ID: 1096485607

View in Genome Browser
Species Human (GRCh38)
Location 12:51978858-51978880
Sequence CAGGATTGGATCAGAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096485601_1096485607 12 Left 1096485601 12:51978823-51978845 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1096485607 12:51978858-51978880 CAGGATTGGATCAGAGAGACAGG 0: 1
1: 1
2: 0
3: 16
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096485607 Original CRISPR CAGGATTGGATCAGAGAGAC AGG Intronic
901617820 1:10555877-10555899 CAGGAATAGATTTGAGAGACAGG + Intronic
902531635 1:17094374-17094396 CAGGACAGGAGCAGAGGGACTGG - Intronic
904195306 1:28781108-28781130 CAGGATTTGGTCTGAGAAACTGG - Intergenic
904917713 1:33982370-33982392 CAGGACTGGAGCACAGAGTCTGG - Intronic
905505326 1:38475119-38475141 CAGGGTTGAATCAGAGATTCAGG - Intergenic
907729119 1:57048821-57048843 CTGCATTGTAGCAGAGAGACGGG + Intronic
907796544 1:57723978-57724000 CAGGATTGAAGCAGAAAAACAGG - Intronic
909869020 1:80715019-80715041 GAAGAGTGGATCAGAGAGATGGG - Intergenic
911852942 1:102841416-102841438 CTGGATTTTATCTGAGAGACAGG - Intergenic
914806752 1:150997442-150997464 CAGGATTGGGACAGAGAGTAGGG + Intronic
915059014 1:153164393-153164415 CAGCATTGGATTAGAGATTCTGG - Intergenic
918670257 1:187205787-187205809 GAGCATTGTCTCAGAGAGACAGG + Intergenic
919166774 1:193905534-193905556 CAGGATTGGATTTGAGAGGCAGG + Intergenic
921729193 1:218557925-218557947 CAGGACAGGATCAGAGTGAGGGG + Intergenic
922155955 1:223039710-223039732 CAGGAATGGATTAGAGGGGCAGG - Intergenic
922621300 1:226990465-226990487 CAGGGCTGGGCCAGAGAGACGGG + Exonic
924058964 1:240152208-240152230 CAGGACTGGATTAGACAGAGAGG - Intronic
1063431383 10:5992008-5992030 GAGAATTTGATCAGAGAGATGGG + Intergenic
1063918856 10:10911876-10911898 CAGGAATAGATCTGAGAGGCTGG + Intergenic
1064242049 10:13639829-13639851 CAGGATTGGACACGAGAGACTGG + Intronic
1065353916 10:24820753-24820775 CAGCAGTGGATCATGGAGACAGG + Intergenic
1067972651 10:50990942-50990964 GAGGGTTGGATCAGAGAGCCTGG - Intergenic
1069644073 10:69979422-69979444 CAGGATAGCATCATAGAGAGAGG + Intergenic
1069874551 10:71553559-71553581 CAGGCTTGGGACAGAGGGACAGG + Intronic
1071571288 10:86698868-86698890 CAGGATTGAACCAAACAGACAGG - Intronic
1075464413 10:122640977-122640999 GAGGATGGGATGAGAGAGAGTGG + Intronic
1077362626 11:2147454-2147476 CAGCTTTGGCTCAGAGAGGCTGG - Intronic
1081578175 11:44332671-44332693 CAGGTGTGGAACTGAGAGACGGG - Intergenic
1083276000 11:61597514-61597536 TGGGATTAGATCAGAGAGCCAGG - Intergenic
1083708697 11:64534218-64534240 GAGGTTTGGAGCAGAGAGCCTGG - Intergenic
1085451904 11:76639202-76639224 CAGAATGGGGTCAGGGAGACTGG - Intergenic
1086940674 11:92795180-92795202 CAGGATTGTACAAGAGAGACTGG + Intronic
