ID: 1096494251

View in Genome Browser
Species Human (GRCh38)
Location 12:52030177-52030199
Sequence AGGGAGACAGGGCCTAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 561}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096494251_1096494260 9 Left 1096494251 12:52030177-52030199 CCTTCCTTAGGCCCTGTCTCCCT 0: 1
1: 0
2: 1
3: 48
4: 561
Right 1096494260 12:52030209-52030231 CTACAGAACTCTCTGAGGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 120
1096494251_1096494257 4 Left 1096494251 12:52030177-52030199 CCTTCCTTAGGCCCTGTCTCCCT 0: 1
1: 0
2: 1
3: 48
4: 561
Right 1096494257 12:52030204-52030226 AGTATCTACAGAACTCTCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 172
1096494251_1096494261 10 Left 1096494251 12:52030177-52030199 CCTTCCTTAGGCCCTGTCTCCCT 0: 1
1: 0
2: 1
3: 48
4: 561
Right 1096494261 12:52030210-52030232 TACAGAACTCTCTGAGGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 158
1096494251_1096494259 8 Left 1096494251 12:52030177-52030199 CCTTCCTTAGGCCCTGTCTCCCT 0: 1
1: 0
2: 1
3: 48
4: 561
Right 1096494259 12:52030208-52030230 TCTACAGAACTCTCTGAGGCGGG 0: 1
1: 0
2: 4
3: 54
4: 652
1096494251_1096494258 7 Left 1096494251 12:52030177-52030199 CCTTCCTTAGGCCCTGTCTCCCT 0: 1
1: 0
2: 1
3: 48
4: 561
Right 1096494258 12:52030207-52030229 ATCTACAGAACTCTCTGAGGCGG 0: 1
1: 0
2: 1
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096494251 Original CRISPR AGGGAGACAGGGCCTAAGGA AGG (reversed) Intronic
900623402 1:3597422-3597444 CGGGAGACAGGGCGTCAGGGTGG - Intronic
900681673 1:3920125-3920147 AGGGAGAGAGGGAAGAAGGAAGG - Intergenic
900894606 1:5474532-5474554 AGGGGGACAGGGCTGAAAGAAGG - Intergenic
901194578 1:7433224-7433246 AAGGAGGCAGGGCAGAAGGAAGG + Intronic
901296099 1:8161912-8161934 GGGGAGACAGGGCTCGAGGAGGG - Intergenic
902199648 1:14823784-14823806 AGGAAGACAAGACCTAAGCATGG + Intronic
902601271 1:17541137-17541159 AGGGACAGGGGGCCTCAGGAAGG - Intronic
902728576 1:18353291-18353313 TGGGAGAGAGGGGCTTAGGATGG + Intronic
903108009 1:21101592-21101614 AGGGAGGGAGGGAGTAAGGAAGG + Intronic
903604189 1:24562921-24562943 CTGGAGAAAGGGCATAAGGAGGG - Intronic
904329582 1:29749523-29749545 AGGGAGGGAGGGCATCAGGAGGG + Intergenic
904535758 1:31198526-31198548 AGAGAGCCAGGGCTTGAGGATGG - Intronic
904706461 1:32394549-32394571 AGGGAGGCGGGACCTAATGATGG - Intronic
904838862 1:33357486-33357508 AGAGAGAGAGGGACTATGGATGG + Intronic
905418582 1:37822527-37822549 TGGGAGCCAGGTCCTAGGGAGGG + Exonic
905819163 1:40976343-40976365 AAGGAGACTGGGCCTATGGTGGG + Intergenic
906322576 1:44826391-44826413 AGGGAGACAGGGCTCACAGAGGG + Intronic
906529151 1:46513240-46513262 AGGCAGGCAGGGCAGAAGGAAGG - Exonic
906918022 1:50032567-50032589 AGGGAAAGAGGTCCCAAGGATGG + Intergenic
907282943 1:53362768-53362790 AGGGACACAGGGTCTCAGGCTGG - Intergenic
907397233 1:54199853-54199875 AGGGACACTGGGCCTCAGAAAGG + Intronic
907714634 1:56915699-56915721 AGGAAAACAGGGCAGAAGGAAGG + Intronic
909897723 1:81094030-81094052 AGGGAGGGAGGGACGAAGGAAGG + Intergenic
911746261 1:101445046-101445068 AGGGAGACAGGGACTGCTGACGG - Intergenic
912519208 1:110233857-110233879 AGGGAGGGAGGGCCAAGGGAGGG - Exonic
914461769 1:147891594-147891616 AGAGAGACAGTGCAGAAGGATGG - Intergenic
915004186 1:152621790-152621812 AGGGAAACAGGGCCTTGGGCAGG - Intergenic
915117135 1:153608243-153608265 AGGGACCCAGGGCCTAGGGTGGG - Intronic
915885432 1:159716503-159716525 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
916232193 1:162551448-162551470 AGGGAGAGAGGGAATAAGGAAGG - Intergenic
916248196 1:162709294-162709316 AGACAGACAGGGCCTAAAGAAGG + Intronic
916666756 1:166974342-166974364 AGGGATACAGGGCCTTGGGGTGG - Intronic
917729351 1:177858649-177858671 AGGGAGACATGGACTGTGGAGGG + Intergenic
918029670 1:180793113-180793135 AGGGAGAGAGGGAAGAAGGAAGG + Intronic
918761874 1:188420625-188420647 AGGGAGAGAGGGAAGAAGGAAGG - Intergenic
919681700 1:200441933-200441955 AGGGATACAGCTCCTAAAGAGGG - Intergenic
920068791 1:203287898-203287920 AGGGAGACAGGAGGAAAGGAGGG - Intergenic
920215112 1:204357523-204357545 AGGAAGCCAGGGCTTAATGAGGG - Intronic
920258103 1:204670210-204670232 AGGTAGACAGGGCCTGGTGATGG + Intronic
920875894 1:209835281-209835303 AGGGAAGCAGGGCATAAGGAAGG + Intronic
921591878 1:217013692-217013714 AGCAACACAGGACCTAAGGATGG + Intronic
922872256 1:228912365-228912387 AGTGAGACAGAGCATAAGTAAGG + Intergenic
922954479 1:229587669-229587691 AGGGAGGCAGGGAGGAAGGAAGG - Intergenic
923072810 1:230581424-230581446 TGGGAGAAAGGCCCTAAGGAGGG + Intergenic
923498430 1:234544552-234544574 AGGGAGGGAGGGCCAAGGGAAGG + Intergenic
1063455913 10:6182650-6182672 AGGGGAACAGGGCCTGAGGCTGG - Intronic
1063691853 10:8295414-8295436 AGGGAGGGAGGGAGTAAGGAAGG - Intergenic
1063698021 10:8356513-8356535 AGGGAGAGAGGGAGGAAGGAAGG - Intergenic
1063907057 10:10792013-10792035 AGGGAGACAGGGAGGAAGGAAGG + Intergenic
1063907064 10:10792036-10792058 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1064460336 10:15529008-15529030 AGGGAGACAGGGAGGAAGGAAGG - Intronic
1064793045 10:18980358-18980380 AGGAAGACAGGGCTAAGGGAAGG + Intergenic
1065497293 10:26342138-26342160 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1066566692 10:36728765-36728787 AGACAGACAGGGCTAAAGGAAGG + Intergenic
1067419365 10:46133474-46133496 GGGGACACAGGGCACAAGGAGGG - Intergenic
1067504716 10:46840071-46840093 GGGGACACAGGGCACAAGGAGGG - Intergenic
1069809609 10:71148686-71148708 AGTGAGCCAGGGCATAAGGAGGG + Intergenic
1070596868 10:77838583-77838605 AGGGAGAGAGGGCATAGAGAAGG + Intronic
