ID: 1096490544

View in Genome Browser
Species Human (GRCh38)
Location 12:52010415-52010437
Sequence TGGGCTGGCCCCAGCATAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 202}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096490530_1096490544 1 Left 1096490530 12:52010391-52010413 CCCTCCCCCAGCCCCCACATCTG 0: 1
1: 1
2: 12
3: 196
4: 1531
Right 1096490544 12:52010415-52010437 TGGGCTGGCCCCAGCATAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 202
1096490529_1096490544 2 Left 1096490529 12:52010390-52010412 CCCCTCCCCCAGCCCCCACATCT 0: 1
1: 1
2: 19
3: 223
4: 1724
Right 1096490544 12:52010415-52010437 TGGGCTGGCCCCAGCATAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 202
1096490535_1096490544 -4 Left 1096490535 12:52010396-52010418 CCCCAGCCCCCACATCTGGTGGG 0: 1
1: 0
2: 1
3: 30
4: 740
Right 1096490544 12:52010415-52010437 TGGGCTGGCCCCAGCATAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 202
1096490540_1096490544 -10 Left 1096490540 12:52010402-52010424 CCCCCACATCTGGTGGGCTGGCC 0: 1
1: 0
2: 1
3: 17
4: 150
Right 1096490544 12:52010415-52010437 TGGGCTGGCCCCAGCATAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 202
1096490537_1096490544 -5 Left 1096490537 12:52010397-52010419 CCCAGCCCCCACATCTGGTGGGC 0: 1
1: 0
2: 4
3: 18
4: 199
Right 1096490544 12:52010415-52010437 TGGGCTGGCCCCAGCATAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 202
1096490533_1096490544 -3 Left 1096490533 12:52010395-52010417 CCCCCAGCCCCCACATCTGGTGG 0: 1
1: 0
2: 3
3: 31
4: 414
Right 1096490544 12:52010415-52010437 TGGGCTGGCCCCAGCATAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 202
1096490528_1096490544 12 Left 1096490528 12:52010380-52010402 CCTCGAGGCTCCCCTCCCCCAGC 0: 1
1: 1
2: 10
3: 82
4: 745
Right 1096490544 12:52010415-52010437 TGGGCTGGCCCCAGCATAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 202
1096490531_1096490544 0 Left 1096490531 12:52010392-52010414 CCTCCCCCAGCCCCCACATCTGG 0: 1
1: 3
2: 12
3: 156
4: 1249
Right 1096490544 12:52010415-52010437 TGGGCTGGCCCCAGCATAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 202
1096490538_1096490544 -6 Left 1096490538 12:52010398-52010420 CCAGCCCCCACATCTGGTGGGCT 0: 1
1: 0
2: 1
3: 13
4: 229
Right 1096490544 12:52010415-52010437 TGGGCTGGCCCCAGCATAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096490544 Original CRISPR TGGGCTGGCCCCAGCATAGC TGG Intronic
900234893 1:1583731-1583753 TCGGCTGGGCCCAGCACAGATGG + Intergenic
900568972 1:3349030-3349052 GGGGCGGGGCCCAGCATGGCCGG + Intronic
901322625 1:8348952-8348974 TGGACAGGCCTCAGCAGAGCGGG - Intergenic
902287152 1:15414035-15414057 TGGGCTGACAACAGCCTAGCGGG + Intronic
902927351 1:19704904-19704926 TGGGCTGGCAGCTGCCTAGCTGG + Intronic
905600583 1:39246822-39246844 TAAGCTGGCTCCAGCATACCAGG - Intronic
905609590 1:39338750-39338772 TGGGCTGGTCAAACCATAGCGGG - Intronic
