ID: 1096511609

View in Genome Browser
Species Human (GRCh38)
Location 12:52132882-52132904
Sequence GCCAACCCCTCATCTAGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096511609_1096511611 -4 Left 1096511609 12:52132882-52132904 CCAACGCTAGATGAGGGGTTGGC No data
Right 1096511611 12:52132901-52132923 TGGCACACTTTTGCTGAAAAGGG No data
1096511609_1096511610 -5 Left 1096511609 12:52132882-52132904 CCAACGCTAGATGAGGGGTTGGC No data
Right 1096511610 12:52132900-52132922 TTGGCACACTTTTGCTGAAAAGG No data
1096511609_1096511612 17 Left 1096511609 12:52132882-52132904 CCAACGCTAGATGAGGGGTTGGC No data
Right 1096511612 12:52132922-52132944 GGCCAGAGAGTAAGTACTCTTGG No data
1096511609_1096511614 26 Left 1096511609 12:52132882-52132904 CCAACGCTAGATGAGGGGTTGGC No data
Right 1096511614 12:52132931-52132953 GTAAGTACTCTTGGCTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096511609 Original CRISPR GCCAACCCCTCATCTAGCGT TGG (reversed) Intergenic
No off target data available for this crispr