ID: 1096488015

View in Genome Browser
Species Human (GRCh38)
Location 12:51996646-51996668
Sequence GTGTGTGGGGTAAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 674
Summary {0: 1, 1: 2, 2: 7, 3: 74, 4: 590}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096488015_1096488025 8 Left 1096488015 12:51996646-51996668 CCTTCTGCCCTTACCCCACACAC 0: 1
1: 2
2: 7
3: 74
4: 590
Right 1096488025 12:51996677-51996699 TCTTCCACCTCTGGGGAAGATGG 0: 1
1: 0
2: 2
3: 36
4: 274
1096488015_1096488023 1 Left 1096488015 12:51996646-51996668 CCTTCTGCCCTTACCCCACACAC 0: 1
1: 2
2: 7
3: 74
4: 590
Right 1096488023 12:51996670-51996692 GTCCAACTCTTCCACCTCTGGGG 0: 1
1: 0
2: 0
3: 22
4: 244
1096488015_1096488021 -1 Left 1096488015 12:51996646-51996668 CCTTCTGCCCTTACCCCACACAC 0: 1
1: 2
2: 7
3: 74
4: 590
Right 1096488021 12:51996668-51996690 CAGTCCAACTCTTCCACCTCTGG 0: 1
1: 0
2: 2
3: 14
4: 178
1096488015_1096488022 0 Left 1096488015 12:51996646-51996668 CCTTCTGCCCTTACCCCACACAC 0: 1
1: 2
2: 7
3: 74
4: 590
Right 1096488022 12:51996669-51996691 AGTCCAACTCTTCCACCTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 237
1096488015_1096488027 14 Left 1096488015 12:51996646-51996668 CCTTCTGCCCTTACCCCACACAC 0: 1
1: 2
2: 7
3: 74
4: 590
Right 1096488027 12:51996683-51996705 ACCTCTGGGGAAGATGGAGCAGG 0: 1
1: 0
2: 0
3: 30
4: 325
1096488015_1096488030 22 Left 1096488015 12:51996646-51996668 CCTTCTGCCCTTACCCCACACAC 0: 1
1: 2
2: 7
3: 74
4: 590
Right 1096488030 12:51996691-51996713 GGAAGATGGAGCAGGTCTTTGGG 0: 1
1: 0
2: 0
3: 17
4: 247
1096488015_1096488029 21 Left 1096488015 12:51996646-51996668 CCTTCTGCCCTTACCCCACACAC 0: 1
1: 2
2: 7
3: 74
4: 590
Right 1096488029 12:51996690-51996712 GGGAAGATGGAGCAGGTCTTTGG 0: 1
1: 0
2: 2
3: 22
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096488015 Original CRISPR GTGTGTGGGGTAAGGGCAGA AGG (reversed) Intronic
900040643 1:460358-460380 GTGTGTGGTGTAATGAAAGAAGG + Intergenic
900062073 1:695329-695351 GTGTGTGGTGTAATGAAAGAAGG + Intergenic
900322934 1:2093931-2093953 GAGTGTGGGGCCAGGGCAGAGGG + Intronic
900430128 1:2597453-2597475 GTATAGGGGCTAAGGGCAGAGGG - Intronic
901010978 1:6201957-6201979 GGGTGTGGGGTGAGGGATGAGGG - Intronic
901906676 1:12418319-12418341 GCGTGAGGGGTAAGGGAACATGG - Intronic
902209345 1:14893535-14893557 GGGTGTGGAGGAAGGGAAGATGG - Intronic
902802352 1:18838334-18838356 GTGTGTGGGGGAGGGGCAGGTGG - Intergenic
902846547 1:19115144-19115166 GGGTGGAGGGTAAGGGCGGAGGG - Intronic
902950618 1:19880089-19880111 GTGTGTGGGCTAAAGGCTAAGGG + Intergenic
902996101 1:20226399-20226421 GTGTGTGTGGTAGGGGGAGATGG + Intergenic
903323774 1:22557629-22557651 GAGTGTGAGGTTAGGGCCGATGG - Intergenic
903353308 1:22731074-22731096 GTGAGTGGGGGCAGGCCAGAGGG - Intronic
903539682 1:24089947-24089969 GTGTGGGGGATGAGGGCAGGTGG - Intronic
903548398 1:24141350-24141372 GGGTGGTGGGTCAGGGCAGAAGG + Intronic
904885709 1:33736722-33736744 GTGAGTGGTCTCAGGGCAGAAGG - Intronic
905240213 1:36576376-36576398 GGGGGTGGGGTGAGGGAAGAAGG + Intergenic
905253600 1:36665727-36665749 GAGTGTGGGGAAAGGGTCGAAGG + Intergenic
906147578 1:43569130-43569152 GTGTGTGCGGACAGGGGAGAGGG + Intronic
906151997 1:43592838-43592860 GTGTGTGGGGCATGGGCGGGAGG - Intronic
906466648 1:46087116-46087138 GTGTGTGGGGGAATGGTGGAGGG + Intronic
906641836 1:47445606-47445628 GAGGGTGGGGTAAGGGCCGAGGG + Intergenic
909417070 1:75418022-75418044 GTGTGAGGGGTAAAAGCAAAAGG - Intronic
909459496 1:75893764-75893786 GGGTGTGGGATAAGGGTGGAAGG + Intronic
910359437 1:86400417-86400439 GTGTGTGGGCTAGGGGAGGATGG - Intergenic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
910886875 1:91973157-91973179 TAGAGTGAGGTAAGGGCAGAGGG + Intronic
911187205 1:94915966-94915988 GTGTGTGGGGGCAAAGCAGAAGG - Intronic
912503110 1:110135610-110135632 ATCTTAGGGGTAAGGGCAGAAGG - Intergenic
913090504 1:115473612-115473634 GGATGTGGGGTAAGGGCAGATGG + Intergenic
913176565 1:116278107-116278129 GAGTGTGTGGGAAGGGCAAATGG - Intergenic
913196269 1:116458791-116458813 GTGTGTGGGGTATGGGGAGGGGG - Intergenic
913324517 1:117615120-117615142 CTGAGTGAGGTAAGGCCAGATGG - Intronic
915217510 1:154349909-154349931 GTGTGTGTGTTGGGGGCAGAGGG - Exonic
915286624 1:154857432-154857454 TGGAGTGGGGTAAGGGTAGAGGG - Intronic
915542085 1:156573877-156573899 GAGTGTGGGGAAAGGGTAAAAGG - Intergenic
915658597 1:157382202-157382224 GGGTGTGGGGTGAGGGGAGGGGG - Intergenic
916001472 1:160620352-160620374 GTGTGGGAGGTAAGGGCGGGGGG + Intronic
916017625 1:160764237-160764259 GGGTGTGGGGTAATGGTAGAAGG - Intergenic
916107452 1:161441882-161441904 GTGTGTGGGGCCAGGGAAGAGGG - Intergenic
916109037 1:161449300-161449322 GTGTGTGGGGCCAGGGAAGAGGG - Intergenic
916110624 1:161456681-161456703 GTGTGTGGGGCCAGGGAAGAGGG - Intergenic
916112210 1:161464091-161464113 GTGTGTGGGGCCAGGGAAGAGGG - Intergenic
916113797 1:161471472-161471494 GTGTGTGGGGCCAGGGAAGAGGG - Intergenic
916243825 1:162666571-162666593 GTGTGTGGGGGAAAGGGGGAGGG + Intronic
917134637 1:171777755-171777777 GTATGTGTGGTTGGGGCAGAAGG - Intergenic
918858149 1:189785952-189785974 GTGAGTGGTTTAAGGGGAGAAGG + Intergenic
920222903 1:204417042-204417064 GAGTGTGGGGGGAGGGGAGAGGG + Intergenic
920383766 1:205552384-205552406 CTATGTGGCGGAAGGGCAGAGGG + Intergenic
920498403 1:206471237-206471259 GAGTGTGGGGTAAGTGCACTTGG + Exonic
920830152 1:209457253-209457275 GTGTGTGGGGCAAAGGAAGAGGG - Intergenic
920997311 1:211007458-211007480 GTATGTGGGGCTAGGGGAGAAGG - Intronic
921594768 1:217042594-217042616 GCCTGTGGGGCAAGGGCAGGGGG - Intronic
922025630 1:221746077-221746099 GTGTGTGGGGTAATGGCAGAAGG + Intergenic
922542397 1:226429204-226429226 GAGCGTGGGGGAAGGGGAGAGGG + Intergenic
922735480 1:227976278-227976300 GCTTTTGGGGTCAGGGCAGAGGG - Intergenic
922740421 1:228011197-228011219 GTGTGTGGTGTGTGGGCAGGTGG + Intronic
923393805 1:233540909-233540931 ATCTGTGGGGAAGGGGCAGAGGG + Intergenic
924112450 1:240713531-240713553 GTGTGAGGGCTGAGGGCTGAGGG - Intergenic
924761155 1:246988100-246988122 GGGTGAGTGGAAAGGGCAGAAGG - Exonic
1062805114 10:413682-413704 GGGGGTGGGCAAAGGGCAGAGGG + Intronic