1070787729 10:79171702-79171724 GGGGAGTGAGGGCCTATGGAAGG + Intronic
1070915455 10:80151549-80151571 AAGGAGCCAGGTCCTAAGGTAGG + Exonic
1071122733 10:82298269-82298291 AGGGAGAGAGGGAGGAAGGAAGG + Intronic
1071431537 10:85610773-85610795 AGGGAGAGAGGGAAGAAGGAAGG + Intronic
1071867295 10:89748616-89748638 AGGGTGACAAGGCCTAAGAAAGG - Intronic
1072011348 10:91305484-91305506 AGCTAGACAGGGTCTGAGGAGGG + Intergenic
1072431085 10:95370992-95371014 AGGCAGACAGAGGCAAAGGAAGG + Intronic
1073988808 10:109240539-109240561 AGGGAGACAGGGAGGAAGGAAGG + Intergenic
1074514207 10:114149719-114149741 AGGGAGGAAGGGACGAAGGAAGG + Intronic
1074724126 10:116289906-116289928 AGGGAGAGAGGGCAGAAGGCAGG - Intergenic
1074731818 10:116386473-116386495 AGGGAGAGAGGGAGAAAGGAGGG - Intergenic
1074769872 10:116726337-116726359 AGGGAGACAGAGACAGAGGAAGG - Intronic
1075394105 10:122114107-122114129 ATGGAAGCGGGGCCTAAGGAGGG + Intronic
1075472581 10:122704001-122704023 AGGGAGCCAGAGCCCAGGGATGG - Intergenic
1075749291 10:124752109-124752131 AGAGACACAGGGCATAAGAAGGG + Intronic
1075805794 10:125187933-125187955 AGGGAGAGTGGGGCTAAAGAGGG - Intergenic
1075822382 10:125325978-125326000 GGGGAGACAGGGCGTAAGTGGGG - Intergenic
1076346837 10:129785088-129785110 AAGGAGGCAGGCCGTAAGGAGGG + Intergenic
1076413170 10:130265923-130265945 ATGGAGACGGGGCCGGAGGAAGG + Intergenic
1076627151 10:131829187-131829209 AGGAATCCAGGGCATAAGGAGGG + Intergenic
1077006558 11:360624-360646 ACGGAGCCAGGCCCTGAGGAAGG + Intergenic
1077405722 11:2381708-2381730 AGGGACACGGGGCCCAAGCAAGG - Intronic
1083949858 11:65947892-65947914 AGGGAGGCAGGGGCTCAGGCAGG + Intronic
1084629971 11:70341697-70341719 ATGGAGACAAGGTCTAAGAATGG + Intronic
1084881125 11:72172399-72172421 AGGTAGACAAGGCCTGAGGGAGG - Intergenic
1085040804 11:73325229-73325251 AGGGAGACAGGGCAGGAGGCTGG - Intronic
1085391171 11:76183066-76183088 GGAGAGACAGGGTCTGAGGAGGG - Intergenic
1085460351 11:76689615-76689637 AGGGAGGCAAGGCCAGAGGAGGG + Intergenic
1087919122 11:103846292-103846314 AGGGAGGGAGGGCGGAAGGAAGG - Intergenic
1088480371 11:110291340-110291362 AGGGAGACAGGGAAAAAGGGAGG + Intronic
1088616563 11:111635473-111635495 AGGGAGAGAGGGCGGAGGGAGGG + Intronic
1088668204 11:112115801-112115823 AGGGAGAAAGGGGCTGGGGATGG + Intronic
1089455195 11:118621783-118621805 AGGGAGGTGGGTCCTAAGGAGGG - Intronic
1090125885 11:124083628-124083650 AGGGAGACAGAAGCTAAGGGTGG - Intergenic
1090525972 11:127537269-127537291 AGGGTGACAGAGACCAAGGATGG - Intergenic
1090580405 11:128152889-128152911 AGGGAGAGAGGGAGGAAGGAGGG + Intergenic
1090580422 11:128152933-128152955 AGGGAGAGAGGGAGGAAGGAGGG + Intergenic
1090634425 11:128681775-128681797 TGGGATACAGGGCCTTAGAAAGG - Intergenic
1090727863 11:129543902-129543924 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1091312148 11:134582182-134582204 AAGGGGCCAGGGTCTAAGGATGG + Intergenic
1091803757 12:3341828-3341850 AAGGGGACAGGGCTGAAGGAAGG + Intergenic
1091930751 12:4393452-4393474 TGGGAGCCAGGGCCTTAGGTGGG - Intergenic
1091991260 12:4957850-4957872 AAGGGGACAGGGCTGAAGGAAGG - Intergenic
1092082851 12:5732417-5732439 AGGGAGACTGGGCTTGAGAAGGG - Intronic
1092562974 12:9636129-9636151 AGGAGCAAAGGGCCTAAGGAAGG - Intergenic
1092677097 12:10932111-10932133 AGGGATAGAGGGCAAAAGGATGG + Intronic
1094559468 12:31537533-31537555 AGGAAGACAGGGAGGAAGGATGG + Intronic
1094704805 12:32904281-32904303 AGGGAGGAAGGGCAGAAGGAAGG - Intergenic
1095475285 12:42580937-42580959 AGGGAGAGAGAGAGTAAGGAAGG + Intronic
1095696250 12:45147433-45147455 AGGGAAACAAGGATTAAGGAGGG - Intergenic
1096494251 12:52030177-52030199 AGGGAGACAGGGCCTAAGGAAGG - Intronic
1096596640 12:52700066-52700088 AAGGGGACAGGGCCTCAGAAAGG - Intronic
1096692159 12:53328027-53328049 AGGGAGAGAGCCCCGAAGGATGG + Exonic
1096976121 12:55700048-55700070 AGGGAGACAGAGCCACAGAAAGG + Intronic
1097168635 12:57099536-57099558 AGGGAGAGAGGACCTAGGGTGGG + Intronic
1097975683 12:65684013-65684035 AGGGATACAGGGACTAGGTATGG - Intergenic
1098980510 12:76951051-76951073 AGGGAGAGAGGGAGGAAGGAAGG - Intergenic
1099743431 12:86669967-86669989 AGGGTGACAACCCCTAAGGAGGG + Intronic
1100262867 12:92949466-92949488 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1100375570 12:94013213-94013235 AGGGAGAGAGGGAGTAAGGAAGG + Intergenic
1100460196 12:94791746-94791768 AGGGAGTCAGGGACAAGGGAAGG + Intergenic
1101443466 12:104720468-104720490 AGGAAGACAGGACCTAGGGCTGG + Intronic
1101561220 12:105859963-105859985 AAGAAGACAGGGTATAAGGAGGG + Intergenic
1101601704 12:106215410-106215432 TGGGAGCCAGGGGCTAAGGCTGG + Intergenic
1102501150 12:113353534-113353556 AGGGAGAGAGGGAGGAAGGAAGG - Intronic
1102682250 12:114698696-114698718 AGGGAGATAGGGAGAAAGGAAGG - Intergenic
1102992146 12:117322845-117322867 AGGGAGGGAGGGAGTAAGGAGGG - Intronic
1103206316 12:119131888-119131910 AGGTAGATGGTGCCTAAGGAAGG + Intronic
1103743179 12:123105091-123105113 AGGGAGAAAGGCCCTGAGGCAGG - Intronic
1103783829 12:123417336-123417358 TGGGAGACAGGGTCAAAGTAAGG - Intronic
1104553487 12:129779156-129779178 AAGGATACAAGGCCTTAGGAAGG + Intronic
1105571563 13:21607990-21608012 TGGGAGACAGAGGCTTAGGAAGG - Intergenic
1106032181 13:26013318-26013340 AGGGAGGCAGGGAGTAAGTATGG - Intronic
1106644915 13:31623550-31623572 AGGGAGGCAGGGCATCAGTAAGG - Intergenic
1107337369 13:39369590-39369612 AGGGAGAGAGGGAGGAAGGAAGG - Intronic
1107787226 13:43969237-43969259 AGCAAGAAAGGGCCTGAGGAGGG + Intergenic
1108287572 13:48923773-48923795 AGGGAGACAGAGGCAAAGAAAGG - Intergenic
1109211788 13:59543708-59543730 AGGGAGGGAGGGCAGAAGGAAGG + Intergenic
