ID: 1096499253

View in Genome Browser
Species Human (GRCh38)
Location 12:52055295-52055317
Sequence CAGGACAGGACTTAGCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096499253_1096499261 1 Left 1096499253 12:52055295-52055317 CCTCCTAGCTAAGTCCTGTCCTG 0: 1
1: 0
2: 1
3: 9
4: 128
Right 1096499261 12:52055319-52055341 AGGGTGGGATCAGCCCTGCCAGG 0: 1
1: 0
2: 0
3: 38
4: 270
1096499253_1096499263 5 Left 1096499253 12:52055295-52055317 CCTCCTAGCTAAGTCCTGTCCTG 0: 1
1: 0
2: 1
3: 9
4: 128
Right 1096499263 12:52055323-52055345 TGGGATCAGCCCTGCCAGGTGGG 0: 2
1: 0
2: 3
3: 17
4: 228
1096499253_1096499266 17 Left 1096499253 12:52055295-52055317 CCTCCTAGCTAAGTCCTGTCCTG 0: 1
1: 0
2: 1
3: 9
4: 128
Right 1096499266 12:52055335-52055357 TGCCAGGTGGGCCGCCTTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 165
1096499253_1096499262 4 Left 1096499253 12:52055295-52055317 CCTCCTAGCTAAGTCCTGTCCTG 0: 1
1: 0
2: 1
3: 9
4: 128
Right 1096499262 12:52055322-52055344 GTGGGATCAGCCCTGCCAGGTGG 0: 1
1: 0
2: 1
3: 31
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096499253 Original CRISPR CAGGACAGGACTTAGCTAGG AGG (reversed) Intronic
906693107 1:47805919-47805941 CAGGACAGTGGTTAACTAGGAGG - Intronic
907049379 1:51319356-51319378 CAGAAGAGGACTGACCTAGGAGG + Intronic
907358322 1:53894457-53894479 GAGGACACGACTGAGCTAGGGGG + Exonic
908411437 1:63869612-63869634 CAGTACAGAACTTAGCTTTGTGG + Intronic
909851332 1:80467923-80467945 AAGGACATGACTTGGCTGGGGGG - Intergenic
910038270 1:82815383-82815405 CAGGACAGAATTTAACTAGTTGG - Intergenic
916334286 1:163652721-163652743 CAGGAAGGGACTCAGCTAGTTGG - Intergenic
922874439 1:228928853-228928875 CAGGACAGAAGTAAGCTAGGGGG + Intergenic
924676602 1:246184744-246184766 CATGTGAGGACTTAGCAAGGAGG + Intronic
1063866118 10:10367227-10367249 CAGGACAGGAGCTGGGTAGGTGG - Intergenic
1066178745 10:32939056-32939078 CAGGACAGCACTTCTCTAAGTGG + Intronic
1067741556 10:48899426-48899448 CAGGACAGGACTCTGCTATTGGG + Intronic
1068356547 10:55917091-55917113 GAGCTCAGGACATAGCTAGGTGG + Intergenic
1069870369 10:71529290-71529312 CAACACAGGACTCAGCTGGGAGG + Intronic
1070964332 10:80520450-80520472 CAGGACAGGCCAGTGCTAGGTGG - Exonic
1076519665 10:131073708-131073730 CAGTACAGTACATAGCCAGGGGG - Intergenic
1077313056 11:1900989-1901011 AAGGACAGGAATAAGCAAGGAGG + Intergenic
1079141903 11:17816652-17816674 CTGGCCAGGACTGAGCTAGCAGG - Intronic
1080548209 11:33342935-33342957 CAGGAAAGGACTTAGGAAGTAGG - Intronic
1084180108 11:67441880-67441902 CAGCAGAGGACTGAGCTCGGTGG - Intronic
1086912406 11:92488323-92488345 GAGGAGAGGACTTAGCTAAGTGG + Intronic
1089497737 11:118916259-118916281 GAGGCCTGGACTTAGCTAGCAGG - Intronic