1089153724 11:116384958-116384980 CAGGTTTGGGCCAGGGAGACTGG - Intergenic
1089605885 11:119641075-119641097 CTGGAATGGAGCAGAGAGAAGGG - Intronic
1090264425 11:125345046-125345068 CAGCCTAGGATCAGAAAGACAGG + Intronic
1090712010 11:129395600-129395622 CAGGATGGGTGCAGAGAGAGAGG - Intronic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1096485607 12:51978858-51978880 CAGGATTGGATCAGAGAGACAGG + Intronic
1096780454 12:53988815-53988837 CTGGAATGGAACAGAGAGAAGGG + Intronic
1096882752 12:54685928-54685950 CAGTTGTGGATCACAGAGACAGG - Intergenic
1098342307 12:69465240-69465262 CAGGATTTGACTAGAGATACTGG + Intergenic
1101015659 12:100497470-100497492 CAGAATGGAATCAGAGAGATGGG + Intronic
1101732495 12:107438154-107438176 CAGGGCAGGATCAGAGACACAGG - Intronic
1102899092 12:116622290-116622312 CAGCATTCAATCAGAGAGGCTGG + Intergenic
1104522360 12:129487423-129487445 CAGGAGTGGATGAGGAAGACTGG + Intronic
1104634443 12:130428746-130428768 CAGCATTGTGTCAGAGAGGCAGG + Intronic
1106611479 13:31286930-31286952 GAGGATTGGTTCAGATAGAAGGG - Intronic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1108681421 13:52783844-52783866 CAGGTTTGCATCAGACAGAATGG + Intergenic
1108749488 13:53433171-53433193 CAGGAAATGATCAGAGAGAAAGG - Intergenic
1110684366 13:78354462-78354484 CATAATTGTGTCAGAGAGACAGG - Intergenic
1112717106 13:102199655-102199677 CAGCATGGGATCAGAGAGGTGGG - Intronic
1115084163 14:29493240-29493262 AAGGAGTGGATGAGAGAGAGAGG + Intergenic
1116022666 14:39480791-39480813 AAAGCTTGGATTAGAGAGACTGG - Intergenic
1117201837 14:53398372-53398394 CAAGATTGGATTAGGAAGACCGG + Intergenic
1118093349 14:62507974-62507996 GAGTATAGGAGCAGAGAGACTGG + Intergenic
1118262130 14:64257703-64257725 AAGGATTGGGTCAGACAGGCAGG - Intronic
1121404421 14:93710636-93710658 CTGGATTGGATCAGAGAAGATGG + Intergenic
1121441418 14:93952060-93952082 GAGGAATGGGTCAGGGAGACTGG + Intronic
1123735875 15:23181539-23181561 CAAGATTGGGACAGTGAGACAGG + Intergenic
1124286591 15:28404522-28404544 CAAGATTGGGACAGTGAGACAGG + Intergenic
1124296112 15:28507114-28507136 CAAGATTGGGACAGTGAGACAGG - Intergenic
1125044010 15:35225184-35225206 CAGGATTAGATCAGAATTACAGG + Intronic
1126198158 15:45954713-45954735 AATGAATGGGTCAGAGAGACTGG + Intergenic
1128805562 15:70528458-70528480 AAGGCTTGAATCAGAGAGGCAGG + Intergenic
1129981117 15:79872281-79872303 CAGAATTAGATCAGAGAAAATGG - Intronic
1130052913 15:80498632-80498654 CAGGAATGGCTGAGAGAGGCTGG + Intronic
1130094478 15:80845805-80845827 CTGGATGGGATCAGAGAAAATGG + Intronic
1130354673 15:83118410-83118432 CAGCACTGGCTCAGAGAGCCAGG + Intronic
1130747913 15:86675863-86675885 CTGAATTGGATCAAACAGACGGG - Intronic