1062805130 10:413778-413800 GGGCGTGGGCAAAGGGCAGAGGG + Intronic
1063022545 10:2144247-2144269 GTGTCTGGGGTGGGGGCAGGGGG - Intergenic
1063192588 10:3710577-3710599 GTGTGTGGCGTATGTGCACATGG - Intergenic
1063268341 10:4478665-4478687 GTGTGTGTGGTCGGGGCACAGGG + Intergenic
1063601677 10:7487345-7487367 GTGTGTGTGGTGAGAGAAGAAGG - Intergenic
1063812480 10:9728488-9728510 GTGTGTCGGGGGAGGGCAGGGGG - Intergenic
1064429198 10:15256819-15256841 GTGTGTGGGCAAGGGGGAGAAGG - Intronic
1064530944 10:16308956-16308978 GTAAGTGGGGTATGGCCAGAGGG + Intergenic
1066050594 10:31631928-31631950 GCTTGATGGGTAAGGGCAGAGGG - Intergenic
1066655971 10:37700479-37700501 GTGTGTGGGGTGGGGGCAGTGGG - Intergenic
1067040461 10:42950744-42950766 GTGTGTGGGGTGGGGGCGGTTGG - Intergenic
1067511537 10:46898904-46898926 GTGTGTGTGGGAAGGGGAGGTGG + Intergenic
1067668108 10:48295871-48295893 GGGTGTGGGTGAAGCGCAGAAGG + Intergenic
1068629435 10:59284569-59284591 GTGTGTGGAGTAGGGGGTGAGGG - Intronic
1069791158 10:71021986-71022008 GGGTGTGGGATAATGGTAGAAGG - Intergenic
1069851576 10:71408788-71408810 GTGTCAGGGGCAAGGGCAGAGGG + Intronic
1070284776 10:75074977-75074999 GTTCTTGGGGTAAGTGCAGAAGG - Intergenic
1070416149 10:76191441-76191463 GTGTTTGGGGAAAGGTTAGAAGG - Intronic
1070612907 10:77946439-77946461 GTGTGTGTGGTGAGGGCATTAGG - Intergenic
1071267380 10:83976235-83976257 GGGTGTGGGATAAGGGTGGAAGG - Intergenic
1071304451 10:84285842-84285864 TTTTGTGGGGTGAGGGGAGAGGG + Intergenic
1071312001 10:84351893-84351915 ATGTATTGGGTAAGGGCAGGTGG + Intronic
1071350387 10:84734772-84734794 GTGTGTGGGGCAGGGGCAGGAGG + Intergenic
1072914172 10:99527012-99527034 GGAAGTGGGGGAAGGGCAGAAGG + Intergenic
1073121268 10:101123707-101123729 GTGGGTGGGGTGAGCGCCGAAGG - Intronic
1073212737 10:101818148-101818170 GAGGGAGGGGGAAGGGCAGAGGG - Exonic
1073508419 10:104023964-104023986 GTGAGTGGGGAAAGGTGAGATGG - Intronic
1074198863 10:111213982-111214004 GTATGTGGGGTATGGGGAGTTGG - Intergenic
1074347835 10:112705504-112705526 GTGTCGGGGGTAGGGGTAGAGGG - Intronic
1075335554 10:121606650-121606672 GTGGGTGGGGTGGGAGCAGACGG - Intergenic
1076257976 10:129043805-129043827 GTTAGAGGGGGAAGGGCAGATGG - Intergenic
1076680166 10:132167733-132167755 GAGTGAGGGGTAAGGGGTGAGGG - Intronic
1076867737 10:133176274-133176296 GTGGATGGGGGATGGGCAGATGG + Intronic
1076966916 11:96581-96603 GTGTGTGGTGTAATGAAAGAAGG + Intergenic
1077025058 11:436416-436438 GTGTGTGGGGTGGGGGCTGGAGG - Intronic
1077350642 11:2091619-2091641 GAGTGTGGGGTGGGAGCAGAGGG - Intergenic
1077533400 11:3107748-3107770 GTGAGTGGGGCGAGGGCACAGGG - Intronic
1078062481 11:8056897-8056919 GTGTGTGGGGGAAGGGCAAGTGG + Intronic
1078094544 11:8288763-8288785 GTGTGTGTGGAAAGGAAAGAAGG + Intergenic
1078531612 11:12140862-12140884 GTTGGTGGGGGAAGGGTAGAAGG - Intronic
1078535104 11:12166946-12166968 GTGTGTGGGGTGCGGGGAAAGGG + Intronic
1079320542 11:19448137-19448159 GGGGGTGGGGTAGGGGCACAGGG - Intronic
1080435877 11:32243477-32243499 GTGTGTGGGGGAAGGGGCGGGGG + Intergenic
1080524271 11:33098448-33098470 TTGTCAGAGGTAAGGGCAGAGGG + Intronic
1080719667 11:34837006-34837028 GTGAGTTGGCTAAGGGCAGCAGG - Intergenic
1080770095 11:35332716-35332738 GAGTGTGTGTTCAGGGCAGATGG - Intronic
1081296276 11:41393468-41393490 GTGAGAGGGGTAGGGGCAGGGGG + Intronic
1081626076 11:44655977-44655999 GTGTGTGTGTTGGGGGCAGAGGG + Intergenic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1082558850 11:54595436-54595458 GGGGGTGGGGTTAGGGGAGAGGG - Intergenic
1083099854 11:60292037-60292059 GTGTGTGGGGCGGGGGCAGGTGG - Intronic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1083997633 11:66279931-66279953 TTCTGTGGGGTAGGGGCAGGAGG + Intronic
1085049923 11:73375233-73375255 GGTTGTGGGGGAAGGGCATAAGG - Intergenic
1085619956 11:78030605-78030627 GTGAGTGAGGGGAGGGCAGAAGG - Intronic
1088094444 11:106081857-106081879 GTGGGTGGGGGAAGGGGGGAGGG + Intronic
1089197544 11:116703491-116703513 GGCTGTGGGGGAAGGGAAGAGGG - Intergenic
1089364127 11:117910648-117910670 GTGTGGGAGTAAAGGGCAGAGGG - Intronic
1089669333 11:120042385-120042407 GTATGTGGGGTAATGGCTAAAGG + Intergenic
1090263505 11:125339547-125339569 GTGTGTGGGGAAAGGCCAAGTGG + Intronic
1090563627 11:127962008-127962030 GTGTGTTTGGTAAGGGCTCAGGG + Intergenic
1090627861 11:128621678-128621700 GTGTGTGGGGCCAGGGGAGGGGG - Intergenic
1090832005 11:130426754-130426776 GTGTCTGGGCTAAGGGCAGCTGG + Intronic
1091273289 11:134332521-134332543 GGGCCTGGGGGAAGGGCAGAGGG - Intronic
1091307524 11:134546141-134546163 GTGTGTGGGGTAAGGTGTGTGGG - Intergenic
1091307528 11:134546155-134546177 GTGTGTGGGGTAAGGTGTGTGGG - Intergenic
1091791997 12:3277292-3277314 GTGGGTGGACTAGGGGCAGATGG - Intronic
1092913973 12:13172853-13172875 CTGTGTAGGGTAAGGATAGATGG - Intergenic
1093032147 12:14298155-14298177 GGGTATGGGGTAATGGTAGAAGG - Intergenic
1093682065 12:22014139-22014161 TTCTGTGGGGGAAGGGAAGAGGG - Intergenic
1094106541 12:26817844-26817866 TTGAATGGGGTAGGGGCAGAGGG + Intronic
1094272469 12:28632051-28632073 GTGTATGGGGAAAGTACAGAGGG - Intergenic
1094393758 12:29982092-29982114 TTGTGTGGGGTGGGGGCAGGGGG - Intergenic
1094573389 12:31661935-31661957 GTGTTTGGGGAAAGGACTGATGG + Exonic
1095085791 12:38056516-38056538 GGGTGTGGGGTGAGGACGGAGGG - Intergenic
1096230461 12:49894003-49894025 GGGTCTGGAGGAAGGGCAGAGGG + Intronic
1096488015 12:51996646-51996668 GTGTGTGGGGTAAGGGCAGAAGG - Intronic
1096752682 12:53772052-53772074 TTGTGTGTGGTGAGGGCAGGGGG - Intergenic
1096840299 12:54375793-54375815 GTGGGTGGGGCAGGGGCAGCAGG - Intronic
1097261965 12:57725444-57725466 GTTTGTGGGGAAGGGGCAGGGGG + Intronic
1097753930 12:63388078-63388100 GTCTGTGGGGTAACAGCACAGGG + Intergenic
1098158150 12:67621663-67621685 GGGTGTGGAATAATGGCAGAAGG + Intergenic
1098457286 12:70689033-70689055 GTGAATGGGGAAAGGGGAGATGG + Intronic
1098590698 12:72208175-72208197 GTGTGTGTATAAAGGGCAGAGGG - Intronic
1098954043 12:76670243-76670265 GTGTTTGGGGTAGAGGAAGAGGG + Intergenic
1099354988 12:81622779-81622801 ATCTGAGGGGTAGGGGCAGAAGG - Intronic
1099640649 12:85279959-85279981 GGGGGTGGGGTAGGGGCGGAGGG + Intergenic
