ID: 1096500010

View in Genome Browser
Species Human (GRCh38)
Location 12:52059016-52059038
Sequence CCCAGGCTTGGGGGTGCTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 371}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096500010_1096500020 21 Left 1096500010 12:52059016-52059038 CCCAGAGCACCCCCAAGCCTGGG 0: 1
1: 0
2: 2
3: 58
4: 371
Right 1096500020 12:52059060-52059082 ACCTTCTCACCTGCTCCAGGAGG 0: 1
1: 0
2: 2
3: 24
4: 233
1096500010_1096500018 18 Left 1096500010 12:52059016-52059038 CCCAGAGCACCCCCAAGCCTGGG 0: 1
1: 0
2: 2
3: 58
4: 371
Right 1096500018 12:52059057-52059079 TCCACCTTCTCACCTGCTCCAGG 0: 1
1: 0
2: 6
3: 52
4: 450
1096500010_1096500024 30 Left 1096500010 12:52059016-52059038 CCCAGAGCACCCCCAAGCCTGGG 0: 1
1: 0
2: 2
3: 58
4: 371
Right 1096500024 12:52059069-52059091 CCTGCTCCAGGAGGTTTGCAGGG 0: 1
1: 1
2: 0
3: 18
4: 256
1096500010_1096500022 29 Left 1096500010 12:52059016-52059038 CCCAGAGCACCCCCAAGCCTGGG 0: 1
1: 0
2: 2
3: 58
4: 371
Right 1096500022 12:52059068-52059090 ACCTGCTCCAGGAGGTTTGCAGG 0: 1
1: 0
2: 1
3: 18
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096500010 Original CRISPR CCCAGGCTTGGGGGTGCTCT GGG (reversed) Exonic