1089690153 11:120182165-120182187 TAGGACAGCACCTAGGTAGGGGG + Intronic
1090355942 11:126140422-126140444 AAGGACAGGGCTGAGCTGGGTGG + Intergenic
1091108595 11:132944389-132944411 CAGGGCTGGACTTGGCTGGGCGG - Intronic
1091207663 11:133832767-133832789 CAGGGCAGGACTTCGCGGGGCGG - Intergenic
1091706526 12:2697217-2697239 CAGGACAGGACATGGCAATGGGG - Intronic
1094765428 12:33588938-33588960 CAGGTGAGGAGTTAGCTATGTGG + Intergenic
1095420952 12:42022932-42022954 CAGAACAGGACCTAAGTAGGTGG - Intergenic
1096499253 12:52055295-52055317 CAGGACAGGACTTAGCTAGGAGG - Intronic
1096781745 12:53995895-53995917 CAGCGCAGGCCTTAGCTAGGAGG + Intronic
1098392210 12:69981368-69981390 CAAGACATGACATAGCTAGTAGG - Intergenic
1100100378 12:91096399-91096421 CAGGACAGGACTAAAACAGGTGG - Intergenic
1102431324 12:112886068-112886090 CAGTGCAGGACTCAGCTATGAGG + Intronic
1106478199 13:30115902-30115924 CAGGTAAGGACACAGCTAGGAGG - Intergenic
1107652852 13:42561952-42561974 CAGGCCAGGACTGAGCATGGTGG - Intergenic
1113443161 13:110345649-110345671 TAGGTCGGTACTTAGCTAGGTGG - Intronic
1117642092 14:57810725-57810747 AAGGCCAGGCCTTAGCTTGGAGG + Intronic
1119074389 14:71621381-71621403 CAGGAAAAGACTGAGCCAGGAGG - Intronic
1121647123 14:95526092-95526114 CAGGACTGGACATAGCTGAGGGG - Intergenic
1126252832 15:46588627-46588649 CAGGACAGGATGTAGCCTGGTGG + Intergenic
1127259416 15:57317414-57317436 CAGGACAGAGCCTATCTAGGTGG + Intergenic
1130642143 15:85687341-85687363 AAGGACTGGAGTTTGCTAGGAGG + Intronic
1131873197 15:96780914-96780936 CAGCACAGGACTTGGGGAGGGGG - Intergenic
1137500728 16:49010111-49010133 CAGGACAGGACCTTGCTGTGTGG + Intergenic
1140150956 16:72364662-72364684 CAAGACAGGAGTAAGCAAGGGGG + Intergenic
1142743407 17:1943110-1943132 CAGGACAGGACCAACCAAGGCGG + Intronic
1142753396 17:2001696-2001718 CAGTACAGGACATAGGAAGGAGG - Intronic
1143574209 17:7780516-7780538 CAGGACATGAAGCAGCTAGGAGG - Intronic
1144050695 17:11495062-11495084 CAGGAAAGGCCTGAGCAAGGTGG + Intronic
1146221961 17:31031854-31031876 CAGCACAGGATTGAGCAAGGGGG - Intergenic
1151712849 17:75816818-75816840 CAGGACAGGACCTGGCTGGGTGG - Exonic
1160726293 19:619195-619217 CAGGACAGGACGTACCTGGATGG + Exonic
1163263289 19:16204142-16204164 CAGGAGAGGACATGGGTAGGTGG + Intronic
1165165222 19:33849365-33849387 CAGGGCAGGACTTAGTCTGGTGG - Intergenic
1165356634 19:35308358-35308380 CTGGAAAGGACTAAGCCAGGGGG + Intronic
931732507 2:65165574-65165596 CAGGAGAAGACTTGGCCAGGGGG + Intergenic
934791217 2:97062175-97062197 CAAGACAGGGCTCAGCTGGGTGG - Intergenic
934815225 2:97320355-97320377 CAAGACAGGGCTCAGCTGGGTGG + Intergenic
934822470 2:97388128-97388150 CAAGACAGGGCTCAGCTGGGTGG - Intergenic
935972196 2:108540735-108540757 CAGGACAGGATTTGCCTAGAAGG + Intronic