1100264771 12:92965277-92965299 GTGTGGGGGTTAAGGGGAGGGGG - Intergenic
1100418627 12:94406483-94406505 GTGTGTGTGGTGGGGGCAGGGGG + Intronic
1100457795 12:94768917-94768939 GTGTGTGGCCCAAGGGCAGCAGG + Intergenic
1101244234 12:102870147-102870169 GTGGGTGGGTTTAGGGGAGAGGG + Intronic
1101314598 12:103617724-103617746 GTTTGTGGGGCAAGGGAAGGGGG - Intronic
1101584376 12:106071859-106071881 GTGTTTGGGGGCAGGGCTGAAGG - Intronic
1102797349 12:115700344-115700366 ATCTGTGTGGGAAGGGCAGAAGG - Intergenic
1102964842 12:117118144-117118166 GGGTGGGGGGTGAGGGAAGAAGG - Intergenic
1103355195 12:120314646-120314668 TTTTGTGGGGTAAGGGTAGAAGG + Intergenic
1104348691 12:128026059-128026081 CAGTGTGGGGTAAGGGCCGGTGG + Intergenic
1104477009 12:129078963-129078985 ATGTGTGGGGTGTGGGGAGAGGG - Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105225326 13:18426339-18426361 GTTTGTGGGGTAAAGGGAGAAGG + Intergenic
1106543415 13:30710538-30710560 ATGTGTGGTATAAGAGCAGAAGG - Intergenic
1107172990 13:37365376-37365398 GTGTGTGTGGGCAGGGCAGGGGG + Intergenic
1108455401 13:50608639-50608661 CTGTGTGGGGAAAGGTCAAAAGG - Intronic
1110189718 13:72716314-72716336 GTGACTGGGGAGAGGGCAGAAGG + Intronic
1110210019 13:72960623-72960645 GTGTGTGGGGAAAGGGTGGCAGG - Intronic
1110410105 13:75195599-75195621 TTGTGGGGGGTAGGGGGAGAGGG - Intergenic
1111542241 13:89684299-89684321 GTCTGTGGGGGAAGGGGAGGGGG + Intergenic
1112780220 13:102892229-102892251 GTGTGTGGGATTGGGGCAGGTGG - Intergenic
1113104423 13:106757773-106757795 GGGTGTGGGGTAAGGGTCGGGGG + Intergenic
1113150754 13:107261262-107261284 CAGTGTGGAGTAAGAGCAGAGGG - Intronic
1113572464 13:111368401-111368423 GTGTGTGGGGTAGGGGGACGGGG + Intergenic
1114009794 14:18354687-18354709 GTTTGTGGGGTAAATGGAGAAGG + Intergenic
1114347745 14:21814489-21814511 GTGGGTGGGGGAAGGGGGGAGGG + Intergenic
1114529790 14:23388550-23388572 GTGTGGGGGGTGAGGGCAGGGGG - Intronic
1114746598 14:25154966-25154988 CTGTGTGGAGTAATGGCAGTGGG + Intergenic
1118142663 14:63101621-63101643 GTGTGTGGGGTGGGGGCGGAGGG + Intronic
1118840435 14:69505885-69505907 GTGAGAGGGATAAGGCCAGAGGG - Intronic
1119532463 14:75372531-75372553 CTGTGTGGGGTAAGCGTAGGGGG - Intergenic
1119776204 14:77250356-77250378 GTGTCTGAGGGAAGGGCAGTGGG - Intronic
1120274790 14:82358827-82358849 GAGTGTGGGGAATGGGCAGAGGG + Intergenic
1120761101 14:88286173-88286195 GTCTGTGGGGTTAGGGGAGGGGG - Intronic
1121113952 14:91330853-91330875 GTGTGTGGGCTAAGGGAAGGCGG + Intronic
1121241892 14:92436877-92436899 GGGTGTGGGTAAAGGGGAGAAGG - Intronic
1121641138 14:95485642-95485664 GGGAGTGGTGTAAGGGGAGAGGG - Intergenic
1122153188 14:99735521-99735543 GAGTGTGGGGCAAGGGAAAATGG + Intergenic
1122378741 14:101286707-101286729 GGGGGTGGGGTGAGGGCAGTGGG - Intergenic
1122414838 14:101544171-101544193 GGGGCTGGGGGAAGGGCAGAAGG + Intergenic
1122452563 14:101822073-101822095 GTGTGTGGGGGGGGGGCAGGGGG - Intronic
1122689235 14:103523681-103523703 GTGTTGGGGGTAGGGGCAGGTGG - Intergenic
1122755201 14:103973327-103973349 GGGTGTGGGGCACGGGCACATGG + Intronic
1122921169 14:104880881-104880903 GTGTGTGGGGTAAGAGGTGAGGG - Intronic
1123144835 14:106118818-106118840 GTCTGTGGAGTAAGGACAGTGGG + Intergenic
1123162391 14:106291209-106291231 ATCTGTGGGGTAAGGACAGTGGG + Intergenic
1127412268 15:58721550-58721572 GTGTGTGGGGTGGGGGCAGAGGG - Intronic
1127773497 15:62248603-62248625 GGTTGTGGGGTGAGGGTAGAGGG - Intergenic
1127876947 15:63119798-63119820 GGGTGTGGGGTTGGGGCTGATGG + Intergenic
1128161547 15:65425978-65426000 GTGTGTGGGGTGGGGGGACATGG + Intergenic
1128179638 15:65590474-65590496 GTGGGTGTGGGAGGGGCAGATGG - Intronic
1128745574 15:70111812-70111834 CTGCGTGGGGGAAAGGCAGATGG - Intergenic
1129759374 15:78120662-78120684 CTGGGTGGGGGCAGGGCAGAGGG + Intronic
1130556265 15:84924511-84924533 GAGTGTGGGGAAAGGGAGGAGGG - Intronic
1131225951 15:90624488-90624510 GTGTCAGGTGTCAGGGCAGAGGG - Intronic
1131458647 15:92603028-92603050 GGGGGAGGGGAAAGGGCAGAGGG - Intergenic
1132140612 15:99390341-99390363 GAGTGTGGTGGATGGGCAGAAGG + Exonic
1132316703 15:100895545-100895567 GTGTATGCGTTAAGGGGAGAGGG - Intronic
1132441260 15:101867254-101867276 GTGTGTGGTGTAATGAAAGAAGG - Intergenic
1132589164 16:718915-718937 GTGTTTGGGCTGGGGGCAGATGG - Exonic
1132673887 16:1113859-1113881 GTGAGTGGGGTGAGGGTAGTGGG - Intergenic
1133427228 16:5703244-5703266 GAGTATGGGGTAAGGGCATTGGG + Intergenic
1133798061 16:9062749-9062771 CTGTCTGGGGTAAGGAAAGAGGG + Intergenic
1133880032 16:9772853-9772875 TTGTTTGGGCAAAGGGCAGAAGG - Intronic
1135295691 16:21277712-21277734 GTGTCTAAGGGAAGGGCAGAGGG - Intronic
1135987869 16:27197398-27197420 GTGTGTGTGGTGAGGGCTGCTGG - Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136043525 16:27598807-27598829 CTGTGAGGGGTAAGGGTAGCAGG + Intronic
1136388259 16:29944136-29944158 ATGCGTGGGATAAGGGCAGAGGG + Intronic
1136520870 16:30795000-30795022 GGGTGGGGGGTGAGGGCAGCAGG - Intergenic
1136536639 16:30903414-30903436 GTGTGCAGGGACAGGGCAGAGGG - Exonic
1136694362 16:32064161-32064183 GTCTGTGGGGTAAGGACAGTGGG - Intergenic
1136794861 16:33007424-33007446 GTCTGTGGGGTAAGGACAGTGGG - Intergenic
1136875048 16:33846961-33846983 GTCTGTGGGGTAAGGACAGTGGG + Intergenic
1137731810 16:50695162-50695184 GGGGGTGGGGTAAGGGCAGAAGG + Intronic
1137835030 16:51583742-51583764 GTGTCTGGGGAAAGAGAAGACGG - Intergenic
1138140166 16:54561154-54561176 GTGTGTGGTGTAAGTGTGGAGGG - Intergenic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1139477207 16:67208675-67208697 GTGGGTGAGGTAGGTGCAGATGG + Intronic
1140656748 16:77148827-77148849 GTGGGTAGGTTAAGGGGAGATGG - Intergenic
1140978523 16:80084181-80084203 GCGCTTGGGGTGAGGGCAGATGG + Intergenic
1141107168 16:81243074-81243096 GGGGCTGGGGTAAGGGGAGAAGG + Intronic
1141466376 16:84208494-84208516 GGGTGTGTGGAAAGGGCACAGGG - Intergenic
1141733775 16:85839296-85839318 ACGTGTGGGGCAAGGGCAGGTGG + Intergenic
1141825066 16:86472973-86472995 GTGTGTTGGCCAAGGGAAGACGG + Intergenic
1142186575 16:88697689-88697711 CTGTGTGGGTGATGGGCAGAGGG - Intronic
1142233353 16:88910086-88910108 GTGCGTGTGGTTAGGCCAGAGGG - Intronic