1132660003 16:1057113-1057135 CAGCATTGGAGCAGGGAAACTGG + Intergenic
1133171194 16:3983451-3983473 CAGGAGTGGAGCAGAATGACTGG + Intronic
1135544991 16:23359607-23359629 CAGGATGGAGTCAGAGAGAGAGG - Intronic
1135863873 16:26082439-26082461 AGTGATAGGATCAGAGAGACTGG + Intronic
1137425149 16:48373104-48373126 AAGGATGGAAACAGAGAGACTGG - Intronic
1137515396 16:49139044-49139066 CTGGAGTGGAGCAGAGAGCCAGG + Intergenic
1137816332 16:51401323-51401345 CAGCATTGGAGCAGAGAGGATGG - Intergenic
1137896585 16:52219327-52219349 CACGATAAGACCAGAGAGACAGG - Intergenic
1146672975 17:34754661-34754683 CAGGAGTAGAAGAGAGAGACGGG + Intergenic
1146780617 17:35668231-35668253 CAGGATTTGAGCAGAGAGGCCGG - Intronic
1147130342 17:38404170-38404192 GGGGGTTGGATCATAGAGACAGG + Exonic
1147270951 17:39270674-39270696 CAGAATTGGGTGAGTGAGACGGG - Intronic
1148370949 17:47099837-47099859 CAGAATGGGATCTTAGAGACAGG + Intergenic
1152084835 17:78211645-78211667 CAGGAATGGCTGAGAAAGACGGG - Intergenic
1152424981 17:80213907-80213929 CAGGCTTAGAACAGACAGACCGG + Intronic
1152841576 17:82572241-82572263 CAGGATTAGATGAGGAAGACAGG - Intronic
1153690762 18:7591336-7591358 CAGGATTAGATCAGAGAGCTTGG + Intronic
1155300957 18:24428229-24428251 AAGCATTGGATTAGAAAGACTGG - Intronic
1157109161 18:44803426-44803448 CAGGATTGCATCTGATAGCCAGG + Intronic
1157192668 18:45594512-45594534 GAGGAGGGGATCAGAGAGAGAGG - Intronic
1160431600 18:78816863-78816885 CAGCATCCAATCAGAGAGACAGG - Intergenic
1160658655 19:287991-288013 CAGGAGGGGCTCAGAGGGACTGG - Intronic
1166364050 19:42269604-42269626 CAGGACTAGATCAGGGTGACAGG + Intronic
1168149878 19:54440123-54440145 CAGGATGGAGTCACAGAGACTGG + Intergenic
925153693 2:1634691-1634713 CAGGATGGGACTAGAGAGAGGGG + Intronic
925537959 2:4936551-4936573 TAGAATAGGTTCAGAGAGACTGG - Intergenic
926251340 2:11156865-11156887 CAGGCTGGGAGCAGAGAGGCTGG + Intronic
926641802 2:15245237-15245259 GGGGATAGGATCAGAGAGGCAGG - Intronic
926679258 2:15651434-15651456 CTGAATTGGATGAGAGAGAATGG - Intergenic
926693275 2:15752234-15752256 CAGGATTGGATCAGAGAGGCAGG - Intergenic
926711960 2:15889006-15889028 CAGCATTGGATCTGAGTTACTGG + Intergenic
927154585 2:20214099-20214121 CAGGATTACAACAGAGAGGCTGG + Intronic
927457922 2:23273356-23273378 CAGAATTGGAGAAGGGAGACCGG - Intergenic
927872103 2:26630248-26630270 CAGGATAGGGTGAGAGAGACAGG - Intronic
928073630 2:28242442-28242464 CAGGCTTTGCTCAGTGAGACAGG + Intronic
934745057 2:96753863-96753885 GAGGACTGGATCAGATAAACAGG - Intergenic
935839543 2:107094243-107094265 GAGGAGTGGATCAAAGAGATGGG + Intergenic
938397973 2:130964446-130964468 TAGACGTGGATCAGAGAGACAGG - Intronic
939058333 2:137390010-137390032 CAGGATTGGTTCAGCTAAACTGG + Intronic