1110882183 13:80585743-80585765 GGGGAGACAGTGGCCAAGGAAGG - Intergenic
1111933189 13:94532635-94532657 AGGGAGTCAGGGGCTAGGGGAGG + Intergenic
1113049998 13:106200198-106200220 AGGGAGAGAGGGAGGAAGGAAGG - Intergenic
1113510867 13:110853824-110853846 AAGGAGCCAGGGGGTAAGGAGGG + Intergenic
1113674109 13:112196334-112196356 AGGGAGAGAGGGCGTAAGGGAGG - Intergenic
1114219311 14:20682825-20682847 AGGGAGCCCGGGCCTAAGCCTGG + Intergenic
1116284347 14:42953039-42953061 AGCAAGACAGGGCCCAAAGAGGG + Intergenic
1116324153 14:43509448-43509470 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1116974126 14:51096272-51096294 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1117665682 14:58053498-58053520 AGGGAAGCAGGGGCTGAGGAAGG - Intronic
1117819646 14:59634611-59634633 ATGGAGACAGGTCCTTAGTATGG - Intronic
1118369756 14:65127782-65127804 AGGGAGAGAGGGAAAAAGGAAGG - Intergenic
1118800887 14:69188472-69188494 AGGGAGAGAGGGAAGAAGGAAGG - Intergenic
1119031991 14:71200013-71200035 AGGGAGACAGTGCAGGAGGAAGG + Intergenic
1119177256 14:72578261-72578283 AGGGAGGCATGTCCTATGGAAGG - Intergenic
1119389535 14:74281609-74281631 AGAAAGACAGGGACTGAGGAAGG - Intergenic
1119863413 14:77953691-77953713 ATGGAAACAGGGCATGAGGAAGG - Intergenic
1119996045 14:79254845-79254867 AGGGAGAAAGGGAGAAAGGAAGG - Intronic
1120224637 14:81776855-81776877 AGGGAGAAAGGGAGGAAGGAAGG - Intergenic
1121800189 14:96768624-96768646 AGGGAGAGAGGGAGGAAGGATGG - Intergenic
1121800340 14:96769182-96769204 AGGGAGAGAGGGACAGAGGAAGG - Intergenic
1122083133 14:99280692-99280714 TGGGGGACAGGGCCCAAAGATGG + Intergenic
1122114725 14:99522000-99522022 ACGGACACAGGGCCTAGGGCTGG + Intronic
1123448317 15:20345158-20345180 AGAGAGACAAGGACCAAGGATGG + Intergenic
1124140434 15:27072678-27072700 TGGGAGCCAGGGGCTGAGGAAGG - Intronic
1125289159 15:38126558-38126580 AGAGAGACAGGAACTAAGCAAGG + Intergenic
1126358698 15:47823333-47823355 AGGAAGCCAGGGCCCAAGGAAGG + Intergenic
1126536098 15:49767211-49767233 AGGGAAACATGGCCCAAAGAAGG - Intergenic
1126671131 15:51115946-51115968 AAGGAGACAGGGCCACAAGATGG - Intergenic
1127305389 15:57700620-57700642 AGGAAGAGAGGGTCGAAGGAGGG + Intronic
1127673341 15:61216671-61216693 AGGGAGACAGGGAAAAGGGAAGG + Intronic
1127961810 15:63895824-63895846 GGGGAGAGAGGGCCCCAGGAGGG - Intergenic
1127993093 15:64134966-64134988 AGGGGGACTAGGCCTCAGGAAGG - Intronic
1128052352 15:64675305-64675327 AGGGAGTCAGGGGCTGAGTAGGG - Exonic
1128241454 15:66104113-66104135 AGGGAGGGAGGGACAAAGGAGGG - Intronic
1128430644 15:67590398-67590420 AGGGAGAGAGGGAGGAAGGAAGG - Intronic
1128618971 15:69132768-69132790 AGGGAGCCAGAGCATGAGGAAGG + Intergenic
1128978124 15:72167929-72167951 AGGAAGACAGGTCCTGAGGCTGG - Intronic
1129607738 15:77032968-77032990 ACGGAGGGAGGGCCTAAGGCTGG + Intronic
1129657511 15:77533986-77534008 AGGGAGAGAGGCCCCAAGGAGGG + Intergenic
1129691173 15:77714456-77714478 GGGGAGAGAGGGCCAAATGAGGG - Intronic
1130559516 15:84947138-84947160 AAGGACACAGGCCCTGAGGATGG - Intergenic
1131019880 15:89088775-89088797 GGGGACAAAGGGCCTCAGGAAGG - Intronic
1131131858 15:89905441-89905463 AGAGAGACAGGTCCTCAGGAGGG - Intronic
1131161825 15:90110370-90110392 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1131488205 15:92839736-92839758 AGGTAGAGAGGGCCCAAGAAAGG + Intergenic
1131902645 15:97105004-97105026 AGGAAGCCAGAGCCCAAGGAGGG - Intergenic
1132169925 15:99640496-99640518 AGGGAGAGAGGGAGGAAGGAAGG - Intronic
1133862037 16:9605219-9605241 AGGGAGAGAGGGCGAAAGGAAGG - Intergenic
1134875932 16:17698671-17698693 TGGCAGCCAGGGGCTAAGGAGGG - Intergenic
1135227563 16:20674825-20674847 AAGGAGAAAGGGCCCAAGGTAGG + Intronic
1135491467 16:22913173-22913195 AGGGAGGGAGGGCGGAAGGAAGG + Intronic
1136003171 16:27311682-27311704 AGGGAGAGAAGGCCACAGGAAGG - Intergenic
1136866935 16:33766660-33766682 AGGGAGGCAGGGCCTGAGTGAGG - Intergenic
1137551416 16:49440152-49440174 AGGGAGAGAGGGACTCAGGATGG - Intergenic
1137709937 16:50559627-50559649 AAGGAGACAAGGCCTCATGACGG - Intronic
1137881194 16:52050289-52050311 AGGGGGACAGGGCAAAGGGATGG - Intronic
1138578481 16:57923915-57923937 AGGGAGCCTGGGGCTCAGGAGGG - Intronic
1138991617 16:62397126-62397148 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1139296335 16:65904721-65904743 AGGGAGACAGAGACTCATGAAGG - Intergenic
1139510761 16:67427251-67427273 AGGGAGACAGGGCTTGGGGCAGG + Intergenic
1139957639 16:70700722-70700744 ATGGAGACAGGGCTCATGGAGGG - Intronic
1140151780 16:72374832-72374854 ACAGAGAAAAGGCCTAAGGATGG + Intergenic
1140485085 16:75287367-75287389 AGGGAGAGAGGCCCCAAGGAGGG + Intergenic
1140944636 16:79756504-79756526 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1141649873 16:85387179-85387201 ACGGACACCGGGCCTAAGGAGGG + Intergenic
1141677172 16:85524017-85524039 CGGGAGACAGGGCTCAAGGCAGG - Intergenic
1203105227 16_KI270728v1_random:1349542-1349564 AGGGAGGCAGGGCCTGAGTGAGG + Intergenic
1203128287 16_KI270728v1_random:1612826-1612848 AGGGAGGCAGGGCCTGAGTGAGG - Intergenic
1142759856 17:2035916-2035938 AGGGACACAGGGACTGAGGTAGG - Intronic
1142984559 17:3688109-3688131 AGGGAGACAGGGCCCAGGGGAGG + Intronic
1143130247 17:4673013-4673035 AGGGCGATGGGGCCTCAGGAGGG + Exonic
1143434415 17:6913078-6913100 AGGGAGAGAGGAGCTCAGGAAGG + Intronic
1143847700 17:9785595-9785617 CGGGAACCAGGGGCTAAGGAGGG + Intronic
1144247771 17:13384396-13384418 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1144305020 17:13961924-13961946 AGGGAGAAAGGAACGAAGGAAGG + Intergenic
1144666072 17:17103074-17103096 AGGGAGACAAGGCCTTGGCATGG - Intronic
