ID: 1096503572

View in Genome Browser
Species Human (GRCh38)
Location 12:52079864-52079886
Sequence TGCACCGCGCGCGGCCCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096503572_1096503582 21 Left 1096503572 12:52079864-52079886 CCCGAGGGGCCGCGCGCGGTGCA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1096503582 12:52079908-52079930 GTCCCTGCTGGTGCTTTGCGGGG 0: 1
1: 0
2: 2
3: 10
4: 127
1096503572_1096503578 -8 Left 1096503572 12:52079864-52079886 CCCGAGGGGCCGCGCGCGGTGCA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1096503578 12:52079879-52079901 GCGGTGCAGGCGGTGGTGCTCGG 0: 1
1: 0
2: 1
3: 20
4: 294
1096503572_1096503579 9 Left 1096503572 12:52079864-52079886 CCCGAGGGGCCGCGCGCGGTGCA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1096503579 12:52079896-52079918 GCTCGGCGTGCTGTCCCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 108
1096503572_1096503580 19 Left 1096503572 12:52079864-52079886 CCCGAGGGGCCGCGCGCGGTGCA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1096503580 12:52079906-52079928 CTGTCCCTGCTGGTGCTTTGCGG 0: 1
1: 0
2: 5
3: 32
4: 241
1096503572_1096503581 20 Left 1096503572 12:52079864-52079886 CCCGAGGGGCCGCGCGCGGTGCA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1096503581 12:52079907-52079929 TGTCCCTGCTGGTGCTTTGCGGG 0: 1
1: 0
2: 2
3: 21
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096503572 Original CRISPR TGCACCGCGCGCGGCCCCTC GGG (reversed) Intergenic
901242863 1:7704951-7704973 CGCCCCGCGCGCGCCCCCGCCGG - Intronic
903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG + Intergenic
904500165 1:30908635-30908657 CGCCCCGCGCGCCGCGCCTCGGG - Exonic
905408324 1:37752615-37752637 AGAACCGCGCGCCTCCCCTCTGG + Intronic
912385556 1:109269599-109269621 TGCACTGCCCTCGCCCCCTCAGG + Intronic
913942262 1:125119599-125119621 TGCACTGCGCTCGGCCCCGATGG + Intergenic
916651627 1:166839495-166839517 TCCCGTGCGCGCGGCCCCTCGGG - Intronic
917797534 1:178542751-178542773 TGCAGCGCGCGGGGCCCGGCGGG - Intronic
923147293 1:231207057-231207079 TGCACCTCAACCGGCCCCTCCGG - Intronic
1063396509 10:5692863-5692885 TGCTCCGCCGGCAGCCCCTCCGG - Intronic
1064982126 10:21174711-21174733 TGCACCGCGCCCGCTCCCACGGG + Intergenic
1065214779 10:23439175-23439197 TGCAGCGGGCGCGGCGCCCCGGG + Intergenic
1065373796 10:25016582-25016604 TGCCCTGCGCGAGGCCGCTCGGG + Intronic
1075691648 10:124399629-124399651 GACACCGCGCCCGGCCCCTCAGG + Intronic
1076268652 10:129131397-129131419 TGCACCCCGAGCAGCCCTTCGGG - Intergenic
1080283874 11:30586329-30586351 TGCACCGCTCGCTCTCCCTCCGG - Intronic
1083638202 11:64131610-64131632 GCCACCGCGCCCAGCCCCTCAGG + Intronic
1083812772 11:65115025-65115047 TGCACCACCCGCAGCCCCTGGGG + Exonic
1084575434 11:69985633-69985655 TGCACCTCGCAGGGCCGCTCGGG + Intergenic
1091718537 12:2795888-2795910 TGCCCCGCGCCCGGCCTCCCCGG - Intronic
1096503572 12:52079864-52079886 TGCACCGCGCGCGGCCCCTCGGG - Intergenic
1097491017 12:60270142-60270164 AGCTCCGCCCGCGGCCCCTCCGG + Intergenic
1100385545 12:94101988-94102010 TGCACCGCGAGGTGTCCCTCAGG - Intergenic
1103764779 12:123272028-123272050 TGCCCCGCGCCCGGCGCCCCGGG + Exonic
1104953554 12:132453231-132453253 TGCAGCGTGTGAGGCCCCTCCGG - Intergenic
