ID: 1096485027

View in Genome Browser
Species Human (GRCh38)
Location 12:51974249-51974271
Sequence TAGCTCTGACCTCTTGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096485027_1096485031 -9 Left 1096485027 12:51974249-51974271 CCCATGCCAAGAGGTCAGAGCTA 0: 1
1: 0
2: 1
3: 12
4: 130
Right 1096485031 12:51974263-51974285 TCAGAGCTAGGTTAGTCTCATGG 0: 1
1: 0
2: 1
3: 4
4: 99
1096485027_1096485032 -8 Left 1096485027 12:51974249-51974271 CCCATGCCAAGAGGTCAGAGCTA 0: 1
1: 0
2: 1
3: 12
4: 130
Right 1096485032 12:51974264-51974286 CAGAGCTAGGTTAGTCTCATGGG 0: 1
1: 1
2: 0
3: 3
4: 84
1096485027_1096485034 5 Left 1096485027 12:51974249-51974271 CCCATGCCAAGAGGTCAGAGCTA 0: 1
1: 0
2: 1
3: 12
4: 130
Right 1096485034 12:51974277-51974299 GTCTCATGGGAGACAGTGTTGGG 0: 1
1: 0
2: 0
3: 12
4: 184
1096485027_1096485035 6 Left 1096485027 12:51974249-51974271 CCCATGCCAAGAGGTCAGAGCTA 0: 1
1: 0
2: 1
3: 12
4: 130
Right 1096485035 12:51974278-51974300 TCTCATGGGAGACAGTGTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 204
1096485027_1096485033 4 Left 1096485027 12:51974249-51974271 CCCATGCCAAGAGGTCAGAGCTA 0: 1
1: 0
2: 1
3: 12
4: 130
Right 1096485033 12:51974276-51974298 AGTCTCATGGGAGACAGTGTTGG 0: 1
1: 0
2: 2
3: 23
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096485027 Original CRISPR TAGCTCTGACCTCTTGGCAT GGG (reversed) Intronic
904400463 1:30253521-30253543 TGGCTCTGACCACCTGGCAGGGG - Intergenic
907757118 1:57321423-57321445 CAACTCTCACCTCTTGGCAGAGG + Intronic
907919746 1:58901524-58901546 TGGCTCCTACATCTTGGCATGGG - Intergenic
909190454 1:72542761-72542783 TAGCCCTAACCCATTGGCATGGG + Intergenic
921715555 1:218413736-218413758 TTGCTCTGACCTCTTTCCTTCGG + Intronic
1065602916 10:27387984-27388006 TTCCTCTGACCCCTTGACATGGG - Intergenic
1066061335 10:31725982-31726004 TAGCTGTGACCTCTTTCCTTGGG - Intergenic
1066150564 10:32611862-32611884 TAGCTCTGATCTTTTTGCTTAGG + Intronic
1066218378 10:33310953-33310975 CAGCTCTGACTTTTTGGAATTGG - Intronic
1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG + Intronic
1077047287 11:552176-552198 CAGCTCTGACTTCCTGGCCTTGG + Exonic
1080328447 11:31107192-31107214 GAGCTCTGACCCTTTGGCACGGG + Intronic
1080647374 11:34196902-34196924 TAGCTGTCACCTCTTTTCATGGG - Intronic
1084334106 11:68446910-68446932 TGGCTCTGTCCTCTTAGGATGGG + Intronic
1084821857 11:71697221-71697243 TAGCTTTGTCCTTTTGGCTTAGG + Intergenic
1085237719 11:75028112-75028134 TATCTCTGGGCTCTGGGCATGGG - Intergenic
1085758693 11:79223472-79223494 TAGCACTGACCTCTGAGCAGAGG - Intronic
1086755017 11:90549918-90549940 TAGGTTTGTCCTCTTGCCATGGG - Intergenic
1096485027 12:51974249-51974271 TAGCTCTGACCTCTTGGCATGGG - Intronic
1097765923 12:63526414-63526436 TATCTCTGGCCTCAGGGCATCGG - Intergenic
1098444880 12:70556224-70556246 TAGCTCTGAGATCTAGGTATAGG + Intronic
