ID: 1096491159

View in Genome Browser
Species Human (GRCh38)
Location 12:52013867-52013889
Sequence TAGAGTTTCCAGTCTGAGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096491159_1096491165 8 Left 1096491159 12:52013867-52013889 CCAACCTCAGACTGGAAACTCTA 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1096491165 12:52013898-52013920 ATCAATTCGGAAGGCAGAACTGG 0: 1
1: 0
2: 2
3: 5
4: 172
1096491159_1096491163 -5 Left 1096491159 12:52013867-52013889 CCAACCTCAGACTGGAAACTCTA 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1096491163 12:52013885-52013907 CTCTATATGGGACATCAATTCGG 0: 1
1: 0
2: 0
3: 5
4: 86
1096491159_1096491164 -1 Left 1096491159 12:52013867-52013889 CCAACCTCAGACTGGAAACTCTA 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1096491164 12:52013889-52013911 ATATGGGACATCAATTCGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 198
1096491159_1096491166 11 Left 1096491159 12:52013867-52013889 CCAACCTCAGACTGGAAACTCTA 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1096491166 12:52013901-52013923 AATTCGGAAGGCAGAACTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096491159 Original CRISPR TAGAGTTTCCAGTCTGAGGT TGG (reversed) Exonic
901583250 1:10263775-10263797 TAGAGTTTCCAGGCTTAACTTGG + Intronic
903133418 1:21293688-21293710 AAGCCTTTCCCGTCTGAGGTGGG - Intronic
905232199 1:36521502-36521524 GAGAGATCCCAGTCTGAGGGAGG - Intergenic
905232230 1:36521622-36521644 GAGAGATCCCAGTCTGAGGGAGG - Intergenic
907809360 1:57852822-57852844 TAGAGTTTCCATTCTGCAGGAGG - Intronic
907921894 1:58921824-58921846 GAGAGTCTCCAGTCTAGGGTGGG - Intergenic
909528764 1:76658063-76658085 TAAATTATCCAGTCTCAGGTAGG - Intergenic
911044345 1:93616551-93616573 CAGATTCTGCAGTCTGAGGTTGG - Intronic
914434146 1:147645383-147645405 AAGAATTTCCAGTTTGAGGCCGG - Exonic
923441758 1:234027365-234027387 TTCAGTTTCCAGTCTGTGGATGG - Intronic
1065672443 10:28135135-28135157 TAGAGTTTCCAGGCTGTGATGGG + Intronic
1067722473 10:48739403-48739425 TAGGGTTTTCAGTCTGCGGAGGG - Intronic
1068880812 10:62046865-62046887 CAGTGTTTCCTGTCTGGGGTGGG + Intronic
1069063005 10:63913677-63913699 TGGAGTTAGCAGTCTGAGGTTGG + Intergenic
1069380471 10:67839198-67839220 GAGTGTCTCTAGTCTGAGGTAGG + Intergenic
1074289003 10:112124287-112124309 ATGAGTTTCCAGACTGGGGTGGG - Intergenic
1075819411 10:125293142-125293164 TGGAGTTTCCAGGCTGGGCTGGG + Intergenic
1077018595 11:407556-407578 TAGAGCTTCCCGTCTGCGGACGG + Exonic
1077458779 11:2698525-2698547 TAAAGGTTGCAGTCTGAGTTGGG - Intronic
1078198608 11:9158434-9158456 AAGAGTCTCCAAGCTGAGGTGGG + Intronic
1078262437 11:9722983-9723005 TGGAGTGTAAAGTCTGAGGTGGG + Intronic
1078393247 11:10954914-10954936 TAAATTATCCAGTCTCAGGTAGG + Intergenic