906686991 1:47769281-47769303 TGGGCTGGCTTCAGGACAGCAGG + Intronic
911447824 1:98020602-98020624 TGGGCAGGCTCCAGCAAAACAGG - Intergenic
912385973 1:109271326-109271348 TGGGCAGGCACCAGCATGGGAGG + Intronic
912507822 1:110168229-110168251 TTGGGTGGCCCCAGCTTGGCAGG + Intronic
915328225 1:155092246-155092268 TGACCTGGCCCCAGCACATCTGG - Intergenic
919793929 1:201309833-201309855 TAGGCTGTCCCAAGCATGGCAGG - Intronic
922153402 1:223023332-223023354 AGGGCTGGCCCCAGGAGAGAAGG - Intergenic
922232789 1:223701111-223701133 TGAGGTCTCCCCAGCATAGCCGG + Intergenic
922809157 1:228406420-228406442 CGGGCTGGCCCCAGCAGCGCCGG + Exonic
923323024 1:232855253-232855275 TGGGGTGACACCAGAATAGCAGG + Intergenic
924852196 1:247841623-247841645 TGGCTTGGCCCCAGGACAGCAGG + Exonic
1067546437 10:47195724-47195746 TAGGCTGGCCCGAGCAGTGCTGG - Intergenic
1067700017 10:48564655-48564677 TGGCCTGGCCCCAGCACATGAGG - Intronic
1069806896 10:71131890-71131912 AGGGCTGGCCCCACCTTAGGAGG - Intergenic
1069890727 10:71650831-71650853 AGGGCTGCCCCAAGCCTAGCAGG - Intronic
1070564183 10:77590961-77590983 TCGCCTGGCACCAGCACAGCAGG - Intronic
1073614401 10:104978479-104978501 AGATCTCGCCCCAGCATAGCTGG + Intronic
1074135898 10:110626131-110626153 TGAACAGGCCACAGCATAGCAGG - Intergenic
1076549754 10:131270881-131270903 GGGCCTGGCCCCAGCCTGGCAGG - Intronic
1076861727 10:133141083-133141105 TGGGGAGGCCCCAGCCTTGCAGG - Intergenic
1077006333 11:359291-359313 TCTGCCGGCCCCAGCATGGCAGG + Intergenic
1077299916 11:1842096-1842118 GGGGCTGCCCCCAGCACTGCGGG - Intergenic
1080644977 11:34181755-34181777 GGGGCAGGCCACAGCTTAGCGGG - Intronic
1083215569 11:61217138-61217160 TGAGCTGGGCCCATCAAAGCGGG + Intergenic
1083218453 11:61235967-61235989 TGAGCTGGGCCCATCAAAGCGGG + Intergenic
1083765588 11:64840043-64840065 TCAGCTGTCCCCAGCACAGCTGG + Intronic
1083790033 11:64978613-64978635 TGGGGAGGCCTCAGCATGGCGGG + Intergenic
1084788631 11:71459031-71459053 TGTGCTGTACCCTGCATAGCCGG + Intronic
1084788641 11:71459091-71459113 TGTGCTGTACCCTGCATAGCTGG + Intronic
1084788669 11:71459257-71459279 TGTGCTGTGCCCTGCATAGCTGG + Intronic
1085296423 11:75434209-75434231 AGGGCTTGTCCCAACATAGCCGG + Intergenic
1096490544 12:52010415-52010437 TGGGCTGGCCCCAGCATAGCTGG + Intronic
1102002192 12:109564155-109564177 GGGGCTGTCCCCTGCATTGCAGG + Intronic
1102712822 12:114943376-114943398 TGGGCAGCCCCCAGCACAGATGG - Intergenic
1111952249 13:94718009-94718031 AGGCCTGGCCCCAGAACAGCAGG - Intergenic
1112119982 13:96399016-96399038 GAGTCTGGGCCCAGCATAGCTGG - Intronic
1115445933 14:33489747-33489769 TTGGCTGGCCTCAGAATAGGGGG + Intronic
1118359002 14:65040045-65040067 TGGGCGTGCCCCACCATACCCGG - Intronic
1118998215 14:70856905-70856927 TGTAGTGGCCCCAGCACAGCAGG - Intergenic
1119544174 14:75459752-75459774 TGGTCTGTCCCCAGCCCAGCTGG + Intronic
1119568355 14:75647787-75647809 TGCCCTGGCCTCAGCATATCAGG + Exonic
1121211988 14:92214086-92214108 CGGGCTGGCCCCAGGTCAGCTGG - Intergenic