1102579133 12:113874908-113874930 TGGCTGTGACCTCTTGGTCTGGG - Intronic
1104475174 12:129065138-129065160 TGGCTCTTACCTGTTGTCATTGG + Intergenic
1107557111 13:41526370-41526392 TAGTTCTGACCTCATGGGGTGGG - Intergenic
1109252674 13:60039244-60039266 TAGCTCTCCCCTCTTGGCTCTGG - Intronic
1112361336 13:98721485-98721507 TATCTCTTACCTCTGAGCATGGG + Exonic
1114524170 14:23357763-23357785 TAGCTCTTACCTCTGCCCATCGG + Intronic
1115550650 14:34502098-34502120 AAGCTCTGAGCTCTAGGCCTTGG - Intergenic
1117294047 14:54362657-54362679 TAGCTTTATCCTCTGGGCATTGG + Intergenic
1118705099 14:68472783-68472805 TATCTCCAACCACTTGGCATAGG + Intronic
1118771545 14:68945977-68945999 TGGCTGTGAGCTCTTGGCCTCGG - Intronic
1123166282 14:106328042-106328064 TAGTTGAGATCTCTTGGCATTGG + Intergenic
1123168968 14:106353076-106353098 TAGTTGAGATCTCTTGGCATTGG + Intergenic
1125105483 15:35966198-35966220 TAGGTCTGAACTCTTGGCCATGG + Intergenic
1125745562 15:41995129-41995151 TAGCTCTGACCTCATGCGGTGGG - Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126877533 15:53060419-53060441 CAGTTCTGACCACTTGGCCTCGG + Intergenic
1127385415 15:58462801-58462823 GAGCTCTGGCCTCTCGGCAGAGG + Intronic
1128332853 15:66767282-66767304 TAGAACTGCCTTCTTGGCATGGG + Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1130022591 15:80243525-80243547 TAACTCTGACCTCTTGTCCAAGG - Intergenic
1130883976 15:88078171-88078193 CAGCTCTGTCCTCTTAGCATGGG + Intronic
1134536639 16:15031671-15031693 GAGCCCTGCCCTCTTGTCATTGG + Intronic
1136025252 16:27464528-27464550 GAGCGCTGGCCTCTTGGCAGGGG + Exonic
1138581095 16:57940841-57940863 TGGCTCTGATCTCATGGCATGGG - Intronic
1139667425 16:68467484-68467506 CTCCTCTGACCTCTTGTCATCGG + Intergenic
1140521643 16:75586957-75586979 CAGCTCTGCCCACTTGGCAATGG - Intergenic
1142681430 17:1551370-1551392 CAGCCCTGACCTCTTGGGCTCGG + Intronic
1144455515 17:15415213-15415235 TTGCTCTGACCCTTTGGAATGGG - Intergenic
1150886758 17:69095650-69095672 CAGCTCTCAACTCTTGGAATGGG - Intronic
1153385559 18:4490859-4490881 TAGCTCTGATCCATTGGCCTTGG + Intergenic
1153411671 18:4800215-4800237 CAGCTTTGACCTCCTGGCTTAGG + Intergenic
1155256500 18:24002320-24002342 TTGCTCTTTCCTCTTGGCATTGG - Intronic
1156511656 18:37641809-37641831 CAGCTCTGGCCTCCTGGCAAAGG - Intergenic
1161104090 19:2434690-2434712 GGGCTCTGGCCTCTTGGCATCGG - Intronic
1161208732 19:3055654-3055676 TGGCTCTTACCTCTTGGGAGAGG + Exonic
1162086255 19:8251129-8251151 TAGCTCTGTCCACGTGACATTGG - Exonic
1166381764 19:42358485-42358507 TGCCTCTGACCTCCTGGCCTCGG - Intronic
929305860 2:40360807-40360829 AAGGTCTGCCCTCTTGCCATTGG + Intronic
931690026 2:64827768-64827790 TGGCTCTGACCTCTCGGAAAGGG - Intergenic
933406167 2:81862447-81862469 TTGCTCTGACCTTTCTGCATGGG + Intergenic
933530105 2:83497791-83497813 TAGCTCTGTTCTTTTGGCTTAGG + Intergenic
935503169 2:103867274-103867296 TACCTCTGATCTCATGACATTGG + Intergenic