1142284862 16:89167585-89167607 GCGGGTGGGGGAAGGGCAGCGGG - Intergenic
1142401515 16:89861057-89861079 CAGTGTGGGGTTAGGGCAGACGG + Intronic
1203097122 16_KI270728v1_random:1269075-1269097 GTCTGTGGGGTAAGGACAGTGGG - Intergenic
1142600312 17:1050633-1050655 GTCTGTGGGGGAAGGACAGACGG + Exonic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1143445625 17:7007349-7007371 GTGTGAGGGGGAGGGGCCGAAGG - Intronic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1143723033 17:8827110-8827132 GGGAGTGGGGTCTGGGCAGAGGG - Intronic
1145965104 17:28911393-28911415 GTGTGGTGAGGAAGGGCAGATGG + Intronic
1146544415 17:33725853-33725875 CTCTGTGGGGTCAGTGCAGAAGG - Intronic
1146681246 17:34810018-34810040 GTGTGCATGGTAAGGGCAGGGGG - Intergenic
1146888979 17:36492698-36492720 GTGTCTGGGGTAAGGGATGTGGG - Intronic
1146891532 17:36509455-36509477 GTGTCTTGGGAAGGGGCAGATGG + Intronic
1147121421 17:38337506-38337528 ACTTGTGGGGCAAGGGCAGAAGG - Intronic
1147370901 17:39992361-39992383 GTGTGAGGGCAGAGGGCAGAGGG - Intronic
1147417876 17:40306849-40306871 GTGTGTTCCGTAAGGGGAGAAGG + Intergenic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148156274 17:45426760-45426782 GTGTGTGGACAACGGGCAGAAGG - Intronic
1148605628 17:48927144-48927166 TTGAGTGGGGGAAGGGGAGATGG - Exonic
1148921216 17:51036545-51036567 CTGTGTGTGGTAGGGGGAGAGGG - Intronic
1149435734 17:56631783-56631805 GTGTGTGTGGTGATGGCAGTGGG - Intergenic
1149552643 17:57551640-57551662 GTGGGTGGGGGAAGGGCGGTGGG - Intronic
1150001843 17:61445189-61445211 GGGTGTGGGGTAGGAGAAGAGGG + Intergenic
1150368520 17:64613738-64613760 GTGTGTGGAGGGGGGGCAGAGGG + Intronic
1150566902 17:66349992-66350014 GTGTGTGGGGAAAGGAGAGAGGG + Intronic
1150848230 17:68680582-68680604 GTGGGAGGGGGAAGGGGAGATGG + Intergenic
1152488324 17:80610541-80610563 GTGCTTGAGGAAAGGGCAGAAGG + Intronic
1152605886 17:81289855-81289877 GTGTGTGGGGTGAGGGCCTCTGG - Intronic
1152675975 17:81641459-81641481 CTGTGTGGGGCAAGCGGAGATGG - Intronic
1152863404 17:82709076-82709098 GGGTGGGTGGTAAGGGGAGAGGG - Intergenic
1153373764 18:4352736-4352758 GTGTGTGTTTTAAGGGCATAAGG - Intronic
1153533879 18:6079266-6079288 GTGTGTTGGGGAAGTGCAGGTGG - Intronic
1153985514 18:10347227-10347249 GGGTGTGGGGTTCGGGCTGAGGG + Intergenic
1154528045 18:15313182-15313204 GTTTGTGGGGTAAAGGGAGAAGG - Intergenic
1155023806 18:21922462-21922484 GTGTTTGGGGAAAGGGATGAAGG + Intergenic
1155510592 18:26572589-26572611 GTGTGTGGGGTTATGGCAATGGG + Intronic
1157065452 18:44343837-44343859 AAGTGTGGGGTAATGTCAGAAGG + Intergenic
1157208235 18:45718835-45718857 GGTTGTGGGGCAAAGGCAGAAGG - Intergenic
1157575101 18:48738444-48738466 GTGTGAAGGGGGAGGGCAGATGG - Intronic
1157733787 18:50028512-50028534 GAGTGGGGGGCAAGGACAGAAGG + Intronic
1159652235 18:70990572-70990594 GTGGGTGGGGGGAGGGGAGAGGG + Intergenic
1159813631 18:73046749-73046771 GTGTGTTGGGTAAGGGGTGCAGG - Intergenic
1159917575 18:74200251-74200273 GAGTGTGGGGCATGGACAGAAGG + Intergenic
1160134919 18:76263669-76263691 GTGAGTGGGGTGCGGGCAGGAGG - Intergenic
1160514860 18:79472638-79472660 GTGTGTGGGGTGAGGGGAGGGGG - Intronic
1160521185 18:79509134-79509156 GTGTGTGGGCTCCGGGGAGAGGG + Intronic
1160605621 18:80047417-80047439 CTGTGTGGGGTAAGGACAGTAGG + Intronic
1160643719 19:166204-166226 GTGTGTGGTGTAATGAAAGAAGG + Intergenic
1161043330 19:2121594-2121616 GTGTGGTGGGGCAGGGCAGAGGG - Intronic
1161258846 19:3324535-3324557 CTGTGAGGGGTGAGAGCAGAGGG - Intergenic
1162145162 19:8608895-8608917 GTGTATGGGGTAGGGGGAGGAGG + Intronic
1162185706 19:8903340-8903362 GTCTTTGGAGTAGGGGCAGAGGG + Intronic
1162804268 19:13128918-13128940 GTGTGGGGGACAAGGGCAGGAGG - Intronic
1163174529 19:15555173-15555195 GTGTATGGAGTAAGGGCTTAAGG + Intergenic
1163337502 19:16682836-16682858 GTGTGCGGGGTCAGGGTACAGGG + Intronic
1163611258 19:18302955-18302977 TTCTGTGGGGAAGGGGCAGAGGG - Intergenic
1164329332 19:24237225-24237247 GTGGGTGGGGGAAGGGGGGAGGG + Intergenic
1165072840 19:33265470-33265492 GTGTGGGTGGTAGGGGCTGAAGG + Intergenic
1165391580 19:35542185-35542207 GTGTGTGGGGTAGGGGACGCAGG + Intronic
1166137416 19:40786071-40786093 GGATGGGGGGCAAGGGCAGAGGG + Intronic
1166532310 19:43550463-43550485 GTGGGTGGGCTCAGGTCAGAAGG - Intronic
1166699532 19:44874301-44874323 GGGTGTGGGGTCAGGTGAGAGGG - Intronic
1167120043 19:47511381-47511403 ATGAGTGAGGTTAGGGCAGAGGG - Intronic
1167270439 19:48502874-48502896 GGGGGTTGGGGAAGGGCAGAGGG - Intronic
1167284778 19:48592857-48592879 GAGTGTGGGGTGTGAGCAGAGGG - Intronic
1167684997 19:50950505-50950527 GTGAGTGGGGTCAGGGCTGGAGG + Intronic
1167978350 19:53251649-53251671 GTGTGTGTGGTAGAGGCAGGGGG - Intronic
1168474957 19:56668899-56668921 GTGTGTAGGGGGAGGGCAGGTGG + Intronic
1168682551 19:58326718-58326740 GTGTGAGGGCTGAGGGCTGAGGG - Intergenic
925058747 2:874934-874956 GGGTGTGGGTTAAAGGCGGAAGG + Intergenic
925089635 2:1143412-1143434 TAGTGTTGGATAAGGGCAGAGGG - Intronic
925520997 2:4745909-4745931 GTGGGTGGGGTGACGGCAGCTGG - Intergenic
926096897 2:10087221-10087243 GTGTGTGTGTTTAGGGGAGAGGG - Intergenic
926473491 2:13292130-13292152 GTGTGTGGGGGAAATGCAGATGG - Intergenic
927468445 2:23354177-23354199 GACTGTGGGGAAAGGGCAGGAGG + Intergenic
927635681 2:24814603-24814625 GTGTGAGTGATGAGGGCAGAGGG - Intronic
927751805 2:25676179-25676201 GGGTATGGAGTCAGGGCAGAGGG - Intergenic
928301340 2:30127964-30127986 GGGTGGGGGGTATGGGAAGAGGG - Intergenic
928475627 2:31624509-31624531 CTGTGTGGGGTGGGGGGAGAGGG - Intergenic
929549917 2:42883478-42883500 GAGTGTGGGGTAATGGTGGAAGG + Intergenic
929873237 2:45775317-45775339 GTGTATGCGGAAAGGGCACAAGG + Intronic
929918683 2:46156856-46156878 GTGTGTGGGAGGTGGGCAGATGG - Intronic
930062937 2:47305867-47305889 GTGTGTGGGGTGAGGGGAACAGG + Intergenic
930241214 2:48937577-48937599 GTGTGTGCTGGAAGGGTAGATGG - Intergenic
931797745 2:65727933-65727955 GTGTGTGGGGGCAGGGGGGAAGG + Intergenic
932332483 2:70905662-70905684 GTGTGTGGGGCAAGGGGATGCGG - Intronic
932489090 2:72107197-72107219 GAATATGGGGTGAGGGCAGAGGG + Intergenic
932680291 2:73818609-73818631 ATGGGTGGGGGAAGGGAAGATGG + Intergenic
934900268 2:98154420-98154442 ATGTGTGCGCTAAGGGAAGAGGG - Intronic