1121832540 14:97064528-97064550 TGGGCTGGCCCAAGTATAGAGGG - Intergenic
1122295111 14:100701090-100701112 TGGGCTGGCCCTAGTCTGGCTGG + Intergenic
1125736837 15:41932914-41932936 TGGGGTGGTCCCAGAATAGACGG - Intronic
1128329490 15:66746266-66746288 TTTTCTGGCCCCAGCAAAGCTGG + Intronic
1129391801 15:75224458-75224480 TGGGCGTGGCCCAGCATGGCGGG - Intergenic
1129697428 15:77748540-77748562 TGAGGTGGCCCCAGCATAGTGGG + Intronic
1130540814 15:84819663-84819685 TGGGCTGGAGCCAACATAGCTGG - Intronic
1132554398 16:566215-566237 TGGACTGGCCCCAGCCCGGCTGG - Intergenic
1133127500 16:3656224-3656246 TGGGAGGGCCCCAACAGAGCAGG + Intronic
1135193562 16:20375735-20375757 TGGCCTGGCCCAAGCATGGCTGG + Intronic
1137477986 16:48827360-48827382 TGGGCTGGACCCAGTAGAGAAGG + Intergenic
1138189629 16:55003809-55003831 TTGCCTGGCCCCAGCATCGAGGG - Intergenic
1138387030 16:56642983-56643005 TGGGCTTCCCACAGCCTAGCTGG - Intronic
1138681074 16:58684116-58684138 TGTGCTGGCTTCAGCAGAGCTGG + Exonic
1141038946 16:80655101-80655123 TGGCCTGGCCCCAGCAGGGATGG - Intronic
1142094628 16:88232921-88232943 TGGTCTGGCCGCCGCCTAGCAGG + Intergenic
1142241923 16:88951282-88951304 TGGACTGGCACCAGCACAGAGGG + Exonic
1142264358 16:89056970-89056992 AGGGCTGCCCCCAGCATCACTGG - Intergenic
1142417012 16:89948740-89948762 GGGGCTGGATCCAGCGTAGCGGG + Intronic
1144782933 17:17816931-17816953 GGGGCTGGCCCCGGCAGAGTGGG - Intronic
1145196659 17:20899945-20899967 TGGTATGGCCCCAGCATGGAGGG + Intergenic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1151732134 17:75917842-75917864 TGGGTTGCCCCCAGCACTGCAGG - Exonic
1152065862 17:78112269-78112291 TGGGCTGGTCCCCGCAGACCTGG + Exonic
1152065874 17:78112307-78112329 TGGGCTGGTCCCTGCAGACCTGG + Exonic
1152091729 17:78251084-78251106 GGGGCTGGCCCCAGGCTTGCCGG - Intergenic
1152787606 17:82257657-82257679 TGGGCTGCCCCCTGCACTGCTGG + Intronic
1152794605 17:82300983-82301005 CGGGCTGGCCCCAGCCGAGAAGG - Intergenic
1153908466 18:9685283-9685305 TGGCCTGACCCCAGCAGAGCCGG + Intergenic
1155191777 18:23437018-23437040 TGGGCTGGCCCCAGCCAAAGTGG - Intronic
1157513383 18:48294520-48294542 TGGGCTGCACCCAGCATTGTAGG - Intronic
1160083473 18:75753155-75753177 TGGTCTGGCCACAGCCTTGCAGG - Intergenic
1160419720 18:78735671-78735693 TGGGCTGGCACCAGCACACGTGG + Intergenic
1160443269 18:78908705-78908727 TGTGCTGTCCCCAGCAGACCAGG + Intergenic
1160822932 19:1066779-1066801 TGGCCGGGCCCCAGCAGGGCCGG - Intronic
1161776136 19:6263280-6263302 TGGCCTGTCCCCAGCAGAGGAGG + Intronic
1162791446 19:13065126-13065148 TGGCCTTGCCCCAGCACAGAGGG - Intronic
1163697723 19:18772406-18772428 TGAGATGGTCCCAGGATAGCGGG - Intronic
1163929014 19:20370770-20370792 TTGGCTGGTCTTAGCATAGCTGG + Intergenic
1164415862 19:28046059-28046081 TGGGCTGGCCCCAGTGAAGATGG - Intergenic
1164416478 19:28050158-28050180 TGGGCTGGCCACAGCAAGGATGG + Intergenic