935680658 2:105634090-105634112 TAGCTATTACTTCTAGGCATTGG + Intergenic
938112645 2:128579139-128579161 TACATCTGACCTCTTCTCATTGG + Intergenic
939113314 2:138033006-138033028 TGGCTCTGAGATCTTGGCCTTGG + Intergenic
939881099 2:147632353-147632375 TAGCTCTGACCTCATTTCCTGGG - Intergenic
944329501 2:198448694-198448716 TCCCTCTGACCCCTTGGGATTGG + Intronic
947469965 2:230392235-230392257 CAGGTCTGGCCTCTTGTCATTGG - Intronic
948666040 2:239535539-239535561 TTCCTCTGACCTGTTGGCCTCGG - Intergenic
1170532309 20:17306741-17306763 TTGCTCTGAACTCTTTACATAGG - Intronic
1173226990 20:41167933-41167955 CAGCTCAGGCCTCTGGGCATAGG + Intronic
1173807970 20:45938671-45938693 GAGCTCTGACCACCTGGCCTGGG + Intronic
1174719116 20:52792290-52792312 TAGCTCTGAGCTCTTGAAAGAGG + Intergenic
1175425321 20:58861384-58861406 CATCTCTGACCCCTTGGAATAGG + Intronic
1180185432 21:46136923-46136945 CAGCTCTGCCCTCTGGGGATGGG + Intronic
1183569194 22:38639506-38639528 TAAATCTGACTTCTTGACATTGG - Intronic
952327837 3:32336933-32336955 CAGCTATGACCCCTTGGCCTTGG - Intronic
955353498 3:58211210-58211232 CAGCTCTGACATCTAGTCATCGG + Exonic
955423720 3:58765974-58765996 TATCTCTGACCTCCTGAAATTGG - Intronic
956842782 3:73155948-73155970 TAACCCTGACGTCTGGGCATTGG - Intergenic
957927762 3:86836811-86836833 TACGTCTGACCTCTAGGCTTAGG + Intergenic
960730784 3:120724499-120724521 CAGCTTTGTCCTTTTGGCATAGG - Intronic
966435575 3:179880044-179880066 GGGCTCTGACTTCTTGGCTTTGG + Exonic
970388983 4:15588185-15588207 TAGCTCTGTCCTTTTAGTATGGG + Intronic
971513994 4:27464007-27464029 TAGCTCTGGGCTCCAGGCATGGG + Intergenic
977153929 4:93549586-93549608 TAGGTCTGACCACTGGGCATTGG - Intronic
978270520 4:106884157-106884179 TAGCTTTGTTCTTTTGGCATAGG - Intergenic
979079679 4:116319878-116319900 TAGCTCTGACCTCTTTTAAGAGG + Intergenic
980416799 4:132499351-132499373 AATCTTTGACATCTTGGCATTGG + Intergenic
980589005 4:134858422-134858444 TACCTCTGACCTCTTATAATGGG + Intergenic
982210429 4:153030294-153030316 TTTCTCTGTCATCTTGGCATTGG - Intergenic
982578767 4:157151932-157151954 TAGCTATAACCTATTGGCATGGG - Intronic
983265017 4:165499643-165499665 TAGCTCTGACCTGTGGGCTGTGG - Intergenic
989316608 5:40087657-40087679 GATCTCTGAGCTCTGGGCATAGG - Intergenic
989403332 5:41032978-41033000 TAGCCCTGAACTCTTGGTAATGG + Intronic
990633402 5:57695762-57695784 TTCCTCTGACTTCTTGCCATTGG - Intergenic
993625808 5:90223489-90223511 TATCTATGACCTCTTTGCTTTGG + Intergenic
995661988 5:114495195-114495217 TGGCTCTGACCTCCTGGCTATGG - Intronic
996662870 5:126025580-126025602 TAGCTCAGAGTGCTTGGCATTGG - Intergenic
1000376973 5:160591875-160591897 TTGCTCTCTCCTCTTGGCTTTGG + Intronic
1004177271 6:13350714-13350736 TAGCTCTGACCTCATCTCATAGG - Intergenic
1005952964 6:30644967-30644989 AAGCTTTGACATCTTGGCAAAGG - Intronic