936134197 2:109875279-109875301 GTGTGTAGGGAAAGAGAAGAAGG - Intergenic
936210500 2:110496206-110496228 GTGTGTAGGGAAAGAGAAGAAGG + Intergenic
936465124 2:112741334-112741356 AGGTGTGGTGTAAGGGTAGAAGG - Intronic
936508191 2:113124755-113124777 TTGTGTGGGGTAATGACACAGGG + Intronic
936540815 2:113349523-113349545 CTGTGTGGGGGTAGAGCAGATGG - Intergenic
936939694 2:117871453-117871475 GTGGGTGGGGGAAGGGGGGAGGG - Intergenic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937122553 2:119451126-119451148 CTGCGTGGGGTAGGGGGAGAGGG - Intronic
938527148 2:132144641-132144663 GTTTGTGGGGTAAAGGGAGAAGG - Intergenic
938727738 2:134121681-134121703 GTGTGTGGGGTTCGGGTGGATGG + Intronic
938765824 2:134460024-134460046 GTTGGTGGTGTAAGGGAAGATGG - Intronic
938864192 2:135401452-135401474 TTGTGAGGGGGAAGGGGAGAAGG - Intronic
939010183 2:136837306-136837328 GTGAATGAGGTAAGTGCAGAAGG - Intronic
939648746 2:144735747-144735769 GTGTGTTGGGGAGGGGAAGAGGG + Intergenic
939745124 2:145958371-145958393 GTGGGTGGGGTTGGGGAAGAGGG - Intergenic
940274752 2:151927535-151927557 GAGTTTGGGGAAAGAGCAGAAGG + Intronic
941225189 2:162839050-162839072 GTGTGTGTGTTAGGGGGAGAGGG - Intergenic
941840992 2:170084350-170084372 GTGTGTTTGGTAGGGGGAGAAGG + Intergenic
942248505 2:174028223-174028245 ATGTGAGGGGTGAGGGCAGCAGG - Intergenic
942711649 2:178842971-178842993 GTGTGTGTGTTGAGGGTAGAGGG + Intronic
943615896 2:190092414-190092436 GTCTCGGGGGTAAGGGCACAGGG + Intronic
944483580 2:200181004-200181026 GTCTGTGGGCTGAGGGCTGAAGG + Intergenic
945497499 2:210526624-210526646 GTGTGTGGGGTAGGGGTGGCAGG - Intronic
945549349 2:211200248-211200270 GTGTGTGTGTTAAGGGAATAGGG - Intergenic
945906295 2:215597307-215597329 GGGTGTGGAGGAAGGGCAGAGGG - Intergenic
945912813 2:215669022-215669044 GTGTGGGGGGTGGGGGCGGAGGG - Intergenic
946061056 2:216941925-216941947 GTGGGTGGGGTAAGAGGAGATGG + Intergenic
946420441 2:219561677-219561699 CTGTGAGGGCCAAGGGCAGAGGG - Intronic
947996442 2:234531692-234531714 GGGTGCACGGTAAGGGCAGAGGG - Intergenic
948401051 2:237685703-237685725 GTGGGTGGGGCAAGGCCTGAGGG - Intronic
948459850 2:238123823-238123845 GTGCGTGGGGGCCGGGCAGATGG + Intronic
948547979 2:238746111-238746133 GTGTGTGGGGAAAGGAGAGGAGG - Intergenic
948870285 2:240794422-240794444 GTGTGTGGGTAAAGGGCAGATGG - Intronic
948901927 2:240960515-240960537 CTGTGTGTGGCAAGGGCAGGAGG + Intronic
1169194501 20:3675907-3675929 GTGTGTGGGGCAGGGGTAGGGGG - Intronic
1169355222 20:4899631-4899653 GTGTGTGGGGTACGACCAGTGGG - Exonic
1169540315 20:6592617-6592639 GTGTGTGTGGTAGGAACAGAGGG + Intergenic
1169870803 20:10246312-10246334 GTATGTGAGGTGAGGGGAGAAGG + Intronic
1170284287 20:14689054-14689076 GTGAGTGGGGGAAGCACAGAAGG - Intronic
1170762455 20:19262913-19262935 GTGGGTGGTGAAAGGGCAAATGG - Intronic
1170819446 20:19743989-19744011 GTAGGTGGGCTAAGGGAAGAAGG - Intergenic
1170908512 20:20539760-20539782 GTGGTTGGGGTAGGGGGAGATGG - Intronic
1171256861 20:23695308-23695330 GTGTGTGGGGAAAAGAAAGAGGG - Intergenic
1171330432 20:24332606-24332628 TTGTGTTGGATAAGGCCAGAAGG + Intergenic
1171946386 20:31381961-31381983 GTGGGTGGGGACAGGGAAGAGGG + Intronic
1171977149 20:31602705-31602727 GTGTGTGTGGTAAGGGGATGAGG + Intergenic
1172233582 20:33353900-33353922 GTGTGTTGAGTAAGGGCTGCAGG - Intergenic
1172522449 20:35576735-35576757 GTGGGTAGGGGATGGGCAGATGG + Intergenic
1173403483 20:42745092-42745114 GTTAGTGGGGAAATGGCAGAGGG + Intronic
1173404490 20:42752969-42752991 GTGTTTGGGGTCGGGGCAGGGGG + Intronic
1173575780 20:44112318-44112340 GTGGGTGGGGTGAGGGCCAAAGG - Exonic
1173932242 20:46830450-46830472 GTGTGTGTGGCAGGGGCAGAGGG - Intergenic
1174189113 20:48727722-48727744 GGGCTTGGGGTAAGGGCACATGG - Intronic
1174571570 20:51505823-51505845 GGGTGTGAGTTAGGGGCAGACGG - Intronic
1174818578 20:53708374-53708396 ATGTGTGGGTTAAAGGCAGCAGG + Intergenic
1175020206 20:55838942-55838964 GAGTATGGAGGAAGGGCAGATGG - Intergenic
1175108878 20:56631735-56631757 GAGTGCGGGGTGGGGGCAGAAGG - Intronic
1175202056 20:57284828-57284850 GTGTTTGGGGGCAGGGTAGAAGG - Intergenic
1175239565 20:57536997-57537019 CTGGGTGGGGTGAGGGAAGAGGG - Intergenic
1175825870 20:61936364-61936386 GGGTGTGGGGGAAGGGGAGGGGG - Intronic
1176142263 20:63549956-63549978 GTGTGCGGTGCAAGGGCAGCAGG - Intronic
1176546597 21:8204970-8204992 TTGTGTGGGGTTGGGGCAGAGGG + Intergenic
1176554491 21:8249161-8249183 TTGTGTGGGGTTGGGGCAGAGGG + Intergenic
1176565548 21:8388017-8388039 TTGTGTGGGGTTGGGGCAGAGGG + Intergenic
1176573413 21:8432185-8432207 TTGTGTGGGGTTGGGGCAGAGGG + Intergenic
1176769381 21:13055362-13055384 GTGTGTGGGGTAAAGGGAGAAGG + Intergenic
1178283781 21:31307736-31307758 AAGTGAGGGGTAAGGGGAGAGGG + Intronic
1179031563 21:37724724-37724746 GTGTGTGGGGCTAGAGCTGAGGG + Intronic
1179925922 21:44533970-44533992 GGGTGCGGGGGCAGGGCAGATGG + Intronic
1180434294 22:15285496-15285518 GTTTGTGGGGTAAATGGAGAAGG + Intergenic
1180516481 22:16149306-16149328 GTTTGTGGGGTAAAGGGAGAAGG + Intergenic
1180615405 22:17122764-17122786 GTGTGTGGGGGAGGTGGAGATGG - Intronic
1180664897 22:17502951-17502973 GTGTGTGTGTTAAGGGGACAAGG - Intronic
1181862378 22:25829007-25829029 GTGGATGGTGTAAGGTCAGATGG + Intronic
1182096706 22:27630660-27630682 GGGTGGGGGGTGGGGGCAGAGGG - Intergenic
1182160098 22:28112888-28112910 GTGTGTGGAGAAAGGACACATGG + Intronic
1183346246 22:37309950-37309972 GTGTGGGAGGCAGGGGCAGACGG - Intronic
1183519753 22:38290016-38290038 CTGTGTTGGGTAAATGCAGATGG + Intergenic
1183705704 22:39473867-39473889 GTGTGTGGGCAGGGGGCAGATGG + Intronic
1184426072 22:44410051-44410073 CTGGGTGGGGCAAGGCCAGAAGG - Intergenic
1184452820 22:44592968-44592990 TGGTGTGGGGGATGGGCAGAGGG - Intergenic
1184734841 22:46391954-46391976 GGGTGTGGGATGTGGGCAGAGGG - Intronic
1184961140 22:47929510-47929532 GGTTGTGGGGAAAGGGAAGAGGG + Intergenic
1185189197 22:49423396-49423418 GTGTGTTGGGTGAAGGCAGAGGG + Intronic
1185189206 22:49423448-49423470 GTGTGTTGGGTGAAGGCAGAGGG + Intronic
1185207896 22:49550654-49550676 GAGTGTGAGGTGAGGACAGAGGG - Intronic
1203251462 22_KI270733v1_random:121236-121258 TTGTGTGGGGTTGGGGCAGAGGG + Intergenic