940486776 2:154306067-154306089 CAGGGCTGGATCAGAGAGGTGGG - Intronic
941554459 2:166959246-166959268 CAGGGTTTGATCAGAGAAAATGG - Intronic
946132716 2:217619705-217619727 TAGAATTGTGTCAGAGAGACAGG - Intronic
948048129 2:234958915-234958937 CAGGGTTGGGTCAGAGGGACTGG + Intronic
948642368 2:239383776-239383798 CAGGAATGGACAACAGAGACTGG + Intronic
1169676074 20:8156377-8156399 CAGGAGTGGAGAAGTGAGACAGG - Intronic
1169729018 20:8766541-8766563 CAGGATGAGATCAGAGAAACAGG + Intronic
1173107982 20:40156043-40156065 GAGCATTTGATCAGGGAGACTGG + Intergenic
1176205041 20:63883669-63883691 CAGGATTGGGTCAGAGCTACAGG - Intronic
1176982346 21:15397776-15397798 CAAGATAGTGTCAGAGAGACAGG - Intergenic
1179026117 21:37680069-37680091 CACTTTTGTATCAGAGAGACAGG - Intronic
1179127015 21:38599518-38599540 CAGGGTTGGAGCAGGAAGACAGG - Intronic
1179415565 21:41195591-41195613 CAGGATTGAAACAGGGAGAATGG - Intronic
1179984569 21:44913447-44913469 CAGGATTGGCTCAGAGACCACGG + Intronic
1181588808 22:23870090-23870112 CAGCACTGGATCAGCAAGACTGG + Intronic
1182933069 22:34193395-34193417 CATGTTTGGACCAGAGATACAGG + Intergenic
1183026521 22:35069621-35069643 CAGGGCAGGAGCAGAGAGACTGG + Intronic
1184021221 22:41822750-41822772 CAGGATTCACTCACAGAGACAGG + Intronic
1184247445 22:43242735-43242757 CAGGCTGGGGACAGAGAGACTGG - Intronic
949093265 3:54833-54855 CAGGATTAGGTCATAGAGACAGG + Intergenic
949285162 3:2394279-2394301 CAGTATCTGATCAGAGGGACAGG + Intronic
949901642 3:8819880-8819902 CAGGATTCTAAGAGAGAGACTGG - Intronic
952515763 3:34103679-34103701 CAGAAGTGGAGCAGAGAAACTGG + Intergenic
952889517 3:38030802-38030824 CAGGATTGGAGCTGAGTGCCAGG - Intergenic
954219780 3:49145928-49145950 CAGGATTGGTGCAGTGAGGCTGG - Intergenic
954247353 3:49342011-49342033 CAGGACAGGATCAGAGAGTGGGG + Intergenic
954847542 3:53572931-53572953 CAGGGTTGCAGGAGAGAGACAGG - Intronic
956724292 3:72144644-72144666 CAGGAGGGAATCAGGGAGACAGG - Intergenic
957033518 3:75270901-75270923 CAGGATTAGGTCATAGAGACAGG + Intergenic
957754366 3:84467509-84467531 CAGCATTGGATCTGACATACAGG - Intergenic
960279974 3:115770325-115770347 GAGGATTTGAACAGAGATACAGG + Intergenic
960460283 3:117925749-117925771 CTGGATTAGATCAGAAATACAGG - Intergenic
963810231 3:149769285-149769307 GAGGGTTGGTTCAGAGAGGCAGG - Intronic
964385857 3:156147076-156147098 CAGGAAGGGAACAGAGAGCCTGG + Intronic
964825167 3:160817888-160817910 CTGGAATGGATAATAGAGACAGG + Intronic
966780100 3:183576855-183576877 CAGGACTGGATGAGAAAGAAGGG - Intergenic
968707490 4:2086945-2086967 GAGGGCTGGATCAGAGAGACTGG - Intronic
969658322 4:8510616-8510638 CAGGATGTGTTCAGAGAGAGAGG + Intergenic
970168393 4:13263743-13263765 CAGGCTCTGATCAGAGAGGCAGG - Intergenic
975494936 4:75027177-75027199 CAGGATTGGATGGGATAGGCAGG - Intronic
