ID: 1096508816

View in Genome Browser
Species Human (GRCh38)
Location 12:52115544-52115566
Sequence GTGTACACACACTTCGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096508816_1096508822 7 Left 1096508816 12:52115544-52115566 CCAATATCGAAGTGTGTGTACAC No data
Right 1096508822 12:52115574-52115596 GATATGGTTTTTAATATCCAGGG No data
1096508816_1096508823 8 Left 1096508816 12:52115544-52115566 CCAATATCGAAGTGTGTGTACAC No data
Right 1096508823 12:52115575-52115597 ATATGGTTTTTAATATCCAGGGG No data
1096508816_1096508817 -9 Left 1096508816 12:52115544-52115566 CCAATATCGAAGTGTGTGTACAC No data
Right 1096508817 12:52115558-52115580 TGTGTACACCCCTTGTGATATGG No data
1096508816_1096508821 6 Left 1096508816 12:52115544-52115566 CCAATATCGAAGTGTGTGTACAC No data
Right 1096508821 12:52115573-52115595 TGATATGGTTTTTAATATCCAGG No data
1096508816_1096508826 16 Left 1096508816 12:52115544-52115566 CCAATATCGAAGTGTGTGTACAC No data
Right 1096508826 12:52115583-52115605 TTTAATATCCAGGGGACGGGAGG No data
1096508816_1096508824 12 Left 1096508816 12:52115544-52115566 CCAATATCGAAGTGTGTGTACAC No data
Right 1096508824 12:52115579-52115601 GGTTTTTAATATCCAGGGGACGG No data
1096508816_1096508825 13 Left 1096508816 12:52115544-52115566 CCAATATCGAAGTGTGTGTACAC No data
Right 1096508825 12:52115580-52115602 GTTTTTAATATCCAGGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096508816 Original CRISPR GTGTACACACACTTCGATAT TGG (reversed) Intergenic
No off target data available for this crispr