1203259512 22_KI270733v1_random:166318-166340 TTGTGTGGGGTTGGGGCAGAGGG + Intergenic
949197720 3:1333088-1333110 GTGGGTGGGGTGTGGGTAGATGG + Intronic
949360887 3:3230994-3231016 GTCTGTGGGGTAATGGCATGGGG + Intergenic
950090199 3:10289700-10289722 GAGGGTGGGGTCAGGGGAGAGGG - Intronic
950437652 3:12990272-12990294 GTGTGTGGAGTGAGGCCAGGTGG - Intronic
951827969 3:26889577-26889599 GTGTGTGTGGTGAGGGTTGAGGG - Intergenic
951971048 3:28444128-28444150 GGGTGTGGGATAATGGCGGAAGG - Intronic
952593208 3:34982687-34982709 GTGTGTGGGGTAAGGGAAGAGGG - Intergenic
952917913 3:38263462-38263484 GTGTGTGGGGTGGAGGGAGAGGG - Intergenic
953163810 3:40446233-40446255 GTGTGTGGGCTCCGGGCAGCAGG + Intergenic
953585821 3:44200181-44200203 GGGTGGGGGGTAAGGGGGGAAGG - Intergenic
953748861 3:45594766-45594788 GTGTGTGTGTTGAGGGCAGCGGG - Intronic
955408651 3:58641975-58641997 CGCTGTGGGGTGAGGGCAGATGG + Intronic
956785487 3:72638731-72638753 GGGAGCGGGGTTAGGGCAGAAGG + Intergenic
957583349 3:82105026-82105048 GTGGGTGGGGGGAGGGGAGAGGG - Intergenic
958870995 3:99559133-99559155 GTGTGTGGGGTCGGGGGAGGGGG - Intergenic
962308663 3:134310862-134310884 GTTTGTGGGGCATGGGCAGAGGG - Intergenic
962588219 3:136862851-136862873 GTGGGTGGGGGGAGGGGAGAGGG - Intronic
963955878 3:151253327-151253349 GAGTGAGGGGTAAGAGCGGAAGG - Intronic
963960883 3:151307577-151307599 GTGTGTGTGTTTAGAGCAGATGG + Intronic
964419457 3:156486280-156486302 GAGAGTAGGGTAAGAGCAGAAGG - Intronic
966881611 3:184354054-184354076 GGCTGTGGGTGAAGGGCAGAGGG - Intronic
967033695 3:185631564-185631586 GAGGGTGGGGAAAGGGGAGAAGG - Exonic
967938553 3:194748524-194748546 GTGTGTGCAGTAAGAGCTGAAGG - Intergenic
968350261 3:198047276-198047298 GTGTGTGGGGTCTGGCCAGCAGG - Intergenic
968666531 4:1825383-1825405 GTGAGTGCGGTAGGAGCAGAAGG + Intronic
968887348 4:3341656-3341678 GGGTGTGGGGGGAGGGGAGATGG + Intronic
969457490 4:7308406-7308428 GTGTTTGGGGTGGGGGTAGATGG + Intronic
969500545 4:7549925-7549947 GTGGGATGGGTTAGGGCAGAGGG + Intronic
970017959 4:11533823-11533845 GTGTGTGGTGTTTGGGAAGAGGG - Intergenic
971254818 4:25004652-25004674 CTATGTGGTGAAAGGGCAGAGGG - Intronic
972169752 4:36331607-36331629 GAGTGTGAGGTTAGGGCAGCTGG + Intronic
974057912 4:57002902-57002924 GTGTCTGGGATAAGATCAGAGGG + Intronic
974484952 4:62493254-62493276 GTGTCAGGGGCAAGGCCAGAGGG + Intergenic
975353604 4:73373232-73373254 GGTTGTGAGGTAAGGGCAGATGG - Intergenic
976751925 4:88457568-88457590 CTGTGAGGGGTGAGGGCTGAGGG + Intronic
978868750 4:113548587-113548609 TTTTCTGGGGAAAGGGCAGAGGG - Intronic
980258822 4:130420894-130420916 GTGTGTGGTGTGTTGGCAGAAGG - Intergenic
980609337 4:135137037-135137059 TTTTGAGGGGTCAGGGCAGAAGG + Intergenic
981784357 4:148461176-148461198 GTGTGTGTGTTGGGGGCAGAGGG + Intergenic
982266697 4:153544499-153544521 GTGTGAGGGGTAAGGGAAGAGGG - Intronic
982551330 4:156803447-156803469 GTATGTGTGGTAAAGGCAGGAGG + Intronic
982569634 4:157032105-157032127 CTGTGTGGCATAAGGGCATATGG + Intergenic
982711849 4:158766266-158766288 GAGTGTCAGGTTAGGGCAGAGGG + Intergenic
983170095 4:164525855-164525877 GTCTGAGGGGTAATGGCACAGGG + Intergenic
983319274 4:166175110-166175132 TTGTGTGGGGCAAGAGCAAAAGG + Intergenic
983828450 4:172295720-172295742 GTGTGTGTGGGAGGGGTAGAGGG - Intronic
983846898 4:172531801-172531823 GTGTGGAGGGTAAGGCCAGGTGG + Intronic
984194754 4:176645753-176645775 GTGGGTGGGGAAAAGACAGAGGG - Intergenic
985519676 5:367707-367729 GGGGGTGGTGTCAGGGCAGAGGG - Intronic
985678475 5:1244172-1244194 GTGTGGGGGGTAAGGGGATGGGG - Intronic
986037331 5:3952707-3952729 GGGTGTGGGATAATGGTAGAAGG - Intergenic
986260565 5:6142384-6142406 CTGTGAGGGGTAAGGGAAGCAGG + Intergenic
986497352 5:8358000-8358022 GTGTGTGAGGTTCTGGCAGAAGG - Intergenic
986671548 5:10147140-10147162 CTGTGTGGGGTAGGGGAATATGG - Intergenic
986720385 5:10556832-10556854 GTGGGTGGGGCAGGAGCAGATGG + Intergenic
986806154 5:11310826-11310848 ACGTGTGGGTTAAGGGCACATGG - Intronic
986806177 5:11310993-11311015 GTGTGTGGGGTGAGGGTGCATGG - Intronic
986806314 5:11311840-11311862 GTGTGTGGGGTGAGGGTGTATGG - Intronic
986968256 5:13301580-13301602 GTGTGTTGGGTGAGGGGAGGTGG + Intergenic
987544348 5:19293205-19293227 GTGTGTGTGGTGGGGGGAGATGG + Intergenic
987621539 5:20342640-20342662 GAGTGTGGGATAATGGCAGAAGG + Intronic
989262487 5:39433798-39433820 GTGTGTGGGCCAAGGGTGGAGGG - Intronic
989445399 5:41522705-41522727 GAGTGTGGGGGCAGGGGAGAAGG - Intergenic
989942347 5:50168940-50168962 GGTTGTGGGGTGAGGGGAGAGGG - Intergenic
990514157 5:56516705-56516727 GAGGGTGGGCTGAGGGCAGAAGG + Intronic
991127875 5:63088064-63088086 GTGTGTTGGGCTAGGGAAGAGGG + Intergenic
991574687 5:68090674-68090696 GTGTGTGGGGGGTGGGCAGAGGG - Intergenic
992023591 5:72649510-72649532 GTGTGTGGGGGCAGGAAAGAGGG - Intergenic
992416624 5:76558290-76558312 GTGTGAGGGGTAGGGGCTGGGGG - Intronic
993319552 5:86456328-86456350 GGGTGTGGGATAAGGGTAGAAGG + Intergenic
993483927 5:88458504-88458526 TGGGGTGGGGGAAGGGCAGAGGG + Intergenic
993539040 5:89125303-89125325 GTCTGGGGGGTAATGGCACAGGG - Intergenic
993966494 5:94366342-94366364 GTGTCTGGGTTCAAGGCAGAGGG - Intronic
994140929 5:96340337-96340359 GAGTGGGGGTTGAGGGCAGAAGG - Intergenic
994717062 5:103334679-103334701 ATGTGTGGGGAATGGGGAGAGGG + Intergenic
995269840 5:110207731-110207753 GGGTGTGGGATAATGGTAGAAGG - Intergenic
995347294 5:111135333-111135355 GTGTATGGGGTATGGCAAGATGG + Intergenic
995656824 5:114435122-114435144 GGGTGAGGGGTAAGGGGTGAGGG - Intronic
996277330 5:121682795-121682817 CTGTGTGTGGTAGGGGCAGGAGG + Intergenic
996361093 5:122647642-122647664 CTGTGAAGGGTAAGGGGAGAAGG + Intergenic
996542021 5:124640395-124640417 GTGGGTGGGGAAGGGGCAGGGGG - Intronic
996789426 5:127276868-127276890 GTGTGTTGGGGAAGGGGTGATGG + Intergenic
996908980 5:128634294-128634316 GGGTGTGGGATAACGGTAGAAGG - Intronic
996952107 5:129139779-129139801 TTGGGTGGGGTGAGGGGAGAGGG - Intergenic
997335532 5:133106531-133106553 GTGTGTGGGGTGGGGGCGGGGGG + Intergenic
997354003 5:133250691-133250713 GTGTGTGGGAGAGGGGAAGAGGG + Intronic
997975804 5:138440625-138440647 AGGTGGAGGGTAAGGGCAGATGG + Intronic
