ID: 1096496167

View in Genome Browser
Species Human (GRCh38)
Location 12:52040620-52040642
Sequence CTGTGGGTATGATGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 262}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096496167_1096496181 13 Left 1096496167 12:52040620-52040642 CCTGCTTCCCATCATACCCACAG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1096496181 12:52040656-52040678 GGGTGCTGACAATGTTGTAAGGG 0: 1
1: 0
2: 0
3: 7
4: 129
1096496167_1096496175 -9 Left 1096496167 12:52040620-52040642 CCTGCTTCCCATCATACCCACAG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1096496175 12:52040634-52040656 TACCCACAGGATCGGGAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 127
1096496167_1096496176 -8 Left 1096496167 12:52040620-52040642 CCTGCTTCCCATCATACCCACAG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1096496176 12:52040635-52040657 ACCCACAGGATCGGGAGGGAGGG 0: 1
1: 1
2: 4
3: 21
4: 217
1096496167_1096496184 24 Left 1096496167 12:52040620-52040642 CCTGCTTCCCATCATACCCACAG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1096496184 12:52040667-52040689 ATGTTGTAAGGGGAGAGCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 143
1096496167_1096496178 -7 Left 1096496167 12:52040620-52040642 CCTGCTTCCCATCATACCCACAG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1096496178 12:52040636-52040658 CCCACAGGATCGGGAGGGAGGGG 0: 1
1: 0
2: 4
3: 29
4: 287
1096496167_1096496183 23 Left 1096496167 12:52040620-52040642 CCTGCTTCCCATCATACCCACAG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1096496183 12:52040666-52040688 AATGTTGTAAGGGGAGAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 179
1096496167_1096496182 14 Left 1096496167 12:52040620-52040642 CCTGCTTCCCATCATACCCACAG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1096496182 12:52040657-52040679 GGTGCTGACAATGTTGTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 129
1096496167_1096496180 12 Left 1096496167 12:52040620-52040642 CCTGCTTCCCATCATACCCACAG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1096496180 12:52040655-52040677 GGGGTGCTGACAATGTTGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096496167 Original CRISPR CTGTGGGTATGATGGGAAGC AGG (reversed) Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
902368081 1:15990298-15990320 CTGTGGGTACCAAGGGCAGCTGG - Intergenic
904391333 1:30188254-30188276 CTGTGGGAATGGTGTGACGCTGG - Intergenic
904424831 1:30416544-30416566 CTGTGGGGAAGATGGGGAGCAGG + Intergenic
905203037 1:36326651-36326673 CTGTGGGCAAGAAGGGGAGCAGG + Intronic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906474164 1:46156678-46156700 CTGTGTGCATGATGGTCAGCTGG - Intronic
907999641 1:59667993-59668015 CTGTGGGTATGATTGCAGACTGG + Intronic
908052091 1:60244442-60244464 ATAAGAGTATGATGGGAAGCAGG + Intergenic
912227824 1:107755384-107755406 ATGTGGGGGTGAGGGGAAGCTGG + Intronic
915300966 1:154951435-154951457 CTGTGGGAAGGAAGGGAGGCGGG - Intronic
915457501 1:156050662-156050684 CTGTGGGAATGACAGGAAGAGGG - Intronic
916419857 1:164626809-164626831 CTGCAGGCATGATGGGGAGCAGG - Intronic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