1164417610 19:28059665-28059687 TGGACTGGCCCCAACCTAGATGG + Intergenic
1164828289 19:31300550-31300572 AGGGATGGCCCCAGGAGAGCTGG + Intronic
1165252729 19:34553797-34553819 CTGGCTGGCCTTAGCATAGCTGG - Intergenic
1168587368 19:57604258-57604280 TGAACTGTCCCCATCATAGCAGG + Exonic
926308532 2:11657814-11657836 TGCGCTGGCCAGAGCATAACTGG + Intergenic
927151745 2:20200187-20200209 TGGCCTGGGCCCTGCAGAGCAGG - Intergenic
927658462 2:24971775-24971797 GGGGCGGGCCCCAGCGTGGCGGG - Intronic
927841049 2:26444452-26444474 TGGTCCAGCCCCAGAATAGCTGG - Intronic
928107004 2:28477035-28477057 TGCGCTGTGCCCAGCATGGCTGG + Intronic
929579056 2:43070273-43070295 TGGGCTTCCCCCAGCTGAGCTGG - Intergenic
929864853 2:45709228-45709250 TGGGCTGGGGCCAGCATACCGGG + Intronic
931460137 2:62443303-62443325 GGGGCTGGCCACAGAATTGCTGG + Intergenic
932620813 2:73264113-73264135 TGGGCCAGCCCCAGGATAGAAGG + Intronic
934274198 2:91564894-91564916 TGGGCTGGCCCTGCCATGGCCGG - Intergenic
937244419 2:120483456-120483478 GGGGCTGGCACCAGCACTGCTGG - Intergenic
938728804 2:134130184-134130206 GGGGCGGGCTCCAGCATGGCGGG - Intronic
939695138 2:145314233-145314255 TGGGGTGGGTCCAGCATAGCTGG - Intergenic
942567966 2:177285379-177285401 TGGAGTGGCCCCAAAATAGCAGG + Intronic
946864295 2:224028793-224028815 TGGGCTCCTCCCACCATAGCTGG - Intronic
947740814 2:232484072-232484094 TGGCCTGGCCCAAGCAGACCCGG + Exonic
947820215 2:233063952-233063974 TGTGCTGGCCCCTGCGTGGCAGG - Intronic
948228695 2:236334099-236334121 TGGGCAGGTCCCACCACAGCTGG - Intronic
948571947 2:238923164-238923186 TGGGCTGGACACAGCATCCCTGG - Intergenic
948949618 2:241240493-241240515 TGGGGTGTGCCCAGCAGAGCAGG + Intronic
948949938 2:241242877-241242899 TGGGGTGCGCCCAGCAGAGCAGG + Intronic
1168829604 20:838384-838406 TGGGCTGGGTCCAGAACAGCCGG + Intronic
1170429048 20:16260249-16260271 CCTGCTGGCCCCAGCATATCAGG + Intergenic
1170750110 20:19137901-19137923 TGTGCTGCCCTCAGCATTGCAGG - Intergenic
1170804306 20:19616568-19616590 TTGGGTGGCCCCAGCATTGGTGG - Intronic
1171297927 20:24034919-24034941 AGGGCTGGCACCAGCACAGATGG - Intergenic
1171516564 20:25743031-25743053 TGCACTGGCCCTAACATAGCAGG + Intergenic
1172113639 20:32561527-32561549 TGTGGTGCCCCCAGCACAGCAGG + Intronic
1173186494 20:40844205-40844227 TGAGCTGTGCCCAGCAGAGCCGG - Intergenic
1174388378 20:50200691-50200713 TGGGCTGGCCCCAGGAAGGCTGG - Intergenic
1174559438 20:51419522-51419544 TATGCTGGCCCCATCATACCAGG - Intronic
1175727052 20:61325652-61325674 TGGGGGGGCCACAGCAAAGCGGG + Intronic
1175730680 20:61351857-61351879 TGGGCAGGCGCCACCATACCAGG + Intronic
1175919021 20:62441401-62441423 AGCGCTTGCCCCAGCACAGCGGG + Intergenic
1176086260 20:63296866-63296888 TGGGCTGCCCCCCGGAAAGCTGG - Intronic
1176180431 20:63747168-63747190 TGTGCTGGCCGCGGCATGGCCGG - Exonic
1176990964 21:15495912-15495934 TGGGCTAGGCCCAGCATGACTGG - Intergenic
1180160899 21:45998257-45998279 CGGGCTGGCCCCAGGACCGCCGG + Intronic