1144788989 17:17847202-17847224 AGGGAGAGAGGGGCCCAGGAGGG + Exonic
1144967684 17:19088531-19088553 TGGGAGGCCGGGCCTGAGGACGG - Intergenic
1144980232 17:19163532-19163554 TGGGAGGCCGGGCCTGAGGACGG + Intergenic
1144987990 17:19214700-19214722 TGGGAGGCCGGGCCTGAGGACGG - Intergenic
1145040187 17:19572215-19572237 AGGGAGACAGGGACAAGAGAGGG - Intronic
1148551467 17:48552905-48552927 AGGGAGAGAGGGACTAGGGGAGG - Exonic
1148869401 17:50647344-50647366 AGGCAGGCAAGGCCAAAGGAAGG + Intronic
1149129549 17:53281676-53281698 AGTGATACAGAGCCTAATGAGGG + Intergenic
1149389682 17:56176202-56176224 AGGGAGTCAGGGACTGAGGGAGG + Intronic
1149447955 17:56728441-56728463 AGGGCGACAGAGCCTCAGGCTGG - Intergenic
1150472299 17:65447408-65447430 AGAGAGATAGGGCCACAGGATGG + Intergenic
1150984814 17:70184429-70184451 AGGGAGAGAGGGAGGAAGGAAGG - Intergenic
1151651815 17:75474954-75474976 AGGGAGGCAGGGCCCAGAGAGGG + Intronic
1151683320 17:75633249-75633271 AGTGAGTCAGGGCCTGAGGAGGG - Intronic
1152259510 17:79259520-79259542 TGGGAGGCAAGGCCTGAGGAGGG + Intronic
1152340474 17:79721423-79721445 AGAGAGACAAGGACCAAGGATGG - Intergenic
1152341493 17:79728341-79728363 AGGGAGGCAGGGCCTGAGTGAGG - Intergenic
1152372853 17:79901293-79901315 AGGGAGGCAGTGCCTGGGGAGGG + Intergenic
1153776806 18:8461721-8461743 AACAAGACAGGGCCTCAGGAAGG - Intergenic
1153802031 18:8679825-8679847 AGGGTGAAAGGGACTCAGGAAGG + Intergenic
1154154739 18:11934996-11935018 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1154389697 18:13925690-13925712 AGGGAGAGAGGGCAAAATGAGGG - Intergenic
1157378625 18:47190485-47190507 AGGAAAACAGGAACTAAGGAGGG + Intergenic
1157694258 18:49708383-49708405 AAGGAGACAGGGCCTCAGCAGGG - Intergenic
1158428667 18:57363298-57363320 AGGGAGACAGGGCTAAATGGTGG + Exonic
1159014474 18:63090003-63090025 AGAGAGACAGGGATCAAGGAAGG - Intergenic
1159098855 18:63936800-63936822 GGGGAGGCAGGGGCTCAGGAGGG + Intergenic
1159527895 18:69617439-69617461 AGGGAGAGAGGGAGGAAGGAAGG + Intronic
1160015849 18:75139812-75139834 AGGGAGTGAAGGCCTGAGGAAGG - Intergenic
1160526894 18:79543623-79543645 AGGGAGACCAGGCCTGGGGAGGG + Intergenic
1160984907 19:1834004-1834026 AGTGAGACTGGGCCCCAGGAGGG + Intronic
1161297460 19:3527086-3527108 CGGGAGACAGGGAGTAGGGAGGG - Intronic
1161353085 19:3804428-3804450 AGGGAGAGAGGGAGGAAGGAAGG + Exonic
1161638120 19:5401951-5401973 AGGGAGGCAGGGGGGAAGGAGGG + Intergenic
1161935265 19:7368008-7368030 AGGGAGGGAGGGCGGAAGGAAGG + Intronic
1162136983 19:8561439-8561461 AGGGAGAGAGGGAGGAAGGAAGG - Intronic
1162204679 19:9046922-9046944 AGGGAGGCAGGGAGGAAGGAAGG - Intergenic
1162392476 19:10397911-10397933 AGGGAGACAGGGAGTGAGGCGGG - Intronic
1162450220 19:10749881-10749903 AGGTAGGCAGGGCCTATGGGAGG + Intronic
1163288268 19:16362994-16363016 TGGGGGACATGGCCTGAGGATGG + Intronic
1164554780 19:29243180-29243202 TGGGAGACAGGGAAGAAGGAAGG - Intergenic
1164787463 19:30944825-30944847 AGGGAGAAAGGGAGGAAGGAAGG + Intergenic
1164803622 19:31098872-31098894 AGTGAGACAGGGAGAAAGGAGGG - Intergenic
1164916773 19:32058311-32058333 AGGGAGAGAGGGAAGAAGGAAGG - Intergenic
1166135677 19:40775742-40775764 ATGGAGATAGGGTCTAGGGAAGG - Exonic
1166555844 19:43699517-43699539 ACGGAGACAGGGTGCAAGGAGGG - Intergenic
1166837560 19:45676939-45676961 AGGCAGCGAGGGCCTAGGGAGGG - Exonic
1167148273 19:47695107-47695129 AGGGAGACGGGGCCTGAAGATGG + Intronic
1168468930 19:56625464-56625486 AGGGACACAGGGCCCAGTGAGGG - Exonic
1168671133 19:58242204-58242226 AGGAACACAGAGCCTAAGCATGG - Intronic
925392768 2:3508970-3508992 GGGGAGAGAGGGCGGAAGGAAGG + Intronic
925620926 2:5791896-5791918 AGGCAGCCAGGGCCTGAGGATGG - Intergenic
925817348 2:7767022-7767044 AGGGAGACAGGGCCTGGGCTGGG - Intergenic
926170452 2:10549883-10549905 AGGGTGACAGCGCCTCTGGAGGG - Intergenic
926731562 2:16039429-16039451 AGGGAGACAGGGAGGAGGGAGGG - Intergenic
926830115 2:16952580-16952602 TGGGAGGCAGAGCCTAAGAAAGG + Intergenic
926974019 2:18495360-18495382 AGGGAGGGAGGGCGGAAGGAAGG - Intergenic
927019117 2:18999323-18999345 AGGGAGACAGGGAGGGAGGAAGG - Intergenic
927173527 2:20389891-20389913 AGGGAGTCTGGGCATAAGGCTGG - Intergenic
927405972 2:22767183-22767205 TTGGAGACAGGGCCTTTGGAAGG - Intergenic
928766071 2:34647262-34647284 AGAGAAACAGGGCCTTGGGAAGG + Intergenic
929572877 2:43033686-43033708 AGAGAGACAGGCTCTAAGGAGGG - Intergenic
929777929 2:44939904-44939926 CGGGAGTCAAGGCCTAAGCAGGG + Intergenic
931578144 2:63742276-63742298 AGGGAGAGAGGGAGGAAGGAAGG + Intronic
932220539 2:69995693-69995715 AGGGACACAGGGCAGAAGGGAGG + Intergenic
932571159 2:72939077-72939099 AGGGAGACATGGACCAAGGCGGG - Intergenic
933272669 2:80250074-80250096 AAAGACACAGGGCCTAAGAAAGG - Intronic
933388670 2:81643749-81643771 ATGGAGACAGAGTATAAGGATGG + Intergenic
934124180 2:88870615-88870637 AGGGAGAGAGGGAGGAAGGAAGG - Intergenic
935663472 2:105489220-105489242 AGGGAGGCAGGGAGGAAGGAAGG + Intergenic
936531482 2:113279262-113279284 GGGGAGACAGGGGGCAAGGAGGG - Intergenic
937135699 2:119550166-119550188 CTGGAGACAGGGCCACAGGAGGG - Intronic
938250677 2:129813267-129813289 TGGGAGACAGGGCCCAGGCATGG - Intergenic
938424984 2:131179070-131179092 AGAGAAACAGGGCCGAAGGCAGG - Intronic
938671189 2:133588386-133588408 AGGGAGAGAGGGAAGAAGGAAGG - Intergenic
939471942 2:142633791-142633813 AGGAAGACAGGGACATAGGAAGG + Intergenic
940356635 2:152750511-152750533 AGGGAGGGAGGGCGGAAGGAAGG + Intronic
941715810 2:168762005-168762027 AGGGGGTCAGGGGCAAAGGAAGG + Intronic
941924608 2:170882938-170882960 AGGGAGAAAGGGAGCAAGGAAGG + Intergenic
942855629 2:180543748-180543770 AGAGAGAGAGCGCCTAAGGATGG - Intergenic