917967062 1:180185543-180185565 CTGGGGGCAGGAGGGGAAGCAGG - Intronic
918773247 1:188591765-188591787 GTGTGGATATGATACGAAGCAGG + Intergenic
918911710 1:190581366-190581388 TTCTGGGCATGATGAGAAGCTGG + Intergenic
920010945 1:202867299-202867321 TTCAGGTTATGATGGGAAGCTGG - Intergenic
920776575 1:208943850-208943872 CTGCAGGGATAATGGGAAGCTGG + Intergenic
920997850 1:211012311-211012333 CTGTGGGTTTGATTGGAGGGTGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923466641 1:234253550-234253572 CTGTTAGTAGGATGGGAAGAGGG + Intronic
1064098300 10:12440793-12440815 CTGTATATATGATGGGATGCAGG + Intronic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1066305119 10:34133027-34133049 CAGTGGGATGGATGGGAAGCTGG - Intronic
1067448563 10:46367711-46367733 CAGTGGGTATCGTGGGCAGCAGG - Intergenic
1067588811 10:47493054-47493076 CAGTGGGTATCGTGGGCAGCAGG + Intergenic
1067635936 10:48001145-48001167 CAGTGGGTATCGTGGGCAGCAGG + Intergenic
1067877554 10:50019182-50019204 CAGTGGGTACCATGGGCAGCAGG - Intergenic
1070132500 10:73665152-73665174 CAGTGGGTATCGTGGGCAGCAGG + Intergenic
1070581252 10:77721478-77721500 CTTTGGGTAGAATGGGAGGCAGG + Intergenic
1070604873 10:77891672-77891694 CTGTGGGAGTGATGTGTAGCGGG - Intronic
1071492726 10:86146980-86147002 CTGTTGGTAAAATTGGAAGCAGG + Intronic
1071609183 10:87018924-87018946 CAGTGGGTATCGTGGGCAGCAGG - Intergenic
1074489961 10:113931120-113931142 CTTTGGGTATGAGGTGAAACTGG + Intergenic
1075333423 10:121591838-121591860 ATGTGGGTATTGTTGGAAGCAGG - Intronic
1075495836 10:122917686-122917708 CTGTGGAGATGACAGGAAGCTGG - Intergenic
1075959233 10:126552987-126553009 TTGTGTTTATGATGGGAAGCAGG - Intronic
1076216506 10:128697986-128698008 CTGTGGGTGCGAGAGGAAGCAGG - Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1077348021 11:2073305-2073327 CACTGGGAATGATGGGAAGCGGG + Intergenic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1079572334 11:21959365-21959387 TTGGGGGTATCATGGGAAGGTGG + Intergenic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1080448202 11:32356677-32356699 CTCTGGGTCAGATGGGAAGACGG - Intergenic
1080911220 11:36600984-36601006 CTGTGGATATGATGGGTTGGAGG + Intronic
1083677579 11:64335147-64335169 CTGTGGGGAGGAGGGGAGGCTGG - Intergenic
1084004361 11:66315266-66315288 CAGTTGGGATAATGGGAAGCTGG + Exonic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1084932060 11:72563985-72564007 CTGTGTGTGTGATGGTAAGCAGG + Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085471466 11:76761109-76761131 CAGTGGGAATGAGGGGCAGCAGG - Intergenic
1085478908 11:76805834-76805856 CTCTGGGGATGAGTGGAAGCTGG - Intergenic
1087465068 11:98494153-98494175 CTGTGAGTAAAATGGGAGGCAGG + Intergenic
1087979174 11:104590084-104590106 CAGTGGGCATGATGGGACGTGGG - Intergenic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1089203372 11:116739110-116739132 CTGTGGTCATAATGGGGAGCAGG - Intergenic
1089732984 11:120531030-120531052 CTGAGCCTATGATGGGAACCAGG - Intronic
1090011178 11:123047221-123047243 CTGTGGTTTTAGTGGGAAGCAGG - Intergenic
