ID: 1096518142

View in Genome Browser
Species Human (GRCh38)
Location 12:52169649-52169671
Sequence CTGATCATGCAGAAACAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096518140_1096518142 -5 Left 1096518140 12:52169631-52169653 CCAGATAGTACATACAGACTGAT 0: 1
1: 0
2: 0
3: 4
4: 1473
Right 1096518142 12:52169649-52169671 CTGATCATGCAGAAACAGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096518142 Original CRISPR CTGATCATGCAGAAACAGGA AGG Exonic
901024599 1:6272521-6272543 CTGATCCTGCACACACAGGTGGG + Intronic
901504155 1:9673954-9673976 GTGGGCATGCAGAGACAGGAAGG + Intronic
904591886 1:31619468-31619490 CTGATTAGGCAGAACTAGGATGG + Intronic
905470791 1:38190230-38190252 CTGACTATGCAGATGCAGGAAGG - Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
907511835 1:54967277-54967299 CTAGTCATGGAGAAATAGGAAGG + Intergenic
909666823 1:78143386-78143408 CTGGCCATGCAAAAAGAGGAAGG - Intergenic
911157325 1:94649876-94649898 TTGAACATGCAGAAGCATGATGG + Intergenic
911700188 1:100943570-100943592 CTGGTCATGCAGAAAGATCAAGG - Intronic
913209003 1:116567958-116567980 CTGATCATGAGGAAACAAGCAGG + Intronic
915090419 1:153420247-153420269 CTGAGGATGCAGAAACAGGCAGG + Exonic
915095073 1:153456846-153456868 CTGAGGATGCAGAAACAAGCAGG - Intergenic
915865669 1:159495348-159495370 GAGAGCAAGCAGAAACAGGATGG - Intergenic
915952575 1:160199221-160199243 CTGAGCAAGGGGAAACAGGACGG + Intronic
917209469 1:172616675-172616697 CTGTCCATCCAGAAAAAGGAAGG - Intergenic
923089605 1:230729855-230729877 CTTATCTTTAAGAAACAGGAAGG + Intergenic
923717047 1:236433999-236434021 ATGACCATGGAGCAACAGGATGG - Intronic
923854317 1:237829382-237829404 CTGAGGATGCAGAAACTAGATGG - Intronic
1064978873 10:21146505-21146527 CTGATAATGCAGGAGTAGGATGG - Exonic
1066704278 10:38160734-38160756 ATGAGCATGCAGAAAGAGGTGGG - Intergenic
1066986344 10:42471124-42471146 ATGAGCATGCAGAAAGAGGTGGG + Intergenic
1069148068 10:64920620-64920642 CTGATAATGCAGAAATGCGAAGG + Intergenic
1070708114 10:78656509-78656531 CTGATCACCCAGACAAAGGAGGG - Intergenic
1071548789 10:86549850-86549872 CTGAACCTGTAGAAACATGATGG - Intergenic
1071684835 10:87743725-87743747 CTGCTCATGAGGAAACAGAAAGG - Intronic
1072182253 10:92997323-92997345 CTCAGAATACAGAAACAGGAAGG + Intronic
1074546815 10:114407761-114407783 CTGATAAGACAGAAACACGAGGG + Intergenic
1074845241 10:117391846-117391868 CTGTTTATACAGGAACAGGATGG + Intergenic
1075204837 10:120437853-120437875 CTGAACATGATGAAAGAGGAAGG - Intergenic
1076247135 10:128956100-128956122 ATGCTCCTGCAGAAACAGGAGGG + Intergenic
1076305013 10:129460038-129460060 GTGAGGATGCAGAAAGAGGATGG + Intergenic
1077035157 11:490946-490968 CTGACCAGGCAGAAAGGGGAGGG - Exonic
1077582292 11:3423941-3423963 TTGATCTTGCAGGGACAGGAAGG + Intergenic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1081420425 11:42869678-42869700 GTGATCATGAAAACACAGGAAGG - Intergenic
1084833229 11:71786083-71786105 TTGATCTTGCAGGGACAGGAAGG - Intergenic
1084952521 11:72674443-72674465 CTGATAATGCAGAAGGGGGAGGG + Exonic
1085700113 11:78738355-78738377 CTGATAATGTGGAAAGAGGATGG - Intronic
1087125485 11:94621832-94621854 CTGATGATGCAGAAAGGAGAAGG - Intergenic
1088841277 11:113629620-113629642 TTGAGCATGCAGAGACAGCAGGG + Intergenic
1089674185 11:120078970-120078992 CTGAGCATGATGAACCAGGAAGG - Intergenic
1089960186 11:122610277-122610299 CAAGACATGCAGAAACAGGAGGG + Intergenic
1090737754 11:129625806-129625828 CTGCTGAGGCAGAAGCAGGAGGG - Intergenic
1092409891 12:8244389-8244411 TTGATCTTGCAGGGACAGGAAGG + Intergenic
1096518142 12:52169649-52169671 CTGATCATGCAGAAACAGGAAGG + Exonic
1096887502 12:54732306-54732328 CTGAACATGCAGAAAAATAATGG - Intergenic
1098785660 12:74751