942893595 2:181021603-181021625 AGGGAGAGAGGGAGGAAGGAAGG - Intronic
943069708 2:183126020-183126042 AGGGAGAGAGGGAAGAAGGAAGG - Intronic
943664636 2:190596248-190596270 AGGGAGTCAGGGGCTAGGGGAGG + Intergenic
943988090 2:194648881-194648903 AGGGAGGCAGTGCCCAAGGGAGG - Intergenic
946048098 2:216837856-216837878 GGGGAGACGGGGCCATAGGAGGG - Intergenic
946148413 2:217748077-217748099 ACCAAGACAGGGCCTCAGGATGG - Intronic
946180046 2:217943472-217943494 AGGGACACAGGGACCAAGGGAGG - Intronic
946192923 2:218016854-218016876 AGGGAGACAGGGAGGAAGGTGGG + Intergenic
947029918 2:225782534-225782556 AGGGAGGGAGGGCAGAAGGAAGG - Intergenic
947860204 2:233353224-233353246 AGGAGGACAAGGCCTAAGGCAGG - Intergenic
947997981 2:234544660-234544682 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
947998000 2:234544729-234544751 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
948551319 2:238774808-238774830 ACAGAGTCAGGGCCTCAGGAAGG - Intergenic
948626048 2:239268672-239268694 AGGGACACAGCCCCTCAGGAGGG + Intronic
1169740217 20:8885160-8885182 AGGAAGACAGGGAGAAAGGAAGG - Intronic
1170628632 20:18049262-18049284 AGGGAGTCAGGGCCTTCGGCTGG + Intronic
1171543406 20:25983792-25983814 GGGGAGACAGGGCAAGAGGAGGG - Intergenic
1172448273 20:35004279-35004301 GTACAGACAGGGCCTAAGGAAGG - Intronic
1173118938 20:40271652-40271674 AGGGAAACAGGCCCTTAAGAAGG - Intergenic
1173150634 20:40563750-40563772 AGGAAGCCAGGGACCAAGGAGGG + Intergenic
1173180755 20:40804660-40804682 AGGGAGACAGGGAGGAAGGATGG + Intergenic
1173860149 20:46277902-46277924 AGGAAGGCAGGGCCGAGGGAGGG + Intronic
1174185546 20:48703567-48703589 AGGGAGCCAAGGCAAAAGGAAGG - Intronic
1174560575 20:51428095-51428117 AGGGAGAGAGGGAAGAAGGAAGG + Intronic
1174752214 20:53122836-53122858 TGGGGGACAGGGCATGAGGAAGG + Intronic
1174758393 20:53182275-53182297 AGGGAGGCAGGGACGGAGGAGGG - Intronic
1174793695 20:53503804-53503826 AGGGAGACAGGGAGGAAGGAGGG + Intergenic
1175196222 20:57245015-57245037 AGGGAGACAGGGGCTGGGCATGG - Intronic
1175598267 20:60252875-60252897 AGGGAGACAGGGACTGAAGGAGG + Intergenic
1175717172 20:61262853-61262875 AGGGAGAGAGGGTGGAAGGAAGG - Intronic
1175877486 20:62237212-62237234 GGGGAGACAAGGCCTGAGGAGGG + Intronic
1175891313 20:62317280-62317302 ATGCAGACAGGGCCTTGGGAGGG - Intronic
1175897941 20:62347668-62347690 AGAGAGACAAGGCCTGAGGTTGG + Intronic
1175987220 20:62770154-62770176 AGGAAGACAGGGAGTAGGGAAGG - Intergenic
1177788980 21:25701388-25701410 AGGGAGAGAGGGAGAAAGGAAGG - Intronic
1177958905 21:27637108-27637130 AGGGAGACAGAACAAAAGGAGGG + Intergenic
1178439897 21:32590313-32590335 AGGGAGAGAGGGAGGAAGGAAGG + Intronic
1178782063 21:35613074-35613096 AGGATGACAGGGCCTCAGGAAGG + Intronic
1179071212 21:38072789-38072811 AGGGAGAAATGGACTATGGAGGG + Intronic
1179775161 21:43657722-43657744 AGGGGGCCAGGGCCTTCGGAGGG + Intronic
1179806556 21:43841859-43841881 TGGGGGACTGGGCATAAGGATGG - Intergenic
1179964842 21:44796850-44796872 AAGGAGCCATGACCTAAGGAAGG - Intronic
1180629493 22:17218557-17218579 AGGGAGACAGGGACAAGGGGCGG - Intronic
1181559795 22:23693444-23693466 AGGAAGACGAGGCCTCAGGATGG + Intronic
1181901023 22:26155916-26155938 AGGGAGAAAGGGAGGAAGGAGGG + Intergenic
1182359640 22:29739030-29739052 AGAGAGCCTGGCCCTAAGGAGGG + Intronic
1182860671 22:33556625-33556647 AGGGAGAAAGGAACTCAGGAAGG + Intronic
1183325335 22:37188306-37188328 AGGGAGAGAGGGCGGAGGGAGGG + Intronic
1183507040 22:38215005-38215027 AGGAAGACAGGGCCCACGAAGGG - Exonic
1184655161 22:45937387-45937409 AGGGAGACAGGGACACAGAAAGG - Intronic
949626876 3:5877158-5877180 AGGGAGATGGGTCCTAAGAAAGG - Intergenic
949849842 3:8411706-8411728 AGTGAGACAGGGGCTACTGAGGG - Intergenic
949849869 3:8411806-8411828 AGTGAGACAGGGGCTACTGAGGG - Intergenic
949849976 3:8412157-8412179 AGTGAGACAGGGGCTACTGAGGG - Intergenic
949850049 3:8412407-8412429 AGTGAGACAGGGGCTACTGAGGG - Intergenic
949850123 3:8412657-8412679 AGTGAGACAGGGGCTACTGAGGG - Intergenic
950460657 3:13120386-13120408 AGGGAGACACGGGCCAAGTAGGG + Intergenic
951376833 3:21928337-21928359 AGGGAGGGAGGGACGAAGGAAGG + Intronic
951959479 3:28300713-28300735 AGGGAGAGAGGGAGGAAGGAGGG - Intronic
952100108 3:30000886-30000908 AGGGAGTGGGGGACTAAGGAAGG + Intronic
952345125 3:32476642-32476664 AGGGAGAGAGGGAGGAAGGAAGG + Intronic
952701154 3:36329002-36329024 AGGGAGACAGGGAAGAAAGAAGG + Intergenic
953170192 3:40500160-40500182 AGGGAGAGAGGGAGGAAGGAAGG - Intergenic
953475974 3:43206127-43206149 AGGGAGGCAGGGAGGAAGGAGGG + Intergenic
953553530 3:43923878-43923900 AGGGAGAGAGGCCCGCAGGAGGG - Intergenic
953616006 3:44491238-44491260 TGGGAGATGGGGCCTAAGGGAGG - Intergenic
953887043 3:46720014-46720036 AAGGAGGGAGGGCATAAGGATGG + Intronic
953972129 3:47355893-47355915 CGGCAGACAGGGCTAAAGGATGG + Intergenic
954055678 3:48022283-48022305 AGAGAGACAGGGACAAAAGAAGG + Intronic
954153635 3:48672545-48672567 AGGGAGGCAAGGGCTAGGGATGG - Intergenic
954405168 3:50341407-50341429 AGGGTGACAGAGCCAAATGAGGG - Exonic
954405635 3:50343630-50343652 AGAAGGACAGGGCCTGAGGAAGG + Intronic
954629551 3:52040548-52040570 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
954629582 3:52040656-52040678 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
954629598 3:52040710-52040732 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
954629615 3:52040764-52040786 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
954770137 3:52959651-52959673 AGGGAAGCAGAGCCTAAAGATGG - Intronic
954846487 3:53563180-53563202 AGGGGGACAGAGGATAAGGATGG - Intronic
954934509 3:54314051-54314073 AGGGAGAAAGGGAGTAAGGGTGG - Intronic