1090463090 11:126909416-126909438 CTGTGGGTATGCTGGGAGCTGGG - Intronic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG + Intergenic
1094745603 12:33341216-33341238 CAGTGGGAAGGATGGGGAGCTGG + Intergenic
1095183841 12:39178413-39178435 CTGTGGGATGGATGGGGAGCTGG - Intergenic
1095866001 12:46972736-46972758 CTGTGTCTATGAGTGGAAGCAGG - Intergenic
1095904381 12:47362497-47362519 CTGTGGGTCTGATGTGAGTCAGG + Intergenic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1097081150 12:56432026-56432048 CTGTGGATATGCTGGGCAGAGGG + Intronic
1100551982 12:95654599-95654621 ATGTGGGGATGATGGGATGATGG + Intergenic
1101272182 12:103159417-103159439 CTGAGGCTATGATGGTAAGTTGG + Intronic
1102527507 12:113522176-113522198 CTCTGGGGATGAGGGGTAGCTGG - Intergenic
1105213367 13:18270945-18270967 CTGTACGTATTCTGGGAAGCAGG - Intergenic
1106299879 13:28453845-28453867 CTGGGGCTATCATGGTAAGCAGG + Intronic
1108436118 13:50403212-50403234 CTGTGCCTTTGCTGGGAAGCTGG + Intronic
1108979870 13:56497407-56497429 CTGAGGGTCTGATGTAAAGCAGG - Intergenic
1110868604 13:80424214-80424236 CTGAGGCTATGAAGGGCAGCAGG + Intergenic
1112452290 13:99523576-99523598 TTGTGTGTATTATGTGAAGCTGG + Intronic
1113080901 13:106518749-106518771 CCGTGGGTGGGAGGGGAAGCAGG - Intronic
1113535635 13:111064194-111064216 TTCAGGCTATGATGGGAAGCAGG + Intergenic
1113815452 13:113166840-113166862 CCTTGGGTAAGCTGGGAAGCTGG - Intronic
1114517398 14:23308793-23308815 CTGTGGGAGAGAAGGGAAGCAGG - Intronic
1116809549 14:49525903-49525925 CTGAGGAGAGGATGGGAAGCAGG + Intergenic
1118158605 14:63266363-63266385 TTCAGGCTATGATGGGAAGCGGG - Intronic
1120492818 14:85198165-85198187 CTTTGACTATGAAGGGAAGCCGG + Intergenic
1120673261 14:87388608-87388630 AGGTGGTTCTGATGGGAAGCTGG - Intergenic
1121320115 14:92987265-92987287 CTGTGGGCCTGATGTGGAGCTGG + Intronic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1123048897 14:105531301-105531323 CTGGGGATATGATCGGAGGCCGG - Intergenic
1124485469 15:30111067-30111089 ATGTGAGTATGTTGGGGAGCTGG - Intergenic
1124518107 15:30386200-30386222 ATGTGAGTATGTTGGGGAGCTGG + Intronic
1124540546 15:30580053-30580075 ATGTGAGTATGTTGGGGAGCTGG - Intergenic
1124758107 15:32427528-32427550 ATGTGAGTATGTTGGGGAGCTGG + Intergenic
1126161581 15:45618971-45618993 CTGTGGGCATGATGGGGGCCAGG + Intronic
1127733328 15:61819727-61819749 CCGTGGTTCTCATGGGAAGCAGG + Intergenic
1130332555 15:82933554-82933576 CTGTGAGAATGATGAGAAGGTGG - Intronic
1130375358 15:83324155-83324177 CTGTGTGTTTGAGAGGAAGCAGG + Intergenic
1133361738 16:5179470-5179492 GTGAGGGTATGATGAGAAGATGG - Intergenic
1134272049 16:12741426-12741448 CTGTGGGTATGATTTAAGGCAGG + Intronic
1134540657 16:15062192-15062214 ATGTGGGTATGTTGGTAAGAAGG - Intronic
1137685795 16:50385951-50385973 ATGTTGGTATGATGGGATGTGGG + Intergenic
1138482576 16:57313317-57313339 CAGAGGGTATGAGGGGAGGCTGG + Intergenic
1138633283 16:58316462-58316484 CTTAGGCCATGATGGGAAGCGGG + Intronic
1139527300 16:67524863-67524885 GTGTGTGTATGAGGGGAGGCAGG - Intronic
1139643601 16:68311106-68311128 CGCTGGGTATGCTGGGAAGGTGG + Intronic
1140802696 16:78503214-78503236 CTGAGAGCATGATGGGAAGATGG + Intronic