936542830 2:113365784-113365806 CAGGACAGGTCCTAGACAGGTGG + Intergenic
936752254 2:115659158-115659180 CAGGAGATGACTTAGCAAGAAGG + Intronic
937049126 2:118874298-118874320 AAGGAAAGGACTTAGGTAGAGGG + Intergenic
938112003 2:128574197-128574219 CAGGAGAGGACTTTGCTTGCTGG + Intergenic
938842415 2:135175714-135175736 CAGGACAGAACTTGGCAAAGTGG + Intronic
941046900 2:160686627-160686649 CTGGTCAGGAGTTAGGTAGGTGG + Intergenic
943201735 2:184835584-184835606 CAGTACAGTACTGAGGTAGGAGG - Intronic
947458989 2:230286176-230286198 CAGGAAAGAACTCATCTAGGAGG - Intronic
947944974 2:234093551-234093573 CAGGAGAGGGCTGCGCTAGGAGG - Intergenic
948357869 2:237394552-237394574 CAGGGCAGGGCGTAGCTTGGTGG + Intronic
1168895881 20:1323172-1323194 CAGGACAGGAATTTCCTGGGAGG + Intronic
1173193963 20:40898735-40898757 TAGGACAGCACTGAGTTAGGAGG + Intergenic
1173875304 20:46366673-46366695 GAGGGCAGGACTTGGCCAGGAGG + Exonic
1178631384 21:34264348-34264370 CAGAAGAGGACCTAGCTAGGTGG - Intergenic
1179140258 21:38719070-38719092 CAGGACAGGCTTTAGGTAGCAGG - Intergenic
1180641317 22:17301724-17301746 CAGAACAGGAATGAGCCAGGAGG - Intergenic
1181831806 22:25565459-25565481 CAGGACAGGACAGGGCTGGGGGG - Intronic
1183408318 22:37640986-37641008 CAGGGCAGGCCTCAGCTGGGAGG + Intronic
1184717743 22:46291445-46291467 CAGGACAGGACTTGGAGAGAAGG - Intronic
1184798334 22:46744891-46744913 GAGGACAGGACTTGGATATGTGG - Intergenic
949371100 3:3335459-3335481 GAGGACAGCACTAAGCTATGAGG - Intergenic
951243320 3:20312334-20312356 CAGGAAGTGACTTAGCTGGGTGG + Intergenic
951932320 3:27982103-27982125 GAGGACAGTACTAAGCAAGGTGG - Intergenic
951962581 3:28345980-28346002 CATAACAGTACTTAGCTAAGTGG - Intronic
955988043 3:64595552-64595574 CAGGACAGAACTTTGCGAGGAGG + Intronic
956163415 3:66378248-66378270 CACAACAGGAATTAACTAGGGGG - Exonic
959989624 3:112616549-112616571 CAGGACAAGACTAAGCTCAGTGG + Intronic
961177448 3:124847493-124847515 CGGAACAGGACTGAGCCAGGAGG - Intronic
962992845 3:140595266-140595288 CAGCACAGGGCTGAGATAGGGGG - Intergenic
963252269 3:143114448-143114470 GAGGACAGGAGCTAGCTAGCTGG - Intergenic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
969921520 4:10544844-10544866 CAGGACAGCACATGGCGAGGAGG + Intronic
970228043 4:13880179-13880201 CAGGACAGGAATTAGGCAGAAGG + Intergenic
971743283 4:30547069-30547091 CAGGTAAGGACATAGCTAGAAGG + Intergenic
972833027 4:42835868-42835890 CATGTCAGGACATAGCTAGAAGG + Intergenic
978710602 4:111775955-111775977 CTGGGCAGGTCTTAGCTATGAGG - Intergenic
994227789 5:97273946-97273968 CTGGACAACACTTAGATAGGAGG + Intergenic
994991895 5:107007496-107007518 CAGGACAGAATTTACCTAGTTGG + Intergenic
995310705 5:110707458-110707480 TTGGACCAGACTTAGCTAGGAGG + Intronic