955009924 3:55003914-55003936 AGGGAGACAGGGAGCAAGGTCGG + Intronic
956715979 3:72080434-72080456 AGGGAGAAAGGGGGAAAGGAAGG - Intergenic
956762420 3:72455759-72455781 AGGCAGAAAGGCCCTGAGGAGGG - Intergenic
956768493 3:72504837-72504859 TGAGAGACAGGGCCAAAGTAAGG + Intergenic
957448125 3:80340595-80340617 AGGCAGAGAGGGAGTAAGGAAGG + Intergenic
958117108 3:89234759-89234781 AGGGAGAGAGGGAGGAAGGAAGG - Intronic
958117151 3:89234928-89234950 AGGGAGAGAGGGAGGAAGGAAGG - Intronic
958479449 3:94628091-94628113 AGGGAGAAAGGGAGGAAGGAAGG - Intergenic
958828241 3:99058410-99058432 AGGGAGAAAGAGCGGAAGGAAGG - Intergenic
958839572 3:99187088-99187110 TGGGAGCCAGGGCCTAAAGCTGG - Intergenic
960100314 3:113735449-113735471 AGGGAAACAAGGGCTAAGGATGG + Intronic
960456625 3:117880469-117880491 AGGGAGAAAGGGCATAAGGAAGG - Intergenic
960673969 3:120177205-120177227 AGGCAGGCAGGTCCTAAGGTAGG - Intronic
960998738 3:123358077-123358099 AGGTAAACAGGGCCTAATTAAGG + Intronic
961041671 3:123682648-123682670 AGGGAGACAAGGCCTGATGGAGG - Intronic
961533621 3:127555792-127555814 AGGAATACATGGCCTATGGAGGG + Intergenic
961968188 3:130927944-130927966 ACAGATACAGGGCCCAAGGAAGG - Intronic
962074886 3:132071133-132071155 AGGGAGCCAGTGCCTAACCAGGG - Intronic
962422321 3:135239517-135239539 AGAGAGACAGAGCCTAAGCATGG + Intronic
963995063 3:151699117-151699139 AGGGGGTCAGGGGCTAGGGAAGG + Intergenic
965165681 3:165192914-165192936 AGGGAGGCAGGGAGGAAGGAAGG + Intronic
965654458 3:170969284-170969306 AGGGGGTCAGGGGCTAGGGAAGG - Intergenic
967247908 3:187506302-187506324 AGGGTGACAGGGCCTCTTGATGG + Intergenic
967488934 3:190066474-190066496 AGGGACTCAGGGGGTAAGGATGG + Intronic
968947899 4:3675123-3675145 AGGAAGACAGGGAGGAAGGAAGG - Intergenic
969481298 4:7448470-7448492 AGGGAGACATGGAAGAAGGAAGG - Intronic
970113083 4:12660569-12660591 AGGGAGAGAGGGATGAAGGAAGG + Intergenic
970816800 4:20166384-20166406 AGGGAGGCAGGCTCTAAGGAAGG - Intergenic
971393674 4:26209542-26209564 AGGGAGACAGGGAAGGAGGAAGG - Intronic
971393682 4:26209566-26209588 AGGGAGACAGGGAAGGAGGAAGG - Intronic
973066042 4:45794449-45794471 AGGGAGGCAGGGAGGAAGGAAGG + Intergenic
973762607 4:54133371-54133393 AGGGAGGGAGGGACGAAGGAAGG + Intronic
973965482 4:56157793-56157815 AGGCATACAGTGCCTCAGGAAGG - Intergenic
974353036 4:60774122-60774144 TGGGAGACAGGGCCTAGAAAGGG + Intergenic
974435800 4:61856318-61856340 AGGGAGAGAGGGAGAAAGGAAGG - Intronic
975030504 4:69608602-69608624 AGGGAGTCAGGGAAGAAGGAAGG + Intronic
976321873 4:83725512-83725534 AGAGAGAGAGGGAGTAAGGAGGG - Intergenic
976505928 4:85847567-85847589 AAGGAGCAAAGGCCTAAGGAAGG + Intronic
976716555 4:88128770-88128792 AGGGTGTCAGGGGCTAGGGATGG + Intronic
976873162 4:89821277-89821299 AGGGAGAGAGGGAGGAAGGAAGG + Intronic
980521561 4:133942924-133942946 AGGGAGAGAGGGGGAAAGGAAGG - Intergenic
981454295 4:144935591-144935613 AGGAAGACAGGAAGTAAGGAAGG - Intergenic
981544322 4:145878738-145878760 AGGGAGGAAGGGCGGAAGGAAGG + Intronic
981682963 4:147421306-147421328 AGGAAGACAGGGAGGAAGGAAGG + Intergenic
981682969 4:147421330-147421352 AGGAAGACAGGGAGGAAGGAAGG + Intergenic
981682975 4:147421354-147421376 AGGAAGACAGGGAGGAAGGAAGG + Intergenic
981682981 4:147421378-147421400 AGGAAGACAGGGAGGAAGGAAGG + Intergenic
981682987 4:147421402-147421424 AGGAAGACAGGGAGGAAGGAAGG + Intergenic
981682993 4:147421426-147421448 AGGAAGACAGGGAGGAAGGAAGG + Intergenic
981682999 4:147421450-147421472 AGGAAGACAGGGAGGAAGGAAGG + Intergenic
983249640 4:165329239-165329261 AGGGAGAGAGGGTCAAGGGAGGG - Intronic
983500933 4:168499222-168499244 AGGGAGACGGGGAAGAAGGAAGG + Intronic
983887154 4:172993167-172993189 AGTGAAACAGGTCCTAAGGGTGG + Intronic
984713093 4:182902501-182902523 AGGAAGACAGGGCCTTAGCCAGG - Intronic
985664710 5:1176018-1176040 TGTGAGACAGGGCCTTAGAAAGG + Intergenic
985993760 5:3584859-3584881 AGGGACACAGGACAGAAGGAAGG + Intergenic
986120572 5:4832073-4832095 AGAGAGACAGGGAGAAAGGAAGG + Intergenic
986218237 5:5741778-5741800 AGGGAGGGAGGAACTAAGGAAGG + Intergenic
986797161 5:11223452-11223474 GGGAAGATGGGGCCTAAGGATGG - Intronic
987388180 5:17350248-17350270 AGGGAGAGAGGGAGGAAGGAGGG - Intergenic
987690487 5:21260050-21260072 TAGGAGACAGGGCCTTTGGAAGG - Intergenic
989665232 5:43846324-43846346 AGGGAGACAGGGAGGAAGGAAGG - Intergenic
989991321 5:50770626-50770648 AGGGAGGGAGGGAGTAAGGAAGG + Intronic
990416360 5:55590936-55590958 TGGGAGACAGGCCCCAAGGCAGG + Intergenic
991612897 5:68466938-68466960 AGGCAGTTATGGCCTAAGGACGG + Intergenic
991638063 5:68726007-68726029 TGGGAGACAGGGCTGAAGGAAGG + Intergenic
994188709 5:96843624-96843646 AGGGAAACAGGGTCTGAGGCAGG - Intronic
994311005 5:98270509-98270531 AGGAAGACAGGGAAGAAGGAAGG + Intergenic
994754804 5:103780340-103780362 GGGGAGACAGGGACTTAGGGAGG - Intergenic
994815111 5:104576185-104576207 AGAGAGACAGGGAGAAAGGAAGG - Intergenic
995420851 5:111965052-111965074 AGTGAGAGAGACCCTAAGGATGG - Intronic
995436019 5:112136219-112136241 AGGGAGATAGAGCGTAAGGGAGG + Intergenic
995732289 5:115258703-115258725 AGAGAGACAGGGACTAGAGAAGG - Intronic
996041073 5:118811860-118811882 AGGGAGTCAGGGGCTAGGGGAGG + Intergenic
996664225 5:126039220-126039242 TGGCAGACAGTGCCTATGGAGGG + Intergenic
997383041 5:133450969-133450991 AGGGAGACAGGGACAGAGGAGGG + Intronic
997583440 5:135031112-135031134 AGTGGGCCAGGGCCTAAGGTGGG + Intronic
997912191 5:137886683-137886705 AGGGAGACAGCACCCAAGGGGGG + Intronic
998511122 5:142714828-142714850 AGGGAGGCAGGGCTTAAGGGAGG - Intergenic
998822178 5:146067055-146067077 AAGGAGACAAGTCCTAAGTAAGG - Intronic
