ID: 1096501908

View in Genome Browser
Species Human (GRCh38)
Location 12:52069465-52069487
Sequence GTCCTGCAGTACAGCGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096501901_1096501908 26 Left 1096501901 12:52069416-52069438 CCGTCTGTTACGCACATTCAACA 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1096501908 12:52069465-52069487 GTCCTGCAGTACAGCGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1096501904_1096501908 -10 Left 1096501904 12:52069452-52069474 CCATCCACTGGGCGTCCTGCAGT 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1096501908 12:52069465-52069487 GTCCTGCAGTACAGCGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1096501900_1096501908 27 Left 1096501900 12:52069415-52069437 CCCGTCTGTTACGCACATTCAAC 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1096501908 12:52069465-52069487 GTCCTGCAGTACAGCGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096501908 Original CRISPR GTCCTGCAGTACAGCGGTGT GGG Intronic
903324223 1:22560638-22560660 GTCAAGCAGTACAGGGCTGTGGG - Intergenic
906050551 1:42867875-42867897 TTCCTGAAGGACAGCGGTGAAGG + Intergenic
919230083 1:194762954-194762976 GTCTAGGAGTACAGTGGTGTGGG - Intergenic
923285056 1:232486154-232486176 GTCCTGGAGTAGAGCTGTTTGGG + Intronic
1062802065 10:388214-388236 GACTTGCAGTAGAGCTGTGTAGG - Intronic
1063400038 10:5734770-5734792 AGCCTGGAGTACAGTGGTGTGGG + Intronic
1064545754 10:16448535-16448557 GTCCAGGGGTCCAGCGGTGTGGG - Intronic
1065042407 10:21711098-21711120 GGGCTGCAGTACAGAGGTGAAGG - Intronic
1065166659 10:22986090-22986112 GGCGTGCAGTGCAGGGGTGTGGG - Intronic
1065493164 10:26303094-26303116 ATCCTGGAGTACAGCAGGGTTGG - Exonic
1074747217 10:116546856-116546878 GTCCTGCAGTACAGCAAGGATGG + Intronic
1076772560 10:132674378-132674400 TTCCTGAAGGACAGCGGTGAAGG - Intronic
1076889363 10:133276362-133276384 GGCCTGGAGTGCAGGGGTGTGGG - Intronic
1076931019 10:133531766-133531788 CTCTTGCAGACCAGCGGTGTGGG + Intronic
1077148649 11:1057873-1057895 GTCCTGCAGTTCATCCATGTCGG + Intergenic
1096501908 12:52069465-52069487 GTCCTGCAGTACAGCGGTGTGGG + Intronic
1097249523 12:57624902-57624924 GTCCCAAAGTACAGTGGTGTTGG - Exonic
1099224708 12:79956013-79956035 GGACTGCAGTACAGCAGAGTTGG + Intergenic
1104723433 12:131060048-131060070 GTGCCGCAGTACTGCGGCGTGGG + Intronic
1105964619 13:25372699-25372721 GCTCTGCAGCACAGCGGTGCCGG - Intronic
1107479131 13:40770989-40771011 GTACCGCAGTTCAGCGCTGTTGG - Exonic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112242130 13:97692786-97692808 GTGCTGCAGTAGAGGGGTGTTGG - Intergenic
1116530948 14:45972756-45972778 TTCCTGAAGGACAGTGGTGTAGG + Intergenic
1117913717 14:60656732-60656754 GTCAAGCACTGCAGCGGTGTTGG - Intronic
1118760999 14:68880095-68880117 GTCCTGCAGCACATCCGTGTGGG - Exonic
1119204563 14:72784419-72784441 CTCCGGCAGTACAGAGGTTTTGG - Intronic
1124061225 15:26295232-26295254 GTCCTGCAGTACACCAGGGAAGG + Intergenic
1125400590 15:39298305-39298327 GTTCTGCAGTACAGTTGTCTAGG + Intergenic
1129411783 15:75354411-75354433 GCCCTGCAGGACACTGGTGTTGG - Exonic
1129842377 15:78751745-78751767 GTTCTGCAGCACAGGAGTGTTGG + Intergenic
