ID: 1096487645

View in Genome Browser
Species Human (GRCh38)
Location 12:51994485-51994507
Sequence GGTCCCCGAAGGAAACCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096487645_1096487647 -4 Left 1096487645 12:51994485-51994507 CCTGAGGGTTTCCTTCGGGGACC 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1096487647 12:51994504-51994526 GACCAGCCCACAGCACACCAAGG 0: 1
1: 0
2: 8
3: 69
4: 337
1096487645_1096487652 4 Left 1096487645 12:51994485-51994507 CCTGAGGGTTTCCTTCGGGGACC 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1096487652 12:51994512-51994534 CACAGCACACCAAGGTGGCCCGG 0: 1
1: 0
2: 2
3: 18
4: 271
1096487645_1096487649 -1 Left 1096487645 12:51994485-51994507 CCTGAGGGTTTCCTTCGGGGACC 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1096487649 12:51994507-51994529 CAGCCCACAGCACACCAAGGTGG 0: 1
1: 0
2: 1
3: 19
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096487645 Original CRISPR GGTCCCCGAAGGAAACCCTC AGG (reversed) Intronic
900097618 1:946419-946441 AGACGCCGAAGGAAACCCTCTGG + Exonic
906179403 1:43805387-43805409 GTTCCCTGAAGGAAACCCAAGGG + Intronic
913962904 1:143353532-143353554 GTTCCCCAACGGAGACCCTCGGG + Intergenic
914057259 1:144179117-144179139 GTTCCCCAACGGAGACCCTCGGG + Intergenic
914121887 1:144787249-144787271 GTTCCCCAACGGAGACCCTCGGG - Intergenic
916599212 1:166276066-166276088 GGTTCCCGAGGGAACACCTCTGG - Intergenic
1065101636 10:22336721-22336743 TGTCACCGAAGGCAACCCCCAGG - Intergenic
1070533488 10:77358260-77358282 AGTCCTCCAAGGAAACTCTCAGG + Intronic
1071301645 10:84260693-84260715 GGTCCCATAAGCAAACCCTGGGG - Intergenic
1078266392 11:9758716-9758738 GGTCCCGGCCGGAAATCCTCAGG - Intergenic
1080418834 11:32092614-32092636 GGTCCCCTGAGGAAACACTTGGG + Intronic
1084691118 11:70727386-70727408 CATCCCCGAAGGAACCCCTCAGG - Intronic
1090917416 11:131177762-131177784 GGTCACAGAAGAAAGCCCTCAGG + Intergenic
1091283786 11:134397065-134397087 GGTCCCGGCATGAAAACCTCAGG + Intronic
1094631530 12:32180231-32180253 GGTCCAGGCAGGAAATCCTCTGG - Intronic
1096105935 12:48997198-48997220 GGCCCCCGAAGTAAACCTGCGGG - Exonic
1096487645 12:51994485-51994507 GGTCCCCGAAGGAAACCCTCAGG - Intronic
1097079337 12:56418348-56418370 GGCCCCTGTAGGAAACCTTCTGG - Exonic
1097299601 12:58004127-58004149 GGTCCTTGAAGGTAACCCTTAGG + Intergenic
1101270006 12:103133113-103133135 GGTCCCTGAAGGGAATGCTCAGG - Intergenic
1103060288 12:117853170-117853192 GGTCCCCAAAGATAACACTCAGG + Intronic
1105484179 13:20810770-20810792 GATCCACTAAGGAAACCCTGAGG + Intronic
1113764281 13:112871099-112871121 GTTCCCCGAGGGAAGCCCCCAGG + Intronic
1123942564 15:25223691-25223713 GGTTCCCTGAGGAAACCCTTGGG - Intergenic
1143705629 17:8696104-8696126 GGTCTCCTAAGTAAACCCACTGG - Intergenic
1143724511 17:8836115-8836137 CGTCCCCCATGGAAGCCCTCTGG + Intronic
1143993132 17:10984013-10984035 GGACCCCACAGGAAACCCACTGG - Intergenic
1151337744 17:73450080-73450102 AGTCCCTGCAGGAAACTCTCAGG - Intronic
1154374693 18:13799289-13799311 GGTCCCCGAAGGCAGCTCCCTGG - Intergenic
1164194890 19:22947716-22947738 TGTCCTCTAAGGAAAACCTCTGG + Intergenic
1168145772 19:54419370-54419392 TGTCCCCGGAGGACACCCCCAGG - Intronic
1202696742 1_KI270712v1_random:131790-131812 GTTCCCCAACGGAGACCCTCGGG + Intergenic
