ID: 1096515621

View in Genome Browser
Species Human (GRCh38)
Location 12:52153611-52153633
Sequence ACACTCTCCTGGCCATGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096515614_1096515621 10 Left 1096515614 12:52153578-52153600 CCAAGCCCAGGTCTGGCTGTGGC No data
Right 1096515621 12:52153611-52153633 ACACTCTCCTGGCCATGGTCTGG No data
1096515608_1096515621 17 Left 1096515608 12:52153571-52153593 CCCCTTCCCAAGCCCAGGTCTGG No data
Right 1096515621 12:52153611-52153633 ACACTCTCCTGGCCATGGTCTGG No data
1096515610_1096515621 16 Left 1096515610 12:52153572-52153594 CCCTTCCCAAGCCCAGGTCTGGC No data
Right 1096515621 12:52153611-52153633 ACACTCTCCTGGCCATGGTCTGG No data
1096515611_1096515621 15 Left 1096515611 12:52153573-52153595 CCTTCCCAAGCCCAGGTCTGGCT No data
Right 1096515621 12:52153611-52153633 ACACTCTCCTGGCCATGGTCTGG No data
1096515616_1096515621 4 Left 1096515616 12:52153584-52153606 CCAGGTCTGGCTGTGGCCATACC No data
Right 1096515621 12:52153611-52153633 ACACTCTCCTGGCCATGGTCTGG No data
1096515615_1096515621 5 Left 1096515615 12:52153583-52153605 CCCAGGTCTGGCTGTGGCCATAC No data
Right 1096515621 12:52153611-52153633 ACACTCTCCTGGCCATGGTCTGG No data
1096515612_1096515621 11 Left 1096515612 12:52153577-52153599 CCCAAGCCCAGGTCTGGCTGTGG No data
Right 1096515621 12:52153611-52153633 ACACTCTCCTGGCCATGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096515621 Original CRISPR ACACTCTCCTGGCCATGGTC TGG Intergenic
No off target data available for this crispr