995911562 5:117193837-117193859 CATGTGAGGACATAGCTAGGAGG + Intergenic
997232312 5:132253933-132253955 AAGGACAGGACTCAGTCAGGAGG - Intronic
998491363 5:142550086-142550108 CATCACAGAACTGAGCTAGGAGG + Intergenic
1002099476 5:176850372-176850394 GAGGACGGCACTGAGCTAGGAGG + Intronic
1003088612 6:3082063-3082085 AAGGGCAGGATTTAGCTAGGGGG + Intronic
1003505834 6:6739722-6739744 TAGAACAGTACTGAGCTAGGAGG + Intergenic
1004586032 6:17001329-17001351 CAGGAAATGACATATCTAGGCGG - Intergenic
1006167075 6:32071286-32071308 CCAGACAGGCCTGAGCTAGGAGG + Intronic
1007697897 6:43745089-43745111 GAGGAGAGGGCTTGGCTAGGGGG + Intergenic
1010059361 6:71605120-71605142 CAGGAAAGGTCTTGGCTAGTGGG + Intergenic
1013517680 6:110903350-110903372 CTGGAGAGGACTGAGCAAGGAGG - Intergenic
1018900067 6:168046577-168046599 CAGGAAAGGACTCAGCCAGTGGG + Intergenic
1019710491 7:2516174-2516196 CTGGACAGGACTCAGCATGGTGG - Intronic
1022370843 7:29769980-29770002 CAGGAGGGGACCTATCTAGGGGG - Intergenic
1023256655 7:38319033-38319055 CAGGCCAAGACTTGGGTAGGAGG - Intergenic
1029306876 7:99626022-99626044 CAGGGCAGGGTTGAGCTAGGTGG + Intronic
1031437292 7:121748609-121748631 CAGGACAGGACTGAGACAGTTGG + Intergenic
1031673990 7:124586932-124586954 CAGGAAAGGACTCACCTAGAGGG - Intergenic
1034003014 7:147437335-147437357 AAGGACAGGGTTTAGCTAGATGG - Intronic
1034616747 7:152424382-152424404 CTGGACTGAGCTTAGCTAGGTGG + Intronic
1035678770 8:1472288-1472310 CAGGAGAGGACGCAGCTGGGAGG + Intergenic
1038925303 8:32132580-32132602 CAAGACAGGACTTAGCAAATAGG - Intronic
1040671122 8:49691691-49691713 CAGGACAGAACCCAGCGAGGGGG - Intergenic
1044299368 8:90565845-90565867 TAGGACAGGACATGACTAGGAGG - Intergenic
1049355989 8:142188315-142188337 CAGGACAGGGCCTTGCTGGGTGG + Intergenic
1052811974 9:33069352-33069374 CAGGACAGGATTTAACTTAGAGG - Intronic
1054957851 9:70933876-70933898 CAGGATTGGACTTTGATAGGAGG + Intronic
1055103748 9:72491937-72491959 TAAAACAGGACATAGCTAGGCGG - Intergenic
1058470598 9:105274432-105274454 CAGGATAGGATTCAGATAGGAGG - Intronic
1059001952 9:110357752-110357774 CAGGTCAGGACTTAGGAGGGTGG + Intergenic
1061771152 9:132923020-132923042 CAGTACAGGACTAAGCTTGTGGG - Intronic
1186891896 X:13967360-13967382 TGGGACAGGACCCAGCTAGGTGG + Intergenic
1189330887 X:40144469-40144491 CAGGAGAGGCCTTTGTTAGGTGG + Intronic
1192143307 X:68662938-68662960 TAGCACAGGACTTAGCTCTGAGG + Intronic
1192189521 X:68982375-68982397 GAGGACAGAACTTAGCTATGAGG - Intergenic
1192925653 X:75752500-75752522 TAGAACAGGCCTTGGCTAGGGGG - Intergenic
1195272085 X:103242172-103242194 CAGGCCAGAACATAACTAGGAGG - Intergenic
1197996081 X:132375370-132375392 CAGTTCAGAACCTAGCTAGGCGG + Intronic
1199798949 X:151230618-151230640 CAGGACAGGACTTAGCTGTGGGG + Intergenic