1141704813 16:85658898-85658920 CCTGGGGCATGATGGGAAGCAGG + Intronic
1142286319 16:89172973-89172995 CTGTGGGAATGAGGGGACTCAGG - Intronic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1143032028 17:3973217-3973239 ATGTGGGTCTCATGGGAGGCAGG - Intergenic
1143381403 17:6498516-6498538 GAGTGGGTGAGATGGGAAGCAGG + Intronic
1144697553 17:17315475-17315497 CTTTGGGTAGAATGGGAAGCTGG + Intronic
1145760877 17:27425086-27425108 TTGTGGGTACCAAGGGAAGCTGG - Intergenic
1147884388 17:43675061-43675083 CTGTGGGCATGATAGGATGATGG + Intergenic
1150810564 17:68353590-68353612 CGGTGGGTAAGAAGGGCAGCAGG - Intronic
1151128879 17:71875235-71875257 GTGGGGGTGTGATGGGAAGGTGG + Intergenic
1151224561 17:72638982-72639004 CTGTGGGGATGCTGGGATACAGG + Intergenic
1151430106 17:74056480-74056502 CTGTGGGTAAGAGGAGAAGGAGG + Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152355627 17:79805769-79805791 CTGTGGGTGAGATGGGTAGGGGG + Intergenic
1152596933 17:81242375-81242397 CTGTGGGTGGGATGGGAGGCTGG - Intergenic
1152900646 17:82939225-82939247 CTGTGGCTGGGATGGGATGCAGG + Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1153953540 18:10076775-10076797 CGGTGGGCAGGATGGGAGGCTGG - Intergenic
1155052170 18:22158045-22158067 CTGTAGGTCTCTTGGGAAGCAGG - Intergenic
1155063903 18:22252764-22252786 GTGTGGGTTTGATAGGAAGCAGG - Intergenic
1155177297 18:23312188-23312210 CTGTGGGTATGGTGGGGGACAGG - Intronic
1155800949 18:30102539-30102561 CAGTGGGTTGGATGGGGAGCCGG - Intergenic
1156622003 18:38864039-38864061 CTGAGGCTGTGCTGGGAAGCAGG - Intergenic
1157120139 18:44901541-44901563 CTTTGGGTATGATGGGAGGTAGG + Intronic
1157300730 18:46477314-46477336 CTGGGGGTAGGGTGGGGAGCAGG + Intronic
1157615137 18:48982417-48982439 CGGTGGGGAGGAAGGGAAGCAGG - Intergenic
1157792886 18:50548723-50548745 TTGTGGGTAGGAGGGGAATCTGG - Intergenic
1157987147 18:52451082-52451104 CTGTGGGCATGTTGTGAGGCAGG + Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162042709 19:7980179-7980201 CTGTGGGTATCTTGTGAAGGCGG + Intronic
1162107528 19:8379072-8379094 CTCTGGGTTTGATGGGAGGGAGG + Intronic
1164676104 19:30102845-30102867 CTGTGAGGATGGTGAGAAGCTGG - Intergenic
1164904496 19:31955957-31955979 CAGTGGGAAGGATGGAAAGCGGG - Intergenic
1165442652 19:35839237-35839259 CTGGGGTAGTGATGGGAAGCTGG + Exonic
1166299924 19:41907751-41907773 CTGTTGGGATCATGGGGAGCTGG + Intronic
1166709097 19:44925719-44925741 ATGTGGTGATGGTGGGAAGCAGG + Intergenic
931277612 2:60756998-60757020 TTGTGGGTAGGTGGGGAAGCAGG - Intronic
931610552 2:64094904-64094926 CTGTGGCTTGGATGTGAAGCTGG - Exonic
931895673 2:66726942-66726964 ATGTGGATATCCTGGGAAGCAGG + Intergenic
932488813 2:72105305-72105327 CTGTGGGGAGGCTGGGAAGCAGG - Intergenic
932638864 2:73421014-73421036 GTGTGTGTGTGATGGGAAGGTGG - Intronic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
937231030 2:120398359-120398381 CTGGGGCCAGGATGGGAAGCAGG + Intergenic
937815950 2:126251132-126251154 CTGTAGGGAGGATGGGAAGGTGG + Intergenic
939464871 2:142544368-142544390 CTGTAGGTACGGTGGGAAGCAGG - Intergenic
939891320 2:147739800-147739822 CTGTGGATTTGACAGGAAGCTGG - Intergenic
