ID: 1096516320

View in Genome Browser
Species Human (GRCh38)
Location 12:52157513-52157535
Sequence TAAGTGCCAGGTCCACTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096516315_1096516320 25 Left 1096516315 12:52157465-52157487 CCAGAGCCTCCGTCATTGGTATG No data
Right 1096516320 12:52157513-52157535 TAAGTGCCAGGTCCACTGCAAGG No data
1096516317_1096516320 16 Left 1096516317 12:52157474-52157496 CCGTCATTGGTATGTCTGCACAT No data
Right 1096516320 12:52157513-52157535 TAAGTGCCAGGTCCACTGCAAGG No data
1096516316_1096516320 19 Left 1096516316 12:52157471-52157493 CCTCCGTCATTGGTATGTCTGCA No data
Right 1096516320 12:52157513-52157535 TAAGTGCCAGGTCCACTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096516320 Original CRISPR TAAGTGCCAGGTCCACTGCA AGG Intergenic
No off target data available for this crispr