1006363955 6:33603878-33603900 TAGCTCTGCCCTTGTGGCTTTGG + Intergenic
1006418476 6:33919108-33919130 TATCTCTTTCCTCTGGGCATGGG - Intergenic
1007195994 6:40061149-40061171 TACCTCTGAACTCTTGTCTTAGG + Intergenic
1012137632 6:95578118-95578140 TAGCTGTCGCCTCTGGGCATCGG + Intronic
1015244075 6:131058259-131058281 TGTCTCTTACTTCTTGGCATTGG - Intronic
1017469942 6:154729795-154729817 TGACTCTGACCTCTTGGCCATGG + Intergenic
1021542118 7:21771311-21771333 TAGTGCTGACCTCTGGGTATTGG + Intronic
1023035900 7:36131199-36131221 TATCCCTGCCCTCATGGCATTGG + Intergenic
1024414095 7:49082114-49082136 TGGCTCTGACCCCTTGGCCCTGG + Intergenic
1028073819 7:86485466-86485488 TAGCTTTGATCTTTTGGCTTAGG + Intergenic
1028076608 7:86524731-86524753 TAGCTTTGATCTTTTGGCTTAGG - Intergenic
1029259101 7:99289336-99289358 TAGCTCTGCCACCTTGGCGTTGG - Intergenic
1030592527 7:111499776-111499798 TAGCTCTGCCCTCTGGGCTTTGG + Intronic
1030653239 7:112138588-112138610 TAGCTCTGACTTCCTGGAATTGG - Intronic
1031602374 7:123726441-123726463 TGACTGTGACCCCTTGGCATAGG + Intronic
1031653140 7:124316521-124316543 TAACTCTGGCCTCATGACATTGG - Intergenic
1032480135 7:132239483-132239505 TAGCTCTGCGATCCTGGCATGGG - Intronic
1033220769 7:139525021-139525043 TAGCTCTGACCACCTGGCCTGGG - Intronic
1033449902 7:141453305-141453327 TAACTTTGACTTCTTGGCCTTGG + Intronic
1037297066 8:17413034-17413056 TGGGTCTGACCTCTTGGTTTTGG - Intronic
1039227007 8:35399216-35399238 TTGCTCTGACCTCCTGGAAGTGG + Intronic
1041671876 8:60499893-60499915 TAGCCCTGACGTCCTGGTATTGG + Intergenic
1043533854 8:81178450-81178472 TATATCTGACCTCTGGGCACTGG - Intergenic
1044543997 8:93438637-93438659 TAGCTCTGAACTCTTTGGATGGG - Intergenic
1044789128 8:95828562-95828584 TAGCTCTTCCCTCTTTCCATTGG - Intergenic
1044806222 8:96011027-96011049 TATCACTGATCCCTTGGCATTGG + Intergenic
1047312023 8:123700034-123700056 AAGCTCTGAGCTCTTGGCCTGGG + Intronic
1048846950 8:138611142-138611164 TCTCCCTGGCCTCTTGGCATAGG - Intronic
1050382660 9:5046530-5046552 TAGCTCTTACATTTAGGCATTGG + Intronic
1052849337 9:33367117-33367139 TGGCTCTGTCCTCTTGGCATGGG + Intronic
1053825467 9:42018883-42018905 TATCTCTAAACTCTTAGCATAGG + Intronic
1054605097 9:67168474-67168496 TATCTCTAAACTCTTAGCATAGG - Intergenic
1187520696 X:20011409-20011431 TTGCTTTGAACTTTTGGCATTGG - Intronic
1187884806 X:23879542-23879564 TAGCCCTGCCCTTTTGGCCTTGG - Intronic
1190797458 X:53758816-53758838 TCGCTGTGACCTCTGAGCATCGG + Intergenic
1195369686 X:104161007-104161029 TTGCTATGACCTCTTGTAATTGG + Intergenic
1195974976 X:110516871-110516893 TGTCTATGTCCTCTTGGCATAGG + Intergenic
1196541746 X:116918572-116918594 TAGCTTTGTCCTTTTGGCTTAGG + Intergenic
1196658659 X:118246404-118246426 TAGCTTTGTCCTTTTGGCTTAGG - Intergenic
1199200916 X:145088069-145088091 AAGCTCTGACCCTGTGGCATTGG - Intergenic
1199753697 X:150845188-150845210 CAGCTCTGACTTCTTGGAAAAGG - Intronic