975934370 4:79560658-79560680 CAGGTTTGGAACTGAGAGAACGG + Intergenic
976080565 4:81350469-81350491 AAGGGTTGCATGAGAGAGACTGG - Intergenic
977396132 4:96472945-96472967 CAGGATTAGATCAGAGACCTTGG + Intergenic
978101570 4:104848063-104848085 CAGGATTGCACCAGTGAGCCAGG - Intergenic
981627621 4:146776944-146776966 CGGAATTGGAACAGAGAGGCAGG + Intronic
982658490 4:158178052-158178074 CTGGATTGGAAAAGACAGACTGG + Intergenic
983018932 4:162650730-162650752 CAGAGATGGCTCAGAGAGACTGG - Intergenic
984094578 4:175418679-175418701 CAGGCTTGGGTCAGAAAGATTGG - Intergenic
984481858 4:180314397-180314419 AAGAATTGTATGAGAGAGACAGG - Intergenic
985601484 5:837336-837358 GAGAAATGGAGCAGAGAGACAGG + Intronic
988993632 5:36694034-36694056 GAGGATTAGATCAGAAAGAAAGG + Intergenic
991646572 5:68807198-68807220 CAGGATTGTCTCAGAAAAACTGG - Intergenic
992013945 5:72557255-72557277 GAGGAAAGGAGCAGAGAGACAGG - Intergenic
996402264 5:123075184-123075206 CAGGAATGGAACAGAGAGGAGGG + Intergenic
996964746 5:129294562-129294584 CCGGTTTGGTTCAGAAAGACGGG + Intergenic
997904344 5:137800238-137800260 CAGGATTGAATCACACAGCCTGG + Intergenic
998249069 5:140537459-140537481 CCCAATTGGAACAGAGAGACTGG + Exonic
999555400 5:152737011-152737033 CAGGATTGGAGCAGAGGAAAGGG - Intergenic
999766104 5:154742064-154742086 CAGGCATGGATCAGAGAGGTTGG - Intronic
1000646162 5:163762855-163762877 CAGTATGGGAGCAGAAAGACTGG + Intergenic
1004225715 6:13782627-13782649 CAGGATTGGGTCACACAGACTGG - Intergenic
1007114626 6:39334915-39334937 CAGGAGTGGACCAGAGATGCTGG + Exonic
1007351569 6:41277364-41277386 CAGGGATGGGGCAGAGAGACAGG + Intronic
1007570288 6:42885117-42885139 CAGGAGTGGATCACAGGGTCAGG + Intronic
1007655746 6:43450119-43450141 CCGGCCTGGATCAGAGAGAGGGG - Exonic
1007712194 6:43831497-43831519 CAGGGTTGGAGCAGGCAGACAGG - Intergenic
1008217376 6:48810055-48810077 CAGGAGAGCATCAGAGAAACTGG - Intergenic
1010184882 6:73132512-73132534 CAGGTTGGGATCAGACACACGGG - Intronic
1011586972 6:88936700-88936722 CATCATTGCATCAGAGATACTGG + Intronic
1015243985 6:131057209-131057231 CACAAGTGGATGAGAGAGACAGG - Intronic
1016354176 6:143200170-143200192 CAGTATTGGAGCACAGAGAAAGG + Intronic
1016668376 6:146671262-146671284 CAGGAGTGGAACAGCGAGACTGG + Intronic
1016941291 6:149484732-149484754 CAGGGGTGGAGGAGAGAGACTGG - Intronic
1018676448 6:166226370-166226392 CAGGAGTGGATCAGGGAGTGAGG + Intergenic
1019038480 6:169083132-169083154 CAGTGGTGGAACAGAGAGACAGG + Intergenic
1020123310 7:5517962-5517984 GAGGAATGGGTCAGAGAGGCTGG - Intergenic
1021251468 7:18331990-18332012 CAGGACTGGAACACAGATACTGG + Intronic
1023747151 7:43332040-43332062 CAAGATGGGAACAAAGAGACAGG + Intronic