1131648780 15:94376062-94376084 GTCCTGCAGTAGAGGAGTGAAGG - Intronic
1132643901 16:990077-990099 GTCCTGGAGCAGAGCAGTGTAGG + Intergenic
1138263366 16:55641646-55641668 GACCTGCAGTACAGCTGTTATGG + Intergenic
1141172864 16:81702101-81702123 GTCCTTCAGCAAAGAGGTGTGGG - Intronic
1141500472 16:84440848-84440870 GCCCTGCAGGTCAGCGGAGTTGG + Exonic
1145369229 17:22294842-22294864 GTCCTGCAGTCCACCTCTGTGGG - Intergenic
1157430589 18:47621274-47621296 GTGCTGCTGTACTGCAGTGTAGG + Intergenic
1162520112 19:11174663-11174685 CTCCTGCAGCACTGTGGTGTAGG + Exonic
1163124840 19:15239262-15239284 GTCCTGCAGAACAGAGAGGTTGG + Exonic
1167782458 19:51608011-51608033 GTGCTGCAGGACAGAGGTGCTGG - Intergenic
1167955244 19:53058706-53058728 CTCCTGCAGCTCAGCGGTCTGGG + Intergenic
1168007772 19:53505193-53505215 GACCTGCTGTAGTGCGGTGTGGG - Intergenic
930402450 2:50907422-50907444 GTCCTTCATTACAGCAGTGTTGG + Intronic
931587297 2:63841785-63841807 CTCCTGCAGTACAGCCCTGGAGG + Exonic
941668080 2:168261562-168261584 TTCCTGAAGGACAGCGGTGAAGG + Intergenic
1169920271 20:10727510-10727532 GAACTCAAGTACAGCGGTGTGGG - Intergenic
1174376685 20:50130709-50130731 GTCTTGCAGCACAGGGGTGAGGG + Intronic
1176998218 21:15580618-15580640 TCCCTGCAGGACAGCGGTGAAGG + Intergenic
1181367378 22:22388525-22388547 TCCCTGAAGTACAGCGGTGAAGG - Intergenic
1183629378 22:39023995-39024017 GTCCTGGCCTACAGCGGTGCTGG + Intronic
1185246345 22:49775238-49775260 GTCCTGCAGTACAGGGGTCCGGG + Intronic
949800297 3:7896759-7896781 GTCCTGAAGTCCAGCTGTCTGGG + Intergenic
953982132 3:47418247-47418269 GTCCTGCAGAAGCCCGGTGTTGG + Exonic
954373871 3:50184232-50184254 GGCCTGCAGTCCAGCTGTGCAGG + Intronic
956678940 3:71760002-71760024 GTCCTGAAGTTCAGTGGTCTTGG - Intergenic
957025086 3:75172730-75172752 ATTGTGCAGTACAGAGGTGTGGG - Intergenic
958025210 3:88041247-88041269 ATCCTGCAATCCAGTGGTGTTGG - Intergenic
960510518 3:118543699-118543721 GTCCTGCAATGCACTGGTGTTGG + Intergenic
964988689 3:162777635-162777657 GTCCTGCAGTTCAGTCGTTTGGG - Intergenic
966158642 3:176945575-176945597 GGCCTGCTGTACAGGGGTTTGGG - Intergenic
969583897 4:8081080-8081102 GTCTTGCAGGAGAGCGGAGTTGG + Intronic
969701706 4:8771262-8771284 GTCCTGCAGTACAGACGGGCAGG + Intergenic
982464305 4:155710997-155711019 GTCTTGCAGAATAGCGATGTGGG - Exonic
997833926 5:137177301-137177323 GTCCTGCAGTACAGGTCTGCTGG + Intronic
1002206925 5:177569290-177569312 GTCCAGCAGGGCAGCGGGGTGGG + Intergenic
1015130009 6:129798737-129798759 GTCCTGAAGTACTGCGGCTTAGG - Intergenic
1015475809 6:133657916-133657938 TTCCTGAAGGACAGCGGTGAAGG + Intergenic
1019479557 7:1260234-1260256 GTCCTGGACTGCAGGGGTGTGGG - Intergenic
1034548211 7:151802783-151802805 CTGCTGCAGAAGAGCGGTGTGGG - Intronic
1046265652 8:111825872-111825894 CTCCTGAAGGACAGTGGTGTGGG - Intergenic
1053898915 9:42773426-42773448 TTCCTGCAGTACAATGCTGTTGG + Intergenic
1056933876 9:90900754-90900776 GTCCCACAGCACAGAGGTGTTGG - Intergenic
1061141909 9:128772206-128772228 GTCCTGCTATTCAGCAGTGTTGG - Intronic
1196135903 X:112209410-112209432 TCCCTGAAGGACAGCGGTGTAGG - Intergenic
1198363142 X:135915415-135915437 GTCCTGAAGGACAGTGGTGAAGG - Intergenic