1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1107971273 13:45645174-45645196 TGCACCGTGCGCGCACCCACTGG - Intergenic
1110860869 13:80343002-80343024 CGCTGCGCTCGCGGCCCCTCTGG + Intergenic
1114801914 14:25784715-25784737 TGCACGGTGCGCGGACCCACTGG + Intergenic
1116516484 14:45812775-45812797 GCCACCGCGCCCGGCCCCTGAGG + Intergenic
1116824457 14:49658360-49658382 GCCACCGCGCCCGGCCCCTCTGG + Intronic
1121312246 14:92941523-92941545 TGCGCCCTGCGCTGCCCCTCTGG + Exonic
1122418706 14:101562383-101562405 TGCACGGCGCTCGGCCCCGGAGG + Exonic
1122917313 14:104865168-104865190 CGCACCCCGCGCCGCCCCGCCGG - Intergenic
1129612312 15:77070769-77070791 GGGGCCGCGCGCGGGCCCTCAGG - Intronic
1129860326 15:78855536-78855558 GCCACCGCGCCCGGCCCCTTTGG - Intronic
1130239264 15:82170398-82170420 GCCACCGCGCCCGGCCCCACTGG + Intronic
1132398102 15:101489178-101489200 TGTCCCGCGCGCGCCCCCCCGGG + Intronic
1133007693 16:2893922-2893944 GCCACCGCGCCCGGCCCCTTTGG + Intronic
1136498382 16:30657918-30657940 GGCACAGCACGCGGCCGCTCGGG + Intergenic
1136560449 16:31036063-31036085 GCCACCGCGCGCGGCCCCTGGGG + Intronic
1139518533 16:67466012-67466034 TCCACAGCGAGGGGCCCCTCTGG + Intronic
1142243306 16:88956859-88956881 TGCACCAAGCCCGGCCCCTGGGG + Intronic
1142338630 16:89506840-89506862 GGCACCGCGCCCGGCCCACCTGG + Intronic
1143166361 17:4899156-4899178 GGCACCCCGCGCGGCCCCCCGGG + Intronic
1147341305 17:39754557-39754579 TGCACCCCGCCCCGCCCTTCCGG - Intergenic
1147557955 17:41491573-41491595 TGGACCCCGTGCAGCCCCTCTGG + Intronic
1148502401 17:48101546-48101568 TGCGCGGCGCGCGGCGCTTCGGG - Intergenic
1149694087 17:58602779-58602801 GCCACCACGCCCGGCCCCTCTGG - Intronic
1152125018 17:78441406-78441428 AGCACAGTGCGGGGCCCCTCGGG - Intronic
1152685536 17:81691936-81691958 GGCACCGGCCGCGGCCCCGCAGG - Intronic
1153219124 18:2847030-2847052 TGCTCCGCGGCCGCCCCCTCCGG - Exonic
1158678373 18:59543547-59543569 GCCACCGCGCCCGGCCTCTCGGG - Intronic
1159618168 18:70606450-70606472 GCCACCGCGCCCGGCCGCTCTGG - Intergenic
1160734712 19:657258-657280 GGCACAGCGCTCGGCCGCTCTGG + Intronic
1161126057 19:2558125-2558147 GCCACCGCGCCCGGCCTCTCAGG + Intronic
1162907085 19:13830518-13830540 AGCACCGCGGGCTGCCGCTCCGG + Exonic
1165129187 19:33621751-33621773 TGCGGCTCCCGCGGCCCCTCTGG - Intergenic
1166330664 19:42076375-42076397 TGCCCGGCGCGCACCCCCTCAGG - Intronic
1167258395 19:48443985-48444007 TCCACTGCGGGCGCCCCCTCGGG - Exonic
1167409425 19:49336267-49336289 GCCACCGCGCCCGGCCCCTAGGG - Intronic
928031589 2:27784267-27784289 GCCACCGCGCCCGGCCTCTCAGG + Intronic
928331431 2:30360755-30360777 GCCACCGCGCCCGGCCCATCTGG + Intergenic
934567076 2:95346919-95346941 TGCAGCCCGCACGGCCTCTCGGG - Intronic
934971895 2:98770574-98770596 GCCACCGCGCCCGGCCCCTAGGG - Intergenic
936279052 2:111122262-111122284 TGCGCCGCGCCCGGACCCGCAGG - Intronic
946339254 2:219057737-219057759 TGCACCTCGGCCGGCTCCTCCGG - Intronic
1168757105 20:325525-325547 TTCTCCCCGCGCGGCCCCGCCGG - Exonic
1169266853 20:4172279-4172301 CGCAGCTGGCGCGGCCCCTCCGG + Intronic
1170654435 20:18272924-18272946 GCCACCGCGCCCGTCCCCTCTGG - Intergenic
1173514091 20:43652717-43652739 GCCACCGCGCCCGGCCACTCTGG - Intergenic
1176148355 20:63575354-63575376 TGCTCAGCGCCCGGCCCCTGGGG - Intergenic
1179810094 21:43864944-43864966 GGCTCCGCGCCCGGCCCCGCCGG + Intergenic
1180616391 22:17131107-17131129 GCCACCGCGCCCGGCCCCTTTGG - Intronic
1183394735 22:37565062-37565084 GCCACCGCGCCCAGCCCCTCAGG + Intronic
1184890435 22:47375783-47375805 AGCAGCGCCCCCGGCCCCTCGGG - Intergenic
1185259365 22:49853319-49853341 GGCTCCCCGCGCGGCCCCCCCGG - Intergenic
1185327376 22:50233518-50233540 TGCACCCCTCGCAGCCCCCCTGG - Exonic
949597554 3:5564038-5564060 GCCACCGCACCCGGCCCCTCAGG - Intergenic
960822502 3:121749551-121749573 GGCAGCTCCCGCGGCCCCTCTGG + Intronic
961822282 3:129581135-129581157 TGCACACCACGTGGCCCCTCGGG - Intronic
963110543 3:141684307-141684329 GCCACCGCGCCCGGCCCCACAGG + Intergenic
968666298 4:1824034-1824056 GCCACCGCGCCCGGCCCCTGGGG - Intronic
968879852 4:3293215-3293237 TGCGCGGCGCCCGTCCCCTCGGG + Intronic
969360311 4:6658987-6659009 TCCACCCCGCGCTGCCCCGCCGG - Intergenic
975346310 4:73296224-73296246 GCCACCGCGCCCGGCCTCTCAGG - Intergenic
979231580 4:118353170-118353192 TGCTCCGCGCGGGCACCCTCGGG - Intergenic
980619009 4:135272539-135272561 GCCACCGCGCCCGGCCTCTCTGG + Intergenic
980781374 4:137496410-137496432 TGCACCGTGCGCGCACCCACTGG - Intergenic
982318062 4:154051071-154051093 GCCACCGCGCCCGGCCTCTCAGG + Intergenic
984693393 4:182754541-182754563 TGCACCGCGTGCTTCCCCACAGG - Exonic
985613174 5:901907-901929 GCCACCGCGCGCGGCCCCTGGGG + Intronic
990437870 5:55812273-55812295 ACCACCGCGCCCGGCCCCTACGG - Intronic
990984082 5:61626034-61626056 TGCAGCGACCACGGCCCCTCAGG - Intergenic
996919003 5:128745450-128745472 GCCACCGCGCCCGGCCCCTCAGG + Intronic
1001381622 5:171309833-171309855 CGCACAGGGCGCGGCGCCTCTGG - Intronic
1006138772 6:31914304-31914326 GCCACCGCGCCCGGCCACTCAGG - Intronic
1015149118 6:130019362-130019384 AGCCCCGCGCGCCGCCCCTGCGG + Intronic
1024632530 7:51261678-51261700 GCCACCGCGCCTGGCCCCTCGGG - Intronic
1030271234 7:107670391-107670413 CTCACCGCGCCCGGTCCCTCCGG + Intronic
1032818795 7:135504770-135504792 GCCACCGCGCCCGGCCCATCCGG + Intronic
1034257723 7:149733665-149733687 TGCCCGGCGAGCGGTCCCTCTGG - Exonic
1035163459 7:156968323-156968345 TGCCCCCCGCCCTGCCCCTCCGG + Intronic
1038311309 8:26448492-26448514 TGGAACGTGCGCGGCCCCGCAGG + Intronic
1040454596 8:47583864-47583886 TGCTCCAAGGGCGGCCCCTCTGG - Intronic
1045815089 8:106269983-106270005 CTCCCCGCGCGCGGCCCCTCTGG - Intergenic
1049754843 8:144306016-144306038 GCCACCGCGCCCGGCCCCTCTGG + Intronic
1053269426 9:36739965-36739987 AGCACCCCGCGTGGCCCCGCAGG - Intergenic
1053532902 9:38899406-38899428 TGCCCCGCCCGCTGCCCCTAAGG + Intergenic
1054205129 9:62123835-62123857 TGCCCCGCCCGCTGCCCCTAAGG + Intergenic
1054633231 9:67464535-67464557 TGCCCCGCCCGCTGCCCCTAAGG - Intergenic
1057151315 9:92798500-92798522 TGCCCCGCCCGCTGCCCCTAAGG - Intergenic
1059375333 9:113876436-113876458 TGCACCGCGCGGGGGACCCCGGG + Intronic
1061541556 9:131280260-131280282 TCCCCAGCTCGCGGCCCCTCCGG + Intergenic
1062421532 9:136484676-136484698 TGCACCGCCTGCGGCCCTGCTGG - Exonic
1062646649 9:137551420-137551442 TCCGCCGGGCGCGGCTCCTCTGG - Exonic
1186487065 X:9941683-9941705 GCCACCGCGCCCGGCCGCTCAGG - Intronic
1192360093 X:70433923-70433945 TGCACCGCGCGCCCGGCCTCCGG - Intergenic