999030425 5:148284310-148284332 AGGGAGAGAGGGAGGAAGGAAGG - Intronic
999229918 5:150055762-150055784 AGGGAAACAGTGACAAAGGAGGG + Intronic
999323114 5:150626753-150626775 GGGGAGACTGGGGCCAAGGAGGG + Intronic
1001438355 5:171718568-171718590 ATGGAAACAGGTACTAAGGATGG + Intergenic
1001883428 5:175265844-175265866 AAGTGGACAGAGCCTAAGGATGG + Intergenic
1002189294 5:177470430-177470452 GGGGAGCCAGGGGCTGAGGATGG - Intronic
1002289817 5:178192639-178192661 AGGGAGAAAGGGAGGAAGGAAGG + Intergenic
1002295328 5:178227576-178227598 GGGAGGCCAGGGCCTAAGGAGGG + Intronic
1002436978 5:179237688-179237710 AAGGAGACGGGGCCTGATGAGGG + Intronic
1002599457 5:180346040-180346062 AATGAGCCAGGGCCTAGGGAAGG + Intronic
1003263769 6:4549174-4549196 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1003401518 6:5794841-5794863 AGGGTGACTGGGACTAGGGAGGG + Intergenic
1003673453 6:8181298-8181320 AGGGAGACAGGGAAGAAGGAAGG - Intergenic
1003857112 6:10287592-10287614 AGGGAGAAAGGGAGGAAGGAAGG + Intergenic
1005468667 6:26140599-26140621 AGGTAGACAGGCCCTGTGGAAGG + Intergenic
1005682736 6:28223085-28223107 AGGGAGACAGGGAAAAAGGAAGG - Intergenic
1005947398 6:30604400-30604422 AGTGTGACATGGCCTGAGGAAGG - Exonic
1006083902 6:31582611-31582633 AGGGAGACAGGCTCTCAGGGTGG + Intergenic
1006505489 6:34486194-34486216 AGGGAGGCAGGGCCTAGGGGTGG + Intronic
1006663799 6:35674020-35674042 AGGGAGAAAGGGAAGAAGGAAGG - Intronic
1007122317 6:39393214-39393236 AGGGAGAGAGGGCCTGCGGGTGG - Intronic
1007518212 6:42430098-42430120 AGAAAGACAGGGCCTCAGGGGGG + Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007789352 6:44300369-44300391 AAGGAGACATGGGCTAGGGAAGG - Exonic
1007838536 6:44696822-44696844 AGGGAGGCATGGGCTAAGGAGGG + Intergenic
1007865317 6:44962876-44962898 AGGGAGACAGAAAATAAGGAAGG - Intronic
1008694256 6:54015580-54015602 AGGAAGACAGCTCCCAAGGAAGG + Intronic
1010298712 6:74232316-74232338 AGGGAGAGAGGGATGAAGGAAGG - Intergenic
1010642477 6:78346049-78346071 GTGGAGCCAGGGCATAAGGAAGG - Intergenic
1010657186 6:78525476-78525498 AAGGAGACAGGTCCTGATGATGG - Intergenic
1011172620 6:84522724-84522746 AGGGAGAAAGAGCCTGAGAATGG - Intergenic
1012053057 6:94368202-94368224 AGGAAGAAATGGCCTGAGGATGG - Intergenic
1013579837 6:111522815-111522837 AGAGAGACAGGAACTTAGGAGGG - Intergenic
1013766279 6:113577979-113578001 AGGGAGGCAGGGAGGAAGGAAGG - Intergenic
1014278527 6:119416052-119416074 GGGGATACAGGGCTTCAGGATGG + Intergenic
1014699862 6:124671531-124671553 AGGCAGACAGATCCTAAGGAAGG - Intronic
1015261623 6:131244280-131244302 AGAGAGCCAGGGCCCAAGGAGGG - Intronic
1015392392 6:132697150-132697172 AGGGAGGCAGGGAGGAAGGAAGG + Intronic
1016355726 6:143216179-143216201 AGGGAGAAAGGGTCTACTGAAGG - Intronic
1016917094 6:149254048-149254070 AGGGAGAGAGGGAGGAAGGAAGG + Intronic
1017124386 6:151051892-151051914 AGGGAGGCAGGGACTGAGGCGGG + Intronic
1018256745 6:161928020-161928042 TGGGAGACGGGGCCTTTGGAAGG + Intronic
1018522399 6:164665097-164665119 AGGGAGTCAGAGGCTGAGGAAGG + Intergenic
1018798194 6:167203326-167203348 AGGGAGTCAGGGACTGAGGGAGG + Intergenic
1018814518 6:167320850-167320872 AGGGAGTCAGGGACTGAGGGAGG - Intergenic
1019256534 7:56060-56082 AGGGTGACCGGGCATAAGGCAGG - Intergenic
1019730558 7:2627320-2627342 AGGGAGAGAGGGAGAAAGGAGGG + Intergenic
1020188178 7:5974473-5974495 AGGGAGAAAGGGTGTAAGGCAGG + Intronic
1020294739 7:6750295-6750317 AGGGAGAAAGGGTGTAAGGCAGG - Intergenic
1021804693 7:24343411-24343433 AGGTGGACAGGGCCTGAGGCAGG - Intergenic
1021805377 7:24349575-24349597 AGGCAGACAGGGCCTGAGGCAGG + Intergenic
1022608680 7:31845527-31845549 AGGGGGTCAGGGGCTAGGGAAGG + Intronic
1024421365 7:49170824-49170846 AAGGAAACAGGAACTAAGGAGGG - Intergenic
1024471368 7:49771034-49771056 AGGGAGAAAGGGGAGAAGGAGGG + Intergenic
1024752879 7:52489319-52489341 GGGAAGACAGGGCTTAAAGAAGG + Intergenic
1024943507 7:54785756-54785778 AGGGTGACAGGGCACTAGGAAGG - Intergenic
1025255300 7:57380852-57380874 AGGGAGAAAGGGCAGAAGGGTGG - Intergenic
1025847829 7:65216722-65216744 AGGGAGAGAGGGAGGAAGGAAGG - Intergenic
1026393612 7:69928394-69928416 AGGCAGACAGGTCCCAAGGCAGG - Intronic
1026589133 7:71680631-71680653 AGGGAGAGAGGGAGGAAGGAAGG - Intronic
1026589149 7:71680709-71680731 AGGGAGAGAGGGAGGAAGGAAGG - Intronic
1026976831 7:74503897-74503919 AGGGAGAGAGGGGAAAAGGAGGG - Intronic
1027220178 7:76208904-76208926 AGGGAGAGAGGGAGAAAGGAAGG + Intronic
1027434711 7:78152525-78152547 AGGTAGCCAGGGGCTAAGGGGGG - Intronic
1029196492 7:98809246-98809268 AGGGAGGCAGGAGCTGAGGATGG + Intergenic
1029713740 7:102314434-102314456 AGGGGGACAGGGTTGAAGGAGGG + Intronic
1030201148 7:106906175-106906197 AGGGAGGCAGGGAAAAAGGAAGG - Exonic
1030929344 7:115503168-115503190 AAGGAGAGAGGGTGTAAGGAGGG - Intergenic
1031492510 7:122406466-122406488 AGGAAGACAGGGAAGAAGGAAGG + Intronic
1031820566 7:126496227-126496249 AGGGAGACAGTGTGGAAGGAAGG + Intronic
1032541280 7:132705157-132705179 AGGGAATCAGGGCCAACGGAAGG - Intronic
1033164674 7:139029671-139029693 AGGGAAGCAGGGTCTAAGGAAGG - Intronic
1033761276 7:144439086-144439108 AGGGAGACAGAGCTTGAGAAAGG + Intergenic
1034242739 7:149622855-149622877 AGGGAAACAGGACCCAAAGAAGG + Intergenic
1034337898 7:150335135-150335157 AAAGATACAGGCCCTAAGGAGGG - Intronic
1034339958 7:150346539-150346561 AGGGAGAGAGAGACTCAGGAGGG + Intergenic
1034412698 7:150949642-150949664 AGGCACACAGGGCCGAGGGAAGG + Intronic
1035050236 7:155994533-155994555 AGGCAGACAGAGGCTCAGGAGGG - Intergenic
1035609080 8:948441-948463 ATGGAGGCCGGGCCTGAGGAAGG - Intergenic
1036087011 8:5623475-5623497 AGGGAGACAAGAGCCAAGGATGG + Intergenic