942485252 2:176432521-176432543 GTGTGTGTATTATGGGAAGAAGG - Intergenic
942718545 2:178922923-178922945 CTGTGGGTATTAAATGAAGCTGG + Intronic
943752075 2:191519886-191519908 CAGTGGAAATGATGGGAAGCAGG - Intergenic
946594214 2:221288351-221288373 CTGTGAGTAAGCTTGGAAGCTGG - Intergenic
948610232 2:239162113-239162135 CAGTGGGGCTGCTGGGAAGCAGG - Intronic
948636059 2:239338354-239338376 CTGATGGAATGAAGGGAAGCGGG - Intronic
948826490 2:240575644-240575666 CCGTGGGTATGATGGCAGGCGGG + Intronic
1169422413 20:5471117-5471139 CTGTGCGTTTGATAGGCAGCTGG + Intergenic
1169574610 20:6944069-6944091 CCCTGGGTATGAGGGGAGGCAGG + Intergenic
1170813245 20:19691647-19691669 CTGTGGGGATGATGAGATGGTGG + Intronic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1172482132 20:35277493-35277515 CTGGGTGTAGGCTGGGAAGCAGG + Intergenic
1172626768 20:36351909-36351931 CTGTGGGTGTGATGTGCTGCCGG + Intronic
1173870565 20:46339379-46339401 TAGTGGGTAGGAGGGGAAGCAGG + Intergenic
1173964829 20:47104601-47104623 TTGTGTGTATGATGTGAGGCAGG + Intronic
1174597129 20:51693115-51693137 CAGTGTGTATGATGGGGCGCAGG - Intronic
1174661114 20:52214054-52214076 CTGTGGATATGATGTGCAGCGGG + Intergenic
1175113339 20:56664465-56664487 CTGTGGGTAAGAGTGGAAGCCGG + Intergenic
1176251080 20:64120257-64120279 CTGTGAGTAGGACGGGAGGCTGG + Intergenic
1178222409 21:30675153-30675175 CTGTGGGATGGATGGGGAGCTGG - Intergenic
1178827635 21:36029990-36030012 CTGTCAGTGTGATGAGAAGCGGG + Intergenic
1179232297 21:39515768-39515790 GTGTGGGGATGATGGTAAGGAGG + Intergenic
1179539067 21:42072484-42072506 GGGTGGGTATCCTGGGAAGCTGG + Intronic
1179819895 21:43930642-43930664 CTGTCGGGATGAGGGGAAGGCGG + Intronic
1179967709 21:44816958-44816980 CTGGGGGTGTGATGGAAAGGGGG + Intronic
1180080541 21:45485768-45485790 CTGTGGGGGACATGGGAAGCAGG + Intronic
1180900040 22:19364065-19364087 CTATGGGTATGTTGGGGAGGCGG + Intronic
1181572096 22:23773150-23773172 CTGGGGGTGTGAAGGGGAGCCGG + Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184480538 22:44744344-44744366 CAGTGGGCCTGATGGGAAACCGG + Intronic
1184658318 22:45953134-45953156 CGGTGGCTGTGAGGGGAAGCCGG - Intronic
1184658327 22:45953166-45953188 CGGTGGCTGTGAGGGGAAGCCGG - Intronic
1184658366 22:45953342-45953364 CGGTGGCTGTGAGGGGAAGCTGG - Intronic
1184742689 22:46438228-46438250 CTGTGGGGATGAGAGGCAGCTGG + Intronic
1184818811 22:46893326-46893348 TTCTGTGTATGATGGGAGGCAGG + Intronic
949515037 3:4800074-4800096 CTGTAGGGATGACTGGAAGCAGG + Intronic
952270803 3:31829599-31829621 GTGTGTCTATGAGGGGAAGCAGG + Intronic
953313134 3:41900038-41900060 ATGTGAGTATGTTGGGGAGCTGG + Intronic
954674319 3:52307356-52307378 CAGTGGGAATGATGGGAGGCTGG + Intergenic
957192797 3:77031312-77031334 CAATGGGGATGATGGGAAGATGG + Intronic
959397167 3:105854992-105855014 CTGTGGGTATTTTTGGAATCTGG + Intronic
962229137 3:133645613-133645635 TTGTTGGTAAGATGGGAAGGAGG + Intronic
962492997 3:135911616-135911638 AAGTGGGTCTGTTGGGAAGCAGG + Intergenic
962850035 3:139301511-139301533 CAGAGGGAATGAAGGGAAGCTGG - Intronic
964645779 3:158957062-158957084 CTGTGGGTATAAGGGGATTCAGG - Intergenic