1078698332 11:13657568-13657590 TAAATTATCCAGTCTCAGGTAGG - Intergenic
1079404464 11:20132372-20132394 CAGAGTTTCCGGGCTGGGGTTGG - Intergenic
1080387722 11:31819555-31819577 TAGAGTGGCCAGTGGGAGGTGGG - Intronic
1081760562 11:45573978-45574000 CACAGTTTCCAGTGTGAGGGCGG - Intergenic
1082261034 11:50076433-50076455 TAGAGAGGCCAGTGTGAGGTAGG + Intergenic
1085021748 11:73214427-73214449 TAGAGTTTCCAGGCTGCGTTTGG + Intergenic
1085868494 11:80323124-80323146 TAGTTTTTGCTGTCTGAGGTTGG + Intergenic
1086137499 11:83456727-83456749 TAGAGTCTCGAGCCAGAGGTTGG + Intronic
1087220553 11:95542275-95542297 TTGAGTCTGGAGTCTGAGGTTGG - Intergenic
1087272859 11:96129354-96129376 TAGAGTTTCAGGTCTGAGGTGGG + Intronic
1087890925 11:103537164-103537186 CAGAGTTGCCAGTCTAAGATGGG - Intergenic
1090247336 11:125225657-125225679 CAGGGTTTCCAGTCTGGGGCTGG + Intronic
1090709218 11:129371365-129371387 TAGAGTTTCCAGTCCTAACTTGG + Intergenic
1091740425 12:2957393-2957415 TGGGGTTTCCAGTCTCAGTTTGG + Intergenic
1091926294 12:4353448-4353470 AAGAATTTCCAGTTTGAGGAAGG + Exonic
1092506802 12:9109983-9110005 CAGAGTTTCCAGTTAGAGGGTGG - Exonic
1092992930 12:13920610-13920632 GAGAGGCTCCAGACTGAGGTGGG + Intronic
1095382692 12:41614697-41614719 TAAATTTTCCAGTCTTGGGTAGG + Intergenic
1096491159 12:52013867-52013889 TAGAGTTTCCAGTCTGAGGTTGG - Exonic
1096526217 12:52211871-52211893 TAGAGCAGGCAGTCTGAGGTGGG + Intergenic
1097666101 12:62479016-62479038 TAGATTTTTCTGGCTGAGGTAGG + Intronic
1099906935 12:88782594-88782616 TAGAGCTTAGAGTCTGCGGTGGG - Intergenic
1099949877 12:89290178-89290200 TAGAGATTTTAGTCTGAGATTGG + Intergenic
1101198867 12:102413936-102413958 TAGAGTTTCAAGCATGTGGTAGG - Intronic
1101210245 12:102528425-102528447 TAGAGTTCCCAGGCTTTGGTGGG + Intergenic
1103673052 12:122633914-122633936 TAAATTTTCCAGTCTCAGGTGGG + Intergenic
1105542013 13:21324090-21324112 TTGAGTTTCCACTCTGAGGCAGG + Intergenic
1105549926 13:21384137-21384159 GGGAGTTTTCAGGCTGAGGTGGG + Intronic
1106577837 13:30992542-30992564 GAGAGTTTGCTGTTTGAGGTAGG + Intergenic
1106715185 13:32381270-32381292 TAGAGCTTACATTATGAGGTTGG + Intronic
1106983112 13:35313649-35313671 TAGAGTTTACAGTCTAGTGTGGG + Intronic
1110788649 13:79562347-79562369 TAGAATTTCCACTGAGAGGTTGG - Intergenic
1111433772 13:88179835-88179857 TAGGGTTAGCAGACTGAGGTGGG + Intergenic
1112192398 13:97190804-97190826 AAGAGTTTGAAGCCTGAGGTTGG + Intergenic
1112802521 13:103128250-103128272 TAGATGTTCAAGTCTAAGGTGGG + Intergenic
1114028690 14:18555520-18555542 TAGAGTTTCCAGGCTGTGATGGG - Intergenic
1114655112 14:24311203-24311225 CAGAGTCTCCAGGCTCAGGTGGG - Exonic
1116186226 14:41604749-41604771 TATGGTGTCCAGACTGAGGTAGG - Intergenic