998169803 5:139865873-139865895 GTAAGTGGGGTGAGGGAAGATGG + Intronic
998170338 5:139868853-139868875 ATGGGTGGGGTAGGGGCAGAGGG + Intronic
998388540 5:141772459-141772481 ATGTGTGGGCCGAGGGCAGAAGG + Intergenic
999776221 5:154814736-154814758 GGGTGTGGGGCAAGGGGAGTGGG - Exonic
1000198605 5:158985837-158985859 GTGTGTGTGAGAAGGGCAGGAGG + Intronic
1000563981 5:162825051-162825073 GTGTGTGGGGCAGGGGTGGATGG + Intergenic
1000847254 5:166297227-166297249 GTGGGTAGGTTACGGGCAGAAGG - Intergenic
1001123139 5:168996378-168996400 GTGGATGGGGGAAGGGAAGAGGG + Intronic
1001705202 5:173736603-173736625 GGGTGTGGGGGCAGGGCGGAGGG - Intergenic
1001806269 5:174589438-174589460 TTGGGAGGGGTTAGGGCAGATGG + Intergenic
1002303985 5:178272821-178272843 GTGTGTGGGGTCAGGCCTGGGGG - Intronic
1002523487 5:179803794-179803816 GTGTGTAGGGAAATGACAGAAGG - Intronic
1002733203 5:181358576-181358598 GTGTGTGGTGTAATGAAAGAAGG - Intergenic
1002751336 6:115531-115553 GTGTGTGGTGTAATGAAAGAAGG + Intergenic
1004684930 6:17934253-17934275 CTGTGTGAGGTCAGAGCAGAGGG + Intronic
1005879315 6:30043034-30043056 GTGTGTGGGGACAGGGAAGATGG + Intergenic
1006410420 6:33870410-33870432 GAGTTTGGGGTAGGGGCAGAGGG + Intergenic
1006474914 6:34247427-34247449 GGGTGTGGGGTTAGGGCGGGTGG + Intronic
1006654892 6:35582471-35582493 GTGAGTGGAGAGAGGGCAGAGGG - Intronic
1006873872 6:37278519-37278541 GGGGGTGGGGTAAGGGCAGAGGG + Intronic
1006942686 6:37763353-37763375 GTGTGGGTGGTAAGGGAAGAGGG + Intergenic
1007107890 6:39295824-39295846 CTGGGTGAGGTAAGGGCCGATGG + Intergenic
1007898309 6:45385419-45385441 GTTTGTGGAATAAGGACAGATGG - Intronic
1009527722 6:64767415-64767437 GAGTATGGGGAAAGGGAAGATGG - Intronic
1009711344 6:67325508-67325530 GTGTGTGGGGTGGGGGGGGATGG + Intergenic
1011093598 6:83633951-83633973 GTGGGTGGGGGGAGGGCGGAGGG + Intronic
1011622673 6:89257488-89257510 GGGTCTGGGGTCAGGGCAGCTGG + Intronic
1012312800 6:97749018-97749040 GAGTGGGGGGCAAGGGGAGAGGG - Intergenic
1012425190 6:99106282-99106304 GAGTGGGTGGTAAGGGCAGGGGG + Intergenic
1012448569 6:99331373-99331395 GTGGGTGGGGTAAGGGATGGAGG - Intronic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1012961857 6:105630517-105630539 GGATGTGGGGTGAGGGAAGAAGG + Intergenic
1014817203 6:125949254-125949276 GTTTCTGGTGTCAGGGCAGAGGG - Intergenic
1015173959 6:130286214-130286236 GTGTGTGAGATAAAGGCAGATGG - Intronic
1015356870 6:132287607-132287629 GTGTATGGGGGTAGGGGAGAGGG + Intergenic
1015467222 6:133560502-133560524 GGGTGTGGGATAAGGATAGAAGG - Intergenic
1017040964 6:150308328-150308350 CTGTGTTGGGTCAGGGCATATGG + Intergenic
1017228112 6:152043356-152043378 GGGTGTGGGCTAATGGTAGAAGG - Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017362662 6:153594453-153594475 GTGTGTGTGTTTAGGGCAGTAGG - Intergenic
1017378264 6:153796889-153796911 TAATGTGGGATAAGGGCAGAAGG - Intergenic
1017865738 6:158441760-158441782 GTGTGTGTGGGAAGGGAAGATGG - Intronic
1018060605 6:160086879-160086901 GTGTGTGTGGTCAGGGTGGAAGG + Intronic
1018871989 6:167790436-167790458 TGGTGGGGGGTAGGGGCAGATGG - Intronic
1019237453 6:170630898-170630920 GTGTGTGGTGTAATGAAAGAAGG - Intergenic
1019543457 7:1561483-1561505 GTGGGCGGGGTGAGGTCAGACGG + Intergenic
1019548234 7:1588796-1588818 GTGAGATGGGTAAGGGAAGATGG + Intergenic
1020122430 7:5512682-5512704 GTGCTTGGGGTCAGGGAAGAAGG - Intronic
1020710034 7:11595347-11595369 GAGTGTGGGGTAATGGTGGAAGG + Intronic
1020905831 7:14062988-14063010 CTGTGTGGGGTGAGGGGAGGGGG - Intergenic
1021168135 7:17365567-17365589 GTGTGTGTGTTGGGGGCAGAAGG - Intergenic
1021513481 7:21458780-21458802 GTGTGTGGGGGGAGGGGAGCGGG - Intronic
1021768124 7:23969690-23969712 GAGTGTGGGGGAAGGGCAGGGGG + Intergenic
1021911179 7:25387112-25387134 GAGTGTGGGGCAATGGCAGGAGG - Intergenic
1022229611 7:28401554-28401576 GTGGTTGGGGAAAGGGGAGAGGG - Intronic
1023346026 7:39271985-39272007 GTGTGTGGGGGTGGGGGAGAGGG + Intronic
1023346716 7:39278359-39278381 GTGTTGGGGGTAAGGGGAGTTGG + Intronic
1023384755 7:39645306-39645328 GTGTGGGAGGTGGGGGCAGAAGG + Intronic
1023965395 7:44961228-44961250 CTGAGGGGGGTAAGGGCTGAGGG + Intergenic
1023981142 7:45070874-45070896 GTTACTGGGGAAAGGGCAGAGGG - Intronic
1024149679 7:46558283-46558305 GCATGTGGGATGAGGGCAGATGG + Intergenic
1024158741 7:46652527-46652549 ATGTGTCTGGTGAGGGCAGATGG - Intergenic
1024395263 7:48859174-48859196 GTGTGTGGGGAAAGGAGTGAGGG - Intergenic
1024399974 7:48913112-48913134 GTGTGTGGGGAAAGGAGTGAGGG + Intergenic
1024728501 7:52228720-52228742 GTGGGTGTGGGAAGGGGAGAGGG + Intergenic
1024760200 7:52586980-52587002 GTGTGAGAGGTTAGGGAAGATGG + Intergenic
1024889973 7:54188840-54188862 GAGTGTGGGCTAAAGACAGAAGG + Intergenic
1025142753 7:56479297-56479319 GGGTGTGGGGTGAAGGCAGCTGG + Intergenic
1025610664 7:63073291-63073313 GGGTGTGGGGTGAAGGCAGCTGG - Intergenic
1025989037 7:66481193-66481215 GTGTGGGGGGTAGGAACAGAAGG - Intergenic
1026148896 7:67771674-67771696 TTGTGTGGGGCCAGGGGAGAGGG - Intergenic
1026636851 7:72090933-72090955 GGGTGTGGGGTAAGAAGAGATGG + Intronic
1027236982 7:76303904-76303926 GGGGGTGGGGTCAGGGAAGAGGG + Intronic
1027311129 7:76954633-76954655 GGGGGTGGGGTATGGGTAGAGGG - Intergenic
1027407101 7:77873324-77873346 GGGTGTGGGATAACGGCGGAAGG - Intronic
1028048011 7:86148004-86148026 GTGGGTAGGGTGTGGGCAGAGGG - Intergenic
1029420623 7:100469960-100469982 GTGGGTGGGGGAAGGGCATCTGG + Intronic
1029479053 7:100802084-100802106 GGCTGTGGGGGAAGGGAAGAAGG - Intergenic
1029983841 7:104903393-104903415 GTGTGTGGGGCAGGGGAAAACGG - Intronic
1030523902 7:110630559-110630581 GGGTGTTGGGTTAGGGCAGCTGG + Intergenic
1031662683 7:124445767-124445789 GTGTGAGGGCTGAGGGGAGAAGG - Intergenic
1032080250 7:128855044-128855066 GGGTGTGGGGTAGAGGGAGACGG - Intronic
1032901327 7:136312280-136312302 GTGTGGGTGGGAAGGGGAGAAGG - Intergenic
1033207594 7:139436309-139436331 GACAGTGGGGGAAGGGCAGACGG - Intergenic
1033777820 7:144632446-144632468 CTGAGTAGGGTAAGGGCAGTCGG - Intronic
1034227468 7:149495152-149495174 GCTTGTGGGGGAGGGGCAGATGG - Intronic
1034422252 7:150996104-150996126 AGGGGTGGGGTAGGGGCAGAGGG - Intronic
1034543792 7:151776810-151776832 GTGTGTGGATTAGGGGCACAGGG + Intronic
