ID: 1096496431

View in Genome Browser
Species Human (GRCh38)
Location 12:52041874-52041896
Sequence ACATTATCCCGTCTGCCTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096496431_1096496435 -3 Left 1096496431 12:52041874-52041896 CCTGAAGGCAGACGGGATAATGT 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1096496435 12:52041894-52041916 TGTGGTTGGCCAAGGCCTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 268
1096496431_1096496437 11 Left 1096496431 12:52041874-52041896 CCTGAAGGCAGACGGGATAATGT 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1096496437 12:52041908-52041930 GCCTGTTGGTCCATCCAGAGTGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096496431 Original CRISPR ACATTATCCCGTCTGCCTTC AGG (reversed) Exonic