1119148256 14:72335196-72335218 TAAATTATCCAGTCTCAGGTAGG + Intronic
1119516092 14:75249612-75249634 TAGAGTTTCCAGTCTCCCTTGGG - Intronic
1120125756 14:80740961-80740983 TAGTATTTCCAGTTTGGGGTAGG - Intronic
1122199225 14:100112220-100112242 TACAGTTTCCAGTTTGAGAGTGG + Intronic
1122992740 14:105245790-105245812 TACAGTTTCAAGTCTGTGTTTGG - Intronic
1124035673 15:26051766-26051788 TGGAGTTCACAGTCTCAGGTGGG + Intergenic
1124504844 15:30263802-30263824 TTGAGATTCCAATCTGAGCTGGG - Intergenic
1124738708 15:32274833-32274855 TTGAGATTCCAATCTGAGCTGGG + Intergenic
1126815698 15:52451172-52451194 TAGAGGTGCCTGTCTGAGATGGG - Intronic
1126994773 15:54428573-54428595 CAGAGCTTACAGTCTAAGGTGGG - Intronic
1127026836 15:54815879-54815901 TAAATTATCCAGTCTTAGGTAGG + Intergenic
1127822556 15:62672269-62672291 TACAGTTTTCAGTATGAGTTGGG + Intronic
1129227173 15:74176740-74176762 TAGAGGTTGCAGGCTGAGGGAGG - Exonic
1132204164 15:99975128-99975150 GTGAGTTTCCAGCCTCAGGTAGG + Intronic
1135716738 16:24776961-24776983 TAGAGTTGGCAGGCTGAGGCTGG - Exonic
1136170962 16:28489196-28489218 TAAAGTTTCCAGTCTCTGGCTGG - Intronic
1137455701 16:48616281-48616303 TAGAGTTGACAGTCTGATGGTGG - Intronic
1137880038 16:52036502-52036524 TAGAGTTTACAGTCTTATATGGG + Intronic
1138821375 16:60264039-60264061 AACAGTTCCCTGTCTGAGGTGGG + Intergenic
1139992504 16:70951325-70951347 TATAGTTTCCAGTCTTGGTTGGG + Intronic
1140401027 16:74671663-74671685 TAGAGTTTGCAATCTCTGGTAGG + Intergenic
1142969736 17:3603276-3603298 TAGAGCTTGAAGTCTGAGCTGGG + Intergenic
1144616712 17:16782678-16782700 TAGGGTTTCCACTGAGAGGTCGG + Intronic
1144895980 17:18532983-18533005 TAGGGTTTCCACTGAGAGGTCGG - Intergenic
1145136233 17:20411237-20411259 TAGGGTTTCCACTGAGAGGTCGG + Intergenic
1145778432 17:27545618-27545640 CAGAGTTTCCAGCCTGAAGAGGG + Intronic
1145886480 17:28385449-28385471 AGAAGTTCCCAGTCTGAGGTGGG + Intronic
1146809268 17:35890453-35890475 GATAGCTTCCAGTCTCAGGTGGG - Intergenic
1150856203 17:68755455-68755477 TAAATTTCCCAGTCTCAGGTAGG - Intergenic
1151166120 17:72205338-72205360 AAGAGTTGCCATTCTGAGGAAGG + Intergenic
1151611170 17:75176328-75176350 TAAAGACTCCAGTCTGAGCTCGG + Intergenic
1152937299 17:83147109-83147131 TTGAGTTTGCAGACTGATGTGGG + Intergenic
1153635099 18:7106692-7106714 TAGTGTGTCCGGTCTGGGGTGGG - Intronic
1153759953 18:8320873-8320895 TAGAGTTTCCAGTATGAACCTGG + Intronic
1156522456 18:37733268-37733290 TAGAGTTTCCATGCTGGTGTGGG - Intergenic
1156628347 18:38937353-38937375 CAGAGTTTCCAGGCTGAGACTGG - Intergenic
1157273033 18:46291075-46291097 GGGAGCCTCCAGTCTGAGGTGGG - Intergenic
1158742647 18:60161479-60161501 TAAAGTTTCCAGTTTTATGTTGG - Intergenic