934277895 2:91588804-91588826 GTTCCCCAACGGAGACCCTCGGG + Intergenic
937462161 2:122098883-122098905 GGTCACCCAAGATAACCCTCAGG - Intergenic
938303323 2:130231132-130231154 AGACACCAAAGGAAACCCTCTGG - Intergenic
938453349 2:131443105-131443127 AGACGCCGAAGGAAACCCTCTGG + Intergenic
942449114 2:176098342-176098364 GGGCTCCTAAGGAAACTCTCTGG + Intergenic
943724472 2:191238732-191238754 GGTCTTTGAAGGAACCCCTCAGG + Intergenic
946328558 2:218997322-218997344 AGTCCCACAAGGAAATCCTCAGG + Intergenic
948095148 2:235327453-235327475 GGTCCCTGAGAGAAGCCCTCAGG - Intergenic
1172234154 20:33358544-33358566 GGTCCATGAGGGAAATCCTCAGG + Intergenic
1174201489 20:48809395-48809417 GTTCCCAGAAGGAAGCCCCCAGG - Intronic
1174803067 20:53581461-53581483 GCTTCCCGAAGGAATCCATCTGG - Exonic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1179981604 21:44898891-44898913 TGTCCCCGACGGGAAGCCTCGGG + Intronic
1182293350 22:29298825-29298847 GGTTCCCGAGGGAACCCCTCTGG + Exonic
1185185421 22:49396466-49396488 GGTCCCATAAGGAAACCGCCTGG - Intergenic
949126734 3:454110-454132 GGTCCTGGAACGAATCCCTCAGG + Intergenic
959973923 3:112437202-112437224 TGTCCCCCCAGGAAACACTCAGG + Intergenic
968461375 4:726885-726907 GGTCCCCGCAGGCCTCCCTCAGG + Intronic
969032849 4:4227531-4227553 GTTCCCCAACGGAGACCCTCGGG - Intergenic
972862212 4:43183944-43183966 GATCCCCAAAGGGAACTCTCAGG + Intergenic
974374485 4:61059002-61059024 GTTCCCCAAAAGAAATCCTCAGG - Intergenic
983938478 4:173518975-173518997 GGGCCCCGAAGGCAACCCGGTGG - Intergenic
983939540 4:173525486-173525508 GTTCCAGGATGGAAACCCTCTGG + Intronic
986454093 5:7898485-7898507 GGGCTCAGAAGGAAACCCTGGGG + Intronic
989179554 5:38562955-38562977 GGTACCCGAAGAAAACCCTGGGG - Intronic
990713816 5:58613898-58613920 GGTATCTGAAGGAACCCCTCGGG - Intronic
1001329530 5:170752469-170752491 GGTCCCCCAAGCAGACGCTCTGG - Intergenic
1002900804 6:1408202-1408224 GGTCCCCGAAGGACAGCCTTTGG - Intergenic
1005500197 6:26422715-26422737 GGTTCATGAAGGAAACCCTGGGG - Intergenic
1008030411 6:46688173-46688195 CGTCCACGAAGGACACCCGCAGG - Exonic
1014098373 6:117483247-117483269 TGTCCCCTAAGGCGACCCTCGGG - Intronic
1016633425 6:146258709-146258731 GGGCCCCTGAGCAAACCCTCTGG - Intronic
1016950749 6:149577298-149577320 GTTCCACGAAGGAGACCCACGGG + Intronic
1018727251 6:166623144-166623166 GGTCACCAAAGAGAACCCTCTGG + Intronic
1019112963 6:169732239-169732261 GTTGCCAGAAGGAAACTCTCAGG + Intergenic
1027987171 7:85308207-85308229 GGTAGCCAAAGAAAACCCTCAGG - Intergenic
1032129820 7:129218881-129218903 GATCCCCAAAGAAACCCCTCAGG + Intergenic
1041468081 8:58177947-58177969 GATCCCCGAATGAAAACCACTGG + Intronic
1047776669 8:128077043-128077065 GGCCCCCTAGGGAAACCCGCTGG - Intergenic
1049225158 8:141447090-141447112 AGTCCTCGCAGGAAACCCACTGG + Intergenic
1056395174 9:86175301-86175323 GGTCCCCTTGGGAAAGCCTCGGG + Intergenic
1057502387 9:95605921-95605943 GCTCCAAGAAGGAGACCCTCGGG - Intergenic
1058666245 9:107318572-107318594 GGTCCCCCAAAGATGCCCTCTGG - Intronic
1062297694 9:135841613-135841635 TGTCCCAGAAGGGCACCCTCCGG - Intronic
1062324717 9:136006428-136006450 GGTCCCCCAGGGGCACCCTCAGG - Intergenic
1062384551 9:136303999-136304021 GGCCCACGATGGAAACCCTCAGG + Exonic
1186493471 X:9993107-9993129 TGTCCCGGCAGGAAACCCCCCGG - Intergenic