1034991725 7:155551689-155551711 GTGTGTGGGGACAGCGCAGCAGG + Intergenic
1035351528 7:158250471-158250493 GAGTCTGGGTTAAGAGCAGATGG - Intronic
1035436593 7:158864078-158864100 GTGTGTGGTGTGGGGGGAGAGGG + Intronic
1035510314 8:175713-175735 GTGTGTGGTGTAATGAAAGAAGG + Intergenic
1036190038 8:6661852-6661874 CTGTGTGGGGAAAGGGCTGATGG + Intergenic
1036635542 8:10547712-10547734 GGGGGTGGGGGAAGGGGAGAGGG - Intronic
1036654627 8:10670226-10670248 GTGTGTAGAGAAAGGGGAGAAGG + Intronic
1037062542 8:14532706-14532728 GTGTGTGGGGGGAGGGCGGGGGG + Intronic
1037463822 8:19139550-19139572 GTGGGGCGGGTGAGGGCAGAAGG - Intergenic
1037521256 8:19682458-19682480 GTGTGTGGGTGAGTGGCAGAGGG - Intronic
1037585117 8:20270732-20270754 GGGTGAGGGGTAAGGCCAGAAGG - Intronic
1037642531 8:20760404-20760426 GTGGGTGGGGTAGGGGGAGTTGG - Intergenic
1038284133 8:26191793-26191815 GTGTGTGGGAAAGGGGCAGCAGG - Intergenic
1038541034 8:28390223-28390245 ATGTGAGGGGTAGAGGCAGAGGG - Intronic
1039147654 8:34466775-34466797 GGCTCTGGGGTGAGGGCAGAAGG + Intergenic
1039341708 8:36657846-36657868 GGGTGTGGGGATGGGGCAGAGGG - Intergenic
1039551193 8:38444277-38444299 ATGTGTGGGGTATGGATAGATGG - Intronic
1041694121 8:60717555-60717577 GGGTGTAGGGGAAGGGCAGGTGG + Intronic
1042128368 8:65561724-65561746 GTGAGTGGGGTAAGAAGAGAGGG - Intergenic
1043372072 8:79606435-79606457 GTGGGTGGGGGAAGTTCAGAGGG + Intergenic
1045305341 8:100952490-100952512 GTGACTGGGGCAAGCGCAGACGG - Intronic
1046578655 8:116064364-116064386 TTGTTTGGAGTAAGGGAAGAAGG + Intergenic
1047975124 8:130122136-130122158 GTGTGTGGGGAATGGGGAGAGGG - Intronic
1048363958 8:133722047-133722069 GTGTGAGAGGAATGGGCAGATGG + Intergenic
1048754531 8:137722308-137722330 GTGTGTGGGCAGAGGGCATATGG + Intergenic
1048788473 8:138077700-138077722 GTGAGTGGGGCATGGGAAGAGGG - Intergenic
1048971160 8:139645621-139645643 GAGTGTGGGGCATGGGCAGGAGG - Intronic
1049469967 8:142770886-142770908 GTGTGCGGGGTAAGGGAGGCGGG - Intronic
1049547227 8:143238677-143238699 GTAGCTGGGGTAGGGGCAGAGGG - Intergenic
1050570374 9:6932099-6932121 GTGTTTGGGGTGGGGCCAGAGGG + Intronic
1050931938 9:11339880-11339902 GTGTGTGGAGTGAGGGCAAGGGG + Intergenic
1052227317 9:26106106-26106128 GGGTGTGGGATAATGGTAGAAGG + Intronic
1052973873 9:34398143-34398165 GGGTGTGGGCAAGGGGCAGATGG - Intergenic
1053016094 9:34663151-34663173 GTGGGTGGGGTGGGAGCAGAGGG + Intronic
1053026302 9:34731409-34731431 TTGGGTGGGAGAAGGGCAGATGG - Intergenic
1053262283 9:36678770-36678792 GTGTTTGGGGTAGAAGCAGAAGG + Intergenic
1053705837 9:40751974-40751996 GTTTGTGGGGTAAAGGGAGAAGG - Intergenic
1053748574 9:41230252-41230274 GTTTGTGGGGTGTGGGCAGTGGG + Intergenic
1053840079 9:42183534-42183556 GTGGGAGGGGGAGGGGCAGAGGG - Intergenic
1054337804 9:63823133-63823155 GTTTGTGGGGTGTGGGCAGTGGG - Intergenic
1054415914 9:64875578-64875600 GTTTGTGGGGTAAAGGGAGAAGG - Intergenic
1054810932 9:69433302-69433324 GTGTGTGAGGTAAGGGTGGAGGG - Intronic
1055007070 9:71520125-71520147 ATGTGAGTGGTAAGGGCACATGG - Intergenic
1056457854 9:86780741-86780763 GTGTGAGGGGTATGGGTAAAGGG + Intergenic
1057346329 9:94254111-94254133 GGGTGTGGGGTAACGGGGGAAGG + Intergenic
1057991783 9:99777869-99777891 GTGTCTGGGGGAAGGGGTGAAGG + Intergenic
1059371092 9:113836973-113836995 GAGTGTGGGGGATGGGAAGAGGG - Intergenic
1059762699 9:117354130-117354152 GTGTGGTGGGGAAGGGCGGAAGG + Intronic
1060217120 9:121745093-121745115 ATGTGGGGGAAAAGGGCAGACGG + Intronic
1060385953 9:123228455-123228477 GTGTGTGGGGTTGGGGGACAGGG + Intronic
1061015124 9:127976996-127977018 GTGGGTGGGGTACGGGTGGAGGG + Intronic
1061063452 9:128262769-128262791 GGTTGTGGGGCAAGGGTAGAGGG - Intronic
1061587585 9:131578778-131578800 GGGTGGGGGGTAAGGGGCGACGG + Exonic
1061809908 9:133156183-133156205 GGCTGTGGGGGAAGGTCAGAGGG - Intronic
1062136347 9:134930372-134930394 GAGTGTGGGATAAAGGGAGAGGG - Intergenic
1062153613 9:135033992-135034014 GTGGGTGGGGTCAGTGGAGAAGG - Intergenic
1062757608 9:138310899-138310921 GTGTGTGGTGTAATGAAAGAAGG - Intergenic
1203445528 Un_GL000219v1:51102-51124 GTGTGTGGGGTGTGTGCAGTGGG - Intergenic
1203467864 Un_GL000220v1:104387-104409 TTGTGTGGGGTTGGGGCAGAGGG + Intergenic
1203475685 Un_GL000220v1:148359-148381 TTGTGTGGGGTTGGGGCAGAGGG + Intergenic
1186837864 X:13455839-13455861 GTGTGGGAGGTAGGTGCAGATGG - Intergenic
1187225788 X:17374930-17374952 GTGTGGGCAGTAAGCGCAGAGGG - Intergenic
1187258313 X:17661413-17661435 GGGTGGGGGGCAAGGGGAGAGGG - Intronic
1187289359 X:17938120-17938142 GTGTGTAGGGTTAGGGAAGTGGG + Intergenic
1187293940 X:17981016-17981038 GTGTTAGGGAGAAGGGCAGAAGG - Intergenic
1188482597 X:30650728-30650750 GTGTGTGTGGTGAGGGCGGCGGG - Intergenic
1189138673 X:38577828-38577850 GTGGTTGGTGTAGGGGCAGAAGG + Intronic
1189241707 X:39529667-39529689 GTGTGTGTGGTGGGGGTAGATGG - Intergenic
1189904058 X:45739499-45739521 GTGTGGGGAGTAAGGGAAAATGG + Intergenic
1190172329 X:48121524-48121546 GTGGGGAGGGGAAGGGCAGAGGG + Intergenic
1190452852 X:50598232-50598254 GTCTGTGGGGTGTGGGTAGAGGG - Intronic
1190585483 X:51935964-51935986 GTGTGCTGGGGAAGGACAGAAGG - Intergenic
1190666944 X:52704831-52704853 GTGTGTGGGGTGGGGGTAGGGGG + Intronic
1190672474 X:52753577-52753599 GTGTGTGGGGTGGGGGTAGGGGG - Intronic
1191735921 X:64387664-64387686 GTGTGTGGGGTTGGGGGTGAGGG + Intronic
1193416911 X:81236861-81236883 GTGTGTGAGGGAAGGACGGAGGG + Intronic
1193667913 X:84346505-84346527 GAGTGTGTGGTATTGGCAGAGGG + Intronic
1195156369 X:102127113-102127135 GAGAGAGGGGGAAGGGCAGAGGG + Exonic
1197206788 X:123797926-123797948 GTGTGGGGGGTGGGGGCAGGGGG - Intergenic
1197408630 X:126087808-126087830 GTGTATGGGGTAAATGCATATGG - Intergenic
1198918788 X:141701964-141701986 GTGAGTGAGATAAGGTCAGATGG + Intergenic
1199503855 X:148539618-148539640 TTGGGTGGGGAAAGGGAAGAGGG - Intronic
1200521008 Y:4209774-4209796 GGGTGTGGGATAATGGTAGAAGG + Intergenic
1200806205 Y:7436167-7436189 GTGAGTGGGGTGAGGGATGAAGG - Intergenic
1200838141 Y:7753053-7753075 TGTTGTGGGGTAAGGGAAGAGGG - Intergenic
1200965039 Y:9027947-9027969 GTGTGTGTGGGAAGGGCAGGGGG - Intergenic
1202148072 Y:21820832-21820854 GTGTGTGTGGGAAGGGCAGGGGG + Intergenic