1180700754 22:17780417-17780439 GGGGCTGCCCCCAGAAAAGCTGG + Intergenic
1180839534 22:18952749-18952771 TGTGCTGGCCCCACGGTAGCTGG - Intergenic
1181062371 22:20287730-20287752 TGTGCTGGCCCCACGGTAGCTGG + Intergenic
1184172003 22:42765368-42765390 CGAGCTGGCCCCTTCATAGCTGG + Intergenic
1184255835 22:43286397-43286419 TGGGCTGGCCTCAGCCTTGGTGG - Intronic
1184721388 22:46316112-46316134 AGAGCTGGCCGCAGCATGGCGGG - Exonic
1184877465 22:47284569-47284591 TGGGCTGGCCACAGAGGAGCAGG - Intergenic
1185051727 22:48557587-48557609 TGGTCTCGCCCAAGCATTGCAGG + Intronic
1185188545 22:49418034-49418056 AGGACTGGCCCCAGCCCAGCAGG - Intronic
949909200 3:8886897-8886919 TGTTCTGGCCCCAGCCTACCTGG - Intronic
950286807 3:11751511-11751533 AGGCCTGGCCCCAGCACGGCAGG - Intergenic
952898606 3:38095428-38095450 AGCGCTGGCCCCAGCATGGAGGG + Intronic
953017891 3:39096010-39096032 TGGCCTGCCTCCACCATAGCAGG + Exonic
954258056 3:49419841-49419863 TGGGCTGGACGCTGCAGAGCTGG + Intronic
956813940 3:72890557-72890579 TGGCCTGACATCAGCATAGCAGG - Intronic
960950017 3:122993167-122993189 TGGTCTGGCCGCAGAAAAGCAGG + Intronic
961028510 3:123582289-123582311 TGGTCTGGTCCGAGCATACCTGG - Exonic
961140456 3:124551454-124551476 TGGGGTGGTGCCAGCACAGCTGG + Intronic
961448510 3:126992099-126992121 TGGGCTGGCCCCACGGTGGCAGG + Intronic
961638636 3:128350536-128350558 TGGGCTGGGACCAGAATACCAGG - Intronic
962963111 3:140329734-140329756 TGGCATGGCCCCAGCAAAACAGG + Intronic
964129999 3:153276185-153276207 TGGGCTGTCCCAAGCAAACCAGG - Intergenic
964439619 3:156693694-156693716 TGGGCTGGCCTCAGCCAATCAGG - Intronic
965103788 3:164335052-164335074 TTGGCTGGTCTTAGCATAGCTGG - Intergenic
965608033 3:170515959-170515981 TTCTCTGGGCCCAGCATAGCAGG - Intronic
968036425 3:195551889-195551911 TGGGCAGGCCCCAACCAAGCAGG + Intergenic
968085127 3:195870747-195870769 TGGGCTGGCCACAGCATGCCAGG + Intronic
968634083 4:1668803-1668825 TGCGAAGGCCCCAGCATTGCTGG + Exonic
976902509 4:90196446-90196468 TGGGCTGGCCCCTGGGAAGCGGG - Intronic
985527903 5:416340-416362 TGGTCTGGCCACAGCCTGGCAGG - Intronic
985765768 5:1778597-1778619 TTGGCTGTCCCCAGCTGAGCCGG - Intergenic
986355882 5:6925765-6925787 TGGGTTGACCCCAGCAGAGGAGG - Intergenic
987340034 5:16931609-16931631 TTTGCTGTCCCCAACATAGCAGG + Intronic
989098256 5:37800873-37800895 TGGGCTGGCAACACCATGGCTGG - Intergenic
992638267 5:78746482-78746504 TGGGATGGCCCAAGCACACCAGG + Intronic
993229735 5:85218936-85218958 TGGGCTGGACCAGGCTTAGCTGG - Intergenic
996809525 5:127500313-127500335 TGGGCTGGCCCAAGGAAACCTGG - Intergenic
997473887 5:134131726-134131748 TGGGGTGCCACCAGCCTAGCTGG - Intronic
1002460085 5:179368991-179369013 AGGGCTGGGCCTAGCATAGCAGG - Intergenic
1003784912 6:9474733-9474755 TGGGCTTGAGCCAGCATGGCAGG - Intergenic
1006136994 6:31901551-31901573 CGGGCTCGCCCCATCCTAGCGGG - Intronic
1006935148 6:37712094-37712116 TGGGCTGGCACCAGCTCACCAGG - Intergenic
1011356915 6:86480555-86480577 TTGGCTGGTCTTAGCATAGCTGG + Intergenic