1160238672 18:77106509-77106531 TGGGGTTTCCAGTCTGTGGTCGG - Intronic
1162930086 19:13953212-13953234 GGGAGTTTCCAGTCTGATGGAGG - Intronic
1164850387 19:31478354-31478376 TGGAGCTTCCAGTCTGAAGAAGG - Intergenic
1165241873 19:34475626-34475648 TAGGCTTTTCAGTATGAGGTTGG - Intergenic
1166523234 19:43495202-43495224 TGGACTTTCAAGTCTGAGGGAGG + Intronic
1166670873 19:44708937-44708959 GAGAGCTCCCAGTCTGAGGGAGG - Intronic
1166670924 19:44709230-44709252 TGGAGTTCCCAGTCTGACGAGGG - Intronic
1167286170 19:48599848-48599870 TGGAGTCTCGAGTCTGAGGGAGG + Intergenic
926096143 2:10081431-10081453 TAGAATTTCAAGTCTGTGGTTGG - Intergenic
926904666 2:17794554-17794576 AAGAGCTTCCTCTCTGAGGTTGG - Intronic
929964218 2:46521516-46521538 TAGAGATTGCAGACTGAGGAAGG + Intronic
929967579 2:46547241-46547263 TAGAGGTTCCAAACTGAGGGAGG - Intronic
935246515 2:101223592-101223614 GAGAGTTTCCAATCTGAGATAGG + Intronic
936862203 2:117031452-117031474 TAGAGTTTCTACTGAGAGGTTGG - Intergenic
939400046 2:141680657-141680679 GACAGTTTGCAGTCTGAGGATGG + Intronic
940450166 2:153827024-153827046 TAAATTGTCCAGTCTCAGGTAGG - Intergenic
940512933 2:154641891-154641913 TGGAAGTTCCAGTCTGAGCTTGG + Intergenic
941072041 2:160966436-160966458 TAGAGTTTCATGTCTGACCTTGG + Intergenic
942174922 2:173324232-173324254 TTGAGTTTAGAGTCTGAGGCAGG - Intergenic
943343343 2:186707864-186707886 TTGACTTTCCTGTCTGAGCTAGG + Intronic
943691156 2:190871082-190871104 TAAAGTACCCAGTCTCAGGTAGG - Intergenic
945344562 2:208697620-208697642 TGCAGTCTCCAGTCTGAGGAGGG - Intronic
946300175 2:218818624-218818646 TCCAGTTTCCAATTTGAGGTTGG - Intergenic
948690951 2:239704837-239704859 TGAATTTTCCAGTCTAAGGTGGG - Intergenic
1171309911 20:24137828-24137850 TAGCGTTGCCAGTCTGAGGATGG - Intergenic
1173221232 20:41134647-41134669 TAGAGTTTCCTGACTGAGGAGGG - Intergenic
1174077451 20:47948091-47948113 CAGAGGTCCCAGTCTGAGGCAGG + Intergenic
1176238218 20:64063932-64063954 AACAGTTTGGAGTCTGAGGTTGG + Intronic
1176992466 21:15514383-15514405 TAGAGTTTCAAGCGTAAGGTAGG - Intergenic
1180452810 22:15482570-15482592 TAGAGTTTCCAGGCTGTGATGGG - Intergenic
1182764091 22:32745985-32746007 TTGACTTTCCAGTTTGAAGTTGG + Intronic
1183806838 22:40219003-40219025 TTGAGTTTTCAGGCTGAGCTAGG + Intronic
951623773 3:24636790-24636812 TAGAATTTCCAGTATAATGTTGG + Intergenic
953600451 3:44358435-44358457 TAATATTTTCAGTCTGAGGTTGG - Intronic
954108514 3:48421732-48421754 TGGAGCTTCCAGCCTGAGCTGGG - Exonic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955662184 3:61312920-61312942 TAGAATTTCCAGTGTGAGCTGGG + Intergenic
955664946 3:61340243-61340265 TAGAGTTTGTAGTCCGGGGTAGG - Intergenic
956585876 3:70864161-70864183 CAGAGTTCCCAGTCCCAGGTGGG + Intergenic