971502057 4:27328355-27328377 CAGTGGGATGGATGGGAAGCTGG + Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
979173530 4:117632751-117632773 CTGTTGGTAGGAATGGAAGCAGG + Intergenic
979842864 4:125467607-125467629 CTGTGGGTATGATTTATAGCAGG - Intronic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
985273214 4:188214174-188214196 CTGTGGGTTTTCTGGGAAGTGGG - Intergenic
985501476 5:250352-250374 CTGTAGGTATGCTGGGAACTAGG - Intronic
985589018 5:755265-755287 CTGTGGGGAGGAGGAGAAGCAGG + Intronic
985603698 5:847781-847803 CTGTGGGGAGGAGGAGAAGCAGG + Intronic
986019019 5:3783692-3783714 CAGTGGGTCTGCTGAGAAGCAGG + Intergenic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987550113 5:19368702-19368724 CTGTGGGTATGCTAGGTTGCAGG + Intergenic
989151658 5:38305973-38305995 CAGTGGGGATGATGGGATACTGG + Intronic
989383367 5:40830870-40830892 CTGTGGGTATAATGTAAAGCTGG - Exonic
990029855 5:51244472-51244494 ATTTGGGTATGATTGGCAGCAGG + Intergenic
990727710 5:58774954-58774976 CTCTGGGGAAAATGGGAAGCTGG + Intronic
991240875 5:64458705-64458727 GTGTGGCTATGGTGGGATGCTGG - Intergenic
992122616 5:73610257-73610279 CTGTGGTTATCAGGGGGAGCTGG - Intergenic
994198504 5:96945707-96945729 CTCAGGCTATGATGGGAAGCGGG - Intronic
994750052 5:103726463-103726485 CTGTGGATTTGTTAGGAAGCAGG - Intergenic
995245718 5:109933001-109933023 GTGTGTGTATGATGGGAATGGGG + Intergenic
996307160 5:122060404-122060426 GTGTGGGTGTGATGGGAAAGTGG - Intronic
996536739 5:124585496-124585518 CAGTGGGAAGGATGGGGAGCTGG + Intergenic
997582713 5:135027656-135027678 CTGTGGGTAGAAAGGGAACCGGG - Intergenic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
1000004068 5:157166759-157166781 CTGTAGTTCTGATGGGGAGCAGG - Intronic
1001001449 5:168011221-168011243 CTGTGGGAATGATGTGCAGATGG + Intronic
1001450592 5:171821431-171821453 CTGTGGCTATGTTTGGAAGCTGG + Intergenic
1003342722 6:5237372-5237394 CTCTGGGGATGATGGGAGACAGG - Intronic
1004895253 6:20141799-20141821 CGGTGGGCATGAAGGGCAGCGGG + Intronic
1005089218 6:22038755-22038777 CAGTGGCTGTGATGGGAGGCAGG - Intergenic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1008061587 6:47003135-47003157 TTGAGGTTATGATGGGAAGTGGG + Intronic
1010939919 6:81904729-81904751 CAGAGGGTATTATAGGAAGCTGG + Intergenic
1010986598 6:82432390-82432412 CTCTGGGTTTGATGGTAAGAAGG + Intergenic
1011510308 6:88093394-88093416 CAGTGGGATGGATGGGAAGCTGG - Intergenic
1011557848 6:88588141-88588163 CAGTGGGTGGGTTGGGAAGCGGG - Intergenic
1012868388 6:104644864-104644886 ATGGGGGTGTGATTGGAAGCTGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013609690 6:111782844-111782866 CTGTGAGACTGATGGGAAGCTGG - Intronic
1013948503 6:115751451-115751473 CTGGGGATATGATTTGAAGCAGG + Intergenic
1014622535 6:123686554-123686576 CTTTAGGTATGATGTGAAGTTGG - Intergenic
1018697732 6:166403786-166403808 CCGTTGATATGATGGGAAGGGGG + Intergenic
1019113746 6:169739484-169739506 CTGTGGGGAGAATGGGAAGTTGG + Intergenic
1019262646 7:90229-90251 CTTTGTGTATGTTGGGAAACAGG + Intergenic
1020569543 7:9841784-9841806 CTGTTGGAAGGAAGGGAAGCAGG + Intergenic
1022510287 7:30930971-30930993 CTGGGGGTCTGGTGGGAGGCTGG + Intergenic