1011776771 6:90739503-90739525 TGGGCGGGGCCCACCACAGCTGG - Intergenic
1017066596 6:150534888-150534910 TGGCCTGGCCACAGCATCGATGG - Intergenic
1017786021 6:157757854-157757876 GGGGTTGGCACCAGCATAGGGGG + Intronic
1019218300 6:170457544-170457566 CGGGCTGGCCCCAGTTTAGGTGG - Intergenic
1019710431 7:2515927-2515949 TTGGCTGGGCTCAGCACAGCCGG - Intronic
1019965800 7:4497337-4497359 TGGGCTGGCCAAGGCAGAGCCGG - Intergenic
1023883504 7:44334957-44334979 TGGAGTGGCCCCAGCCTGGCCGG + Intergenic
1027250069 7:76393444-76393466 TGTGCTGGCCCCAGCCCAGGTGG + Exonic
1028482584 7:91323937-91323959 CTGGCTGACCCTAGCATAGCTGG + Intergenic
1029181597 7:98705765-98705787 TGGGCTGGCCCCTGGGAAGCTGG + Intergenic
1029655682 7:101922851-101922873 TGGGCTGGCCACAGCATGTCAGG + Intronic
1033683606 7:143620288-143620310 TGGGGTGGGCTCAGCAGAGCCGG - Intergenic
1033701006 7:143837350-143837372 TGGGGTGGGCTCAGCAGAGCCGG + Intergenic
1034273537 7:149814515-149814537 TGGTCTGGCCCCTGCAGGGCTGG - Intergenic
1035179936 7:157081956-157081978 TGGGCTGGCTCCAAGAGAGCAGG + Intergenic
1035966373 8:4196619-4196641 AGGACTGGACCCAGCATTGCTGG - Intronic
1036199563 8:6756719-6756741 GGGGCTGGTCCCAGGATACCCGG - Intronic
1036569224 8:9965172-9965194 TAGGCTAACCCCAACATAGCAGG + Intergenic
1039465914 8:37784791-37784813 TGTGCTGTCCCCAGCAGGGCTGG + Intronic
1041859457 8:62495914-62495936 TGGCCTGGAGTCAGCATAGCTGG - Intronic
1047201344 8:122770242-122770264 CTGGCTGGGCCCAGCACAGCTGG - Intergenic
1049399026 8:142416589-142416611 AGGGCTGGGCCCAGGACAGCTGG + Intergenic
1049746214 8:144264387-144264409 TGGGCTGGATCCAGCCTCGCCGG - Exonic
1050937313 9:11414341-11414363 TGGTCTGGCCTCAGCCTCGCAGG + Intergenic
1051287709 9:15513256-15513278 AGGGCTGCACCAAGCATAGCTGG - Intergenic
1054905680 9:70412528-70412550 TGGGGTGGCCCCACCGTCGCGGG + Intronic
1056852436 9:90095793-90095815 TGGGCTGGCCTCAGCAAGGGTGG - Intergenic
1057182163 9:93036066-93036088 TGGGCCTGCCCCATCCTAGCTGG + Exonic
1059327675 9:113514177-113514199 TGTGCTGCCTCCATCATAGCTGG + Intronic
1059441459 9:114309373-114309395 TGGGCAGACCCCAGCCAAGCAGG + Exonic
1059824938 9:118017784-118017806 TGGGCTGGCCCCAGCAACCCTGG - Intergenic
1060209273 9:121700006-121700028 GGGGCTGGCGCTAGCAGAGCGGG + Intronic
1060559932 9:124534502-124534524 TGGACAGGCCCCAGAACAGCAGG + Intronic
1060771590 9:126335997-126336019 TGAGCTGGCCTCACCATGGCAGG + Intronic
1061289685 9:129643528-129643550 TGCGCTGGCTCCAGCATCTCAGG - Intergenic
1062204208 9:135326787-135326809 GGGGCTGGCCTCGGCATCGCAGG + Intergenic
1062423232 9:136494053-136494075 GGGGCTGTCCCCAGGATGGCTGG + Intergenic
1062723967 9:138060830-138060852 TGTGCTGGTCCAAGCAGAGCTGG + Intronic
1203745028 Un_GL000218v1:36781-36803 TGGGGTGGGCACAGCATAGGGGG + Intergenic
1188620612 X:32218357-32218379 TGGGCAGGCCCCAGGAAATCTGG - Intronic
1193931706 X:87561509-87561531 ATGGCTAGCCCCAGCATTGCAGG + Intronic