958982118 3:100733991-100734013 GAGTGATGCCAGTCTGAGGTTGG + Intronic
960982878 3:123248181-123248203 TAGAACTTCCAGTATGATGTTGG - Intronic
961400605 3:126639482-126639504 TAGAGTTTGCTGTATGAGGAAGG - Intronic
961581757 3:127888888-127888910 GAGAATTTCCAGTCTGAGCCTGG - Intergenic
961732238 3:128974341-128974363 TTGTGTTTCCAGTGTGAGGTGGG - Intronic
963336886 3:143985540-143985562 TAGAGTTTTCCGTCTGATGAAGG + Exonic
965724519 3:171700166-171700188 TAGAATATTCAGTCTGTGGTGGG - Intronic
965833466 3:172825204-172825226 TAAAGTTTTCAGTCTTAGATGGG - Intergenic
968248842 3:197185814-197185836 TACTGTTTACAGTTTGAGGTAGG - Intronic
969284754 4:6196178-6196200 TCTACTTTCCAGTATGAGGTTGG + Intronic
970019246 4:11548427-11548449 TGGAGTTGCCAGTCTGAGTTTGG + Intergenic
971791089 4:31170580-31170602 AAGAGGTTCCAGTCTCAGCTGGG - Intergenic
975010907 4:69349905-69349927 TAGACGTTCCAGTATTAGGTTGG + Intronic
976121508 4:81787914-81787936 TAGAGTATCCTGTCTGAGGTTGG + Intronic
980258905 4:130421952-130421974 TAAAGATCACAGTCTGAGGTGGG - Intergenic
980582038 4:134768128-134768150 TGCAATTTCCAGTCTGAGGCTGG + Intergenic
980929230 4:139169470-139169492 GAGTGATGCCAGTCTGAGGTTGG - Intronic
981180684 4:141740056-141740078 TAGAATTTCCAGTATTATGTTGG - Intergenic
981382791 4:144092502-144092524 CAGAGTTTCTTGTATGAGGTTGG + Intergenic
982233782 4:153233209-153233231 AAGAGTTTCCAGTAGAAGGTGGG + Intronic
983833095 4:172355929-172355951 TAGACTTTCCATCCAGAGGTAGG - Intronic
984351605 4:178601365-178601387 TAGAGTTTCCAAGCTGAGTATGG + Intergenic
989846776 5:46154571-46154593 TAGAGTTTCCAAACTGCTGTAGG - Intergenic
990330418 5:54719901-54719923 TAGAGGTTCCAGGCGGAGCTAGG + Intergenic
993160750 5:84287966-84287988 TAGAGTCTTCAGTCTGTGGATGG - Intronic
995876848 5:116799329-116799351 TAGAGTTTACAGTCTAGGGAAGG + Intergenic
996364026 5:122680757-122680779 TAGAGTTTCCAACATGAGGAAGG - Intergenic
998114900 5:139529048-139529070 AACAGTTTTCAGTCTGAGGAAGG - Intronic
1004365412 6:15008647-15008669 CAGAGTTACCATTCTGAGGGTGG - Intergenic
1005431721 6:25764501-25764523 TAGAGTTTGTAGTGTGTGGTAGG - Intronic
1005744582 6:28824577-28824599 AAGAATTTCTAGGCTGAGGTGGG - Intergenic
1006936661 6:37723461-37723483 TGGAGCTTCCAGTCTGAGTAGGG + Intergenic
1007987028 6:46217166-46217188 GAGTGTTTCCACTCTGAAGTGGG + Intergenic
1008234380 6:49026275-49026297 TAGAATGTCCACTCTGGGGTAGG - Intergenic
1008456146 6:51713356-51713378 CAGATTTTCCAGCCTGAGGCAGG - Intronic
1017644047 6:156522642-156522664 TAAATTTCCCAGTCTCAGGTAGG + Intergenic
1017908691 6:158774189-158774211 CAAAGTTTACAGACTGAGGTGGG + Intronic
1019797604 7:3063342-3063364 AAAACTTTCCACTCTGAGGTGGG - Intergenic
1021118309 7:16768671-16768693 TAGAGTTTATGGTTTGAGGTAGG + Intronic
