ID: 1096516661

View in Genome Browser
Species Human (GRCh38)
Location 12:52159841-52159863
Sequence TACCACTGCATTTCAGCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096516661_1096516663 10 Left 1096516661 12:52159841-52159863 CCCTAGGCTGAAATGCAGTGGTA No data
Right 1096516663 12:52159874-52159896 TCACTGCAACCTCCGCCTTCTGG 0: 1590
1: 43693
2: 158147
3: 142664
4: 82940
1096516661_1096516664 11 Left 1096516661 12:52159841-52159863 CCCTAGGCTGAAATGCAGTGGTA No data
Right 1096516664 12:52159875-52159897 CACTGCAACCTCCGCCTTCTGGG 0: 820
1: 24459
2: 118926
3: 224201
4: 181459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096516661 Original CRISPR TACCACTGCATTTCAGCCTA GGG (reversed) Intergenic
No off target data available for this crispr