ID: 1096509006

View in Genome Browser
Species Human (GRCh38)
Location 12:52116856-52116878
Sequence AACGGCCTATGGAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096509006_1096509015 18 Left 1096509006 12:52116856-52116878 CCCCCAGAGTTCCATAGGCCGTT No data
Right 1096509015 12:52116897-52116919 ATGCACTTGAAGGGTTAAAAAGG 0: 13
1: 14
2: 29
3: 34
4: 188
1096509006_1096509013 9 Left 1096509006 12:52116856-52116878 CCCCCAGAGTTCCATAGGCCGTT No data
Right 1096509013 12:52116888-52116910 TAATGCTCCATGCACTTGAAGGG 0: 5
1: 31
2: 40
3: 34
4: 102
1096509006_1096509012 8 Left 1096509006 12:52116856-52116878 CCCCCAGAGTTCCATAGGCCGTT No data
Right 1096509012 12:52116887-52116909 ATAATGCTCCATGCACTTGAAGG 0: 7
1: 28
2: 40
3: 30
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096509006 Original CRISPR AACGGCCTATGGAACTCTGG GGG (reversed) Intergenic
No off target data available for this crispr