1024824322 7:53372168-53372190 CATGATTACATCAGAGTGACTGG - Intergenic
1030393132 7:108951938-108951960 CAGAATTGGATGAGAAACACTGG + Intergenic
1031224639 7:119020800-119020822 CAGGATTGCAACATAGAGAAAGG + Intergenic
1032192572 7:129773114-129773136 GAGGACTGGAGCACAGAGACAGG + Intergenic
1033012210 7:137634826-137634848 CAGGAGTGGGTCCTAGAGACAGG + Intronic
1034341032 7:150355315-150355337 AAGAATAGGTTCAGAGAGACTGG + Intergenic
1035090371 7:156305389-156305411 CAGGTTTGGATGGGAGAGAGAGG + Intergenic
1037186509 8:16070061-16070083 AAGGATTTAATGAGAGAGACTGG - Intergenic
1037998568 8:23370795-23370817 CAGGAATGCATCTGAGAGCCTGG - Intronic
1038416118 8:27397269-27397291 GAGGAATGGGTCAGAGAGAGGGG + Intronic
1039386900 8:37143943-37143965 CGGGATTGGAATAGAGAGATGGG - Intergenic
1040494916 8:47958128-47958150 GAAGAGTGGGTCAGAGAGACAGG + Intronic
1042422681 8:68610411-68610433 TAGGAATGAATCAGAGAGCCAGG - Intronic
1044616430 8:94147431-94147453 CTGAATTGGAGAAGAGAGACAGG - Intronic
1046353513 8:113047149-113047171 CAGGATGGGATAAAGGAGACAGG - Intronic
1047309896 8:123683165-123683187 CAGGAGCAGAGCAGAGAGACTGG + Intronic
1048290952 8:133181414-133181436 CAGGAATGGTTCAGAGAAAAGGG - Intergenic
1050204590 9:3183184-3183206 TATGATTGGATCTGAGAGGCTGG - Intergenic
1052683259 9:31721744-31721766 CAGGACTGGATGGTAGAGACAGG - Intergenic
1052858235 9:33420421-33420443 TAGGAGTGGAGCAGAGAAACTGG + Intergenic
1059243293 9:112826905-112826927 CAGTGCTGGATCAGACAGACGGG - Intronic
1059276640 9:113103032-113103054 CAAGGTTTGATCAGAGAGAGTGG + Intergenic
1059540331 9:115123919-115123941 CAGGATTGGCACAAATAGACAGG - Intergenic
1061181230 9:129026410-129026432 CAGGATTGGGGCAGAGTGGCAGG - Intronic
1186540360 X:10393823-10393845 CAGCATTGGGCCATAGAGACTGG - Intergenic
1187241969 X:17522080-17522102 CAGGCTTGGAAGACAGAGACAGG + Intronic
1187260343 X:17679698-17679720 GAGGATTGGATCAGGGAAAAAGG - Intronic
1187497081 X:19804399-19804421 CTGGCTTAGATCAGAGAGAGTGG - Intronic
1187592707 X:20735804-20735826 CAGTCTTGGATCAGAGCAACTGG - Intergenic
1188162541 X:26821030-26821052 CAGAATAGGAACATAGAGACTGG - Intergenic
1189669366 X:43391730-43391752 AAAGAAAGGATCAGAGAGACAGG - Intergenic
1192109683 X:68351565-68351587 CACGGCTGGATGAGAGAGACAGG - Intronic
1194093496 X:89605667-89605689 AAGGATTGAATCAGTGAAACTGG + Intergenic
1194613861 X:96077123-96077145 TAGGTCTGAATCAGAGAGACAGG + Intergenic
1194710667 X:97232667-97232689 TGGGATTGGATCAGAGCAACAGG - Intronic
1195937008 X:110135118-110135140 CAGGATTGAGGAAGAGAGACTGG - Intronic
1196647445 X:118133124-118133146 CAGGATTGGTCCAGGGACACAGG + Intergenic
1199289170 X:146087216-146087238 GAGGACTGGATCAGACAGACTGG + Intergenic
1200446124 Y:3261770-3261792 AAGGATTGAATCAGTGAAACAGG + Intergenic