1036400737 8:8405559-8405581 AAGGACACAGGGACAAAGGAGGG - Intergenic
1036546110 8:9771405-9771427 AGGGAGACAGATACTAAGGAAGG + Intronic
1036764312 8:11537538-11537560 AGGGACACAGAGCCTCAGGCAGG + Intronic
1037169465 8:15874060-15874082 AGGGAGTGAGGGACAAAGGAAGG - Intergenic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1037941647 8:22955976-22955998 ATGGAGACGGGCACTAAGGAAGG + Intronic
1037967537 8:23145938-23145960 AGGGAGACAGGGACTCTTGATGG + Intronic
1040979018 8:53226400-53226422 TGGAAGACAGGTCCTAACGAGGG - Exonic
1041117920 8:54558551-54558573 AGGGAGACAGGGGCCTGGGAGGG - Intergenic
1041373371 8:57188378-57188400 AGGTACACATGGCCCAAGGAAGG + Intergenic
1041463201 8:58133756-58133778 AGGTAGACACTGCCTTAGGAGGG - Intronic
1042036668 8:64540950-64540972 AGGGAGAGAGGGAGGAAGGACGG + Intergenic
1042397832 8:68311941-68311963 AGGGAGACAGGGAAGGAGGAAGG - Intronic
1043388897 8:79771899-79771921 ACAGAGACAGGGCCTCATGAAGG - Intergenic
1044622475 8:94203819-94203841 AGGAAGACAGGGAAGAAGGAAGG + Intronic
1044773127 8:95658821-95658843 AGGGAGACAGGGACACAGCATGG - Intergenic
1045755159 8:105533848-105533870 AGGGAGAAAGGGAGGAAGGAAGG - Intronic
1045766853 8:105682609-105682631 AGGGAGACAGGACAGAAGAACGG + Intronic
1047495197 8:125404185-125404207 AGGGAGACAGGCAGGAAGGAAGG - Intergenic
1047518037 8:125572179-125572201 AGGAAGAGAGGGCCCAAGGATGG - Intergenic
1047767693 8:128002918-128002940 AGGGAGACAGGGAGGGAGGAAGG - Intergenic
1048315100 8:133355944-133355966 AGGGAGAGAGGGATCAAGGAAGG - Intergenic
1048335164 8:133497117-133497139 AGGCAGACAGGGCCCAGGTAGGG - Intronic
1049127799 8:140808103-140808125 AGGGACACAGGGCTAAAAGAGGG + Intronic
1051666860 9:19474047-19474069 AGGGAGAAAGGGAGGAAGGAAGG - Intergenic
1053000401 9:34574514-34574536 AGGAGGACAGGGCCTAAGCTTGG - Intronic
1053540618 9:38970078-38970100 AGGGAGAGAGGGAGGAAGGAAGG - Intergenic
1054140323 9:61523218-61523240 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1054625521 9:67393828-67393850 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1055280737 9:74671185-74671207 AGGGAGAGAGGGTCTGAGGGAGG + Intronic
1055553155 9:77449869-77449891 AGGAGGCCTGGGCCTAAGGAGGG - Intronic
1056645744 9:88410091-88410113 AGAGAGACAGGATCTAAAGAGGG - Intronic
1057565044 9:96160065-96160087 AGGGAGAGAGGGGGAAAGGAAGG + Intergenic
1057861282 9:98642913-98642935 AGGGAGACAGTGCAGGAGGAGGG - Intronic
1057936613 9:99244930-99244952 AGGGAGACTGGGAAGAAGGAAGG + Intergenic
1058036979 9:100263532-100263554 AGGGAAACAGGGAGTCAGGAGGG - Intronic
1059735273 9:117094121-117094143 AGGGAGGGAGGGACTAAGGGAGG + Intronic
1060584510 9:124777576-124777598 AGGGACCCGGGGCCTGAGGAAGG + Intronic
1060604322 9:124900268-124900290 AGGGAGTCAGGACCTAATGGTGG - Intronic
1060720935 9:125976870-125976892 AGGGAGAGAGGGAGGAAGGAAGG - Intergenic
1061120107 9:128636850-128636872 ACAGAGACAAGGCCCAAGGAGGG + Intronic
1061181067 9:129025592-129025614 AAGGAGAGAGGGACTAAGGGAGG + Intronic
1061232339 9:129322045-129322067 AGGCAATCAGGGCCTAAGCATGG - Intergenic
1061728795 9:132597300-132597322 CGGGAGACAGGGCCTGCGGTTGG + Intronic
1061925350 9:133803528-133803550 AGGGACACTGGGCCTTGGGAAGG - Intronic
1062057209 9:134474906-134474928 AGTGAGGCAGGGGCTAGGGATGG - Intergenic
1062201662 9:135306112-135306134 AGGGAGAGAGGGGGTAAGGGAGG - Intergenic
1203654033 Un_KI270752v1:6531-6553 AGGGAGAAAGTGAATAAGGATGG - Intergenic
1185520666 X:736276-736298 AGGGACTCAGGGGCCAAGGAGGG - Intergenic
1185777560 X:2817096-2817118 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1186020099 X:5245329-5245351 AGGGAGAGAGGGAGGAAGGAAGG - Intergenic
1186239930 X:7555167-7555189 AGGGAGAAAGGGAGAAAGGATGG + Intergenic
1186246709 X:7622806-7622828 AGGGAGATAGGGAGGAAGGAAGG - Intergenic
1186838444 X:13460952-13460974 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1187212032 X:17241343-17241365 AGGGAGACAGCCCATAAAGAGGG - Intergenic
1188727802 X:33607163-33607185 AGGGAGACAGGGAGCAGGGAGGG - Intergenic
1188747390 X:33862798-33862820 ATGGAGACAGAGCAGAAGGATGG - Intergenic
1189271130 X:39752739-39752761 AGTGACACAGGGCAGAAGGATGG + Intergenic
1189279790 X:39813060-39813082 AGGGAGAAAGGGCTGCAGGATGG + Intergenic
1189847977 X:45153843-45153865 AGGGTGACAGGAGCTAGGGAGGG - Intronic
1190342451 X:49308493-49308515 AAGGAGAAAGGGCCCAAGGCAGG + Intronic
1190712067 X:53078462-53078484 AGGGAGAAGGGCCCCAAGGATGG + Exonic
1195967250 X:110439818-110439840 AGGAAAGCAGGGCCTAGGGAAGG - Intronic
1197267487 X:124390963-124390985 TGGGAGCCAGGGCAAAAGGAAGG - Intronic
1198131750 X:133702897-133702919 AGGGAGAAGGGCCCAAAGGAGGG - Intronic
1198206052 X:134466039-134466061 TTGGAGACAGGGCCTTTGGAAGG + Intronic
1198215205 X:134549349-134549371 AGGGAGACAGGGAGGAAGGAAGG + Intergenic
1198443272 X:136685205-136685227 ACGGAGACAGGACTTGAGGAGGG - Intronic
1199063873 X:143390765-143390787 AGGGAGAGAGGGAGGAAGGAAGG + Intergenic
1199700314 X:150370895-150370917 CCAGAGACAGGGCCTAAGGAGGG + Intronic
1200149478 X:153944246-153944268 AGTGAGAAGGGGCCTCAGGAAGG + Intronic
1200636932 Y:5666717-5666739 AGGGAGACAGGGAGAAAGGGAGG - Intronic
1201357333 Y:13111765-13111787 AAGGAGAAAGGGCCCAAGGCAGG + Intergenic
1201574433 Y:15446857-15446879 AGGGAGACAGGGGATAAAGGAGG + Intergenic
1201949484 Y:19548462-19548484 AGGGAGGAAGGACGTAAGGAAGG - Intergenic
1202107801 Y:21388334-21388356 AGGGAGGGAGGGAATAAGGAAGG + Intergenic
1202251534 Y:22878350-22878372 ATGTACACAGGGCCCAAGGAGGG + Intergenic
1202404522 Y:24512099-24512121 ATGTACACAGGGCCCAAGGAGGG + Intergenic
1202466257 Y:25157983-25158005 ATGTACACAGGGCCCAAGGAGGG - Intergenic