1022036011 7:26535304-26535326 GAGAGTTTCCAGCCTGAGAATGG - Exonic
1022259104 7:28686768-28686790 TAGAGATTGCAGTCTGAAGCCGG - Intronic
1024661927 7:51503885-51503907 TAGAGTTTTTAGCCTCAGGTAGG - Intergenic
1025092230 7:56073713-56073735 TAAAGATTCCAGTCTCAGCTGGG + Intronic
1029627238 7:101727663-101727685 ATGAGTTTCCAGTCTGATGGAGG - Intergenic
1033492709 7:141860034-141860056 TATAGCTGCCAGTCTGAGGCAGG + Intergenic
1038032360 8:23653622-23653644 TTGAGTTTCCAGATGGAGGTGGG + Intergenic
1038772167 8:30493126-30493148 AAGACATTCCAGTCTGATGTCGG - Intronic
1041903584 8:63008214-63008236 TAGAGTTTCCAGGAGGAGGGGGG - Intergenic
1044309595 8:90678388-90678410 TTGAGTGTCCATTTTGAGGTTGG - Intronic
1044510306 8:93069611-93069633 CAGAGTTTTCAGTCAGAGGGAGG - Intergenic
1046242423 8:111513763-111513785 AAGAGTTTCCAGGCTGAGCGCGG + Intergenic
1047500389 8:125436008-125436030 TAGACTTTCTAGTCTAAGCTGGG - Exonic
1048384757 8:133901780-133901802 TCCAGTTTCCAGCCTGAGGCGGG + Intergenic
1049650668 8:143766920-143766942 TAGAGATTTCAGTCAGTGGTGGG - Intergenic
1051184359 9:14442902-14442924 TAGTGTTTGCAGTCTGCGGAAGG + Intergenic
1052873910 9:33537755-33537777 TAAAGTTTCCAGTCAACGGTAGG - Intronic
1053502134 9:38606590-38606612 TAAAGTTTCCAGTCAATGGTAGG + Intergenic
1054460521 9:65459869-65459891 TGGAGCATCCAGTCGGAGGTGGG + Intergenic
1054996993 9:71403089-71403111 CAAAGTTCCCAGTCTGAGTTGGG - Intronic
1055760336 9:79600335-79600357 GAGAGTTTTCAGTTTGTGGTTGG + Intronic
1057681506 9:97190900-97190922 TAAAGTTTCCAGTCAATGGTAGG + Intergenic
1057693595 9:97308115-97308137 CAGATCTTCCAGGCTGAGGTAGG + Exonic
1057710923 9:97443325-97443347 TAGAATATACAGTCTAAGGTGGG + Intronic
1057931817 9:99200307-99200329 AAGGGGTTCCAGTCTGAGGCTGG - Intergenic
1058008145 9:99941872-99941894 TAGTGTTTCCATTCTGTGGATGG + Intronic
1061713653 9:132505091-132505113 TAGTGGATTCAGTCTGAGGTGGG - Intronic
1186440815 X:9585087-9585109 AAAAATTTCCAGTCTGAGGTGGG + Intronic
1188407114 X:29825374-29825396 TAGAGCTTCCAGTTTGGAGTAGG - Intronic
1189492625 X:41481858-41481880 TAGAGTTTCCCATGTGGGGTTGG - Intergenic
1190203298 X:48381963-48381985 TGTAGTTCCCAGGCTGAGGTGGG + Intergenic
1190207238 X:48413441-48413463 TGTAGTTCCCAGGCTGAGGTGGG - Intergenic
1190431870 X:50385824-50385846 AAGAGTTTTCATTCTGAGTTGGG + Intronic
1191902927 X:66057072-66057094 TAAAGTACCCAGTCTCAGGTAGG - Intergenic
1193014437 X:76716451-76716473 TAAATTTCCCAGTCTCAGGTAGG + Intergenic
1195430541 X:104784349-104784371 TACAGTTTGCATTCTGAGGTAGG + Intronic
1195837140 X:109129248-109129270 TATGGTTTCCAGGCTGAGTTTGG + Intergenic
1197460532 X:126735734-126735756 TGGATTTTCCAGGCTGAGGATGG + Intergenic
1201674617 Y:16565649-16565671 TAAATTATCCAGTCTTAGGTAGG - Intergenic