1022845846 7:34209124-34209146 TAGTGGGTATGATGAGAAGGAGG + Intergenic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1024207292 7:47174721-47174743 CTCTGTGTAGAATGGGAAGCTGG - Intergenic
1026331019 7:69352603-69352625 ATGTGGCTATGATATGAAGCGGG - Intergenic
1026589295 7:71681518-71681540 CTGTGGGTATCCTAGGAAGGTGG - Intronic
1026796073 7:73366920-73366942 CTGTGGGGAGGAGGGGCAGCAGG - Intergenic
1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG + Intronic
1029153110 7:98495341-98495363 CTCTGTTTCTGATGGGAAGCTGG + Intergenic
1029221752 7:98995688-98995710 GTGTGTGTATGATGGGATGGGGG - Intronic
1030808208 7:113943114-113943136 CTGTAGGTATGATATGAAGTAGG + Intronic
1035062645 7:156080313-156080335 TTGTGGGGCTGCTGGGAAGCTGG - Intergenic
1036209047 8:6827249-6827271 CAGTGGGTTTGCTGGGCAGCAGG - Intronic
1036968679 8:13329509-13329531 CTGTAGTTGTGATGGGAAGGAGG - Intronic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1039415105 8:37386666-37386688 CTTTGGGAAAGGTGGGAAGCTGG - Intergenic
1039415879 8:37393726-37393748 CTTTGGGAAGGGTGGGAAGCTGG - Intergenic
1041306835 8:56470488-56470510 CTGTGTGTGTGATGGGAATAAGG + Intergenic
1042601440 8:70503181-70503203 CAGTGGGATGGATGGGAAGCTGG + Intergenic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1048463539 8:134642720-134642742 CTGTGCGAGTGCTGGGAAGCTGG - Intronic
1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG + Intergenic
1050338801 9:4615376-4615398 CTGTGGTTAAGACGGAAAGCAGG - Intronic
1050731594 9:8715392-8715414 CTGGTGGTATGATGGCAAGATGG - Intronic
1052885917 9:33647919-33647941 CAGTGGGTTGGATGGGGAGCTGG - Intergenic
1053013868 9:34650899-34650921 CTGAGGGTTTGATGGGGAGCGGG + Exonic
1053454673 9:38225042-38225064 CTGAGGCTTTCATGGGAAGCAGG - Intergenic
1054934402 9:70671333-70671355 CTGTGGGTAGGAGTGGGAGCTGG + Intronic
1056754837 9:89375157-89375179 CGGTGGGGAGGCTGGGAAGCGGG - Intronic
1056792314 9:89633723-89633745 CTGAGGATGTGATGGAAAGCAGG - Intergenic
1056858409 9:90156362-90156384 CAGTGGGTATGATGGGGAGGAGG + Intergenic
1057839133 9:98471070-98471092 CTGAGAATCTGATGGGAAGCTGG + Intronic
1060413860 9:123417221-123417243 CTGTGGGTACCATGGGGAGATGG - Intronic
1060585071 9:124780558-124780580 CTGTGGGTGTAATTGGAAACAGG + Intronic
1060711067 9:125864561-125864583 ATCTGGGGATGATGGGAAACAGG + Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1062431511 9:136528701-136528723 CTGTGGCTCTGCTGGGGAGCAGG - Intronic
1062582504 9:137234765-137234787 CTGTGGGGCTGAGAGGAAGCTGG - Intronic
1188805481 X:34583384-34583406 GTGTGTGTATGATGGTAAGTGGG - Intergenic
1190108761 X:47576295-47576317 CTCAGGGTGTGAGGGGAAGCGGG - Intronic
1190396861 X:49993851-49993873 CTGTGGGGCAGCTGGGAAGCAGG + Intronic
1195748086 X:108138365-108138387 CTGTGTGCCTGATGGAAAGCAGG + Intronic
1199077034 X:143536117-143536139 CTGTGGGTGTCAGGGGAAGGGGG - Intergenic
1199383044 X:147192812-147192834 CTATGAGTAAAATGGGAAGCAGG + Intergenic
1199979505 X:152913245-152913267 TTGTGGGCATGACAGGAAGCAGG - Intergenic
1200831314 Y:7690460-7690482 CTGTGGGTCTTTTGGGGAGCGGG + Intergenic
1202627942 Y:56879801-56879823 TTGAGGGTATGATGGTCAGCTGG - Intergenic