ID: 1096506843

View in Genome Browser
Species Human (GRCh38)
Location 12:52099080-52099102
Sequence CCTCATATCCAGAGGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096506843_1096506848 -8 Left 1096506843 12:52099080-52099102 CCTCTCTCCCTCTGGATATGAGG No data
Right 1096506848 12:52099095-52099117 ATATGAGGAAGAGTTTCACAGGG No data
1096506843_1096506849 17 Left 1096506843 12:52099080-52099102 CCTCTCTCCCTCTGGATATGAGG No data
Right 1096506849 12:52099120-52099142 GTGTGTACCCCCTGCGATATTGG No data
1096506843_1096506850 18 Left 1096506843 12:52099080-52099102 CCTCTCTCCCTCTGGATATGAGG No data
Right 1096506850 12:52099121-52099143 TGTGTACCCCCTGCGATATTGGG No data
1096506843_1096506847 -9 Left 1096506843 12:52099080-52099102 CCTCTCTCCCTCTGGATATGAGG No data
Right 1096506847 12:52099094-52099116 GATATGAGGAAGAGTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096506843 Original CRISPR CCTCATATCCAGAGGGAGAG AGG (reversed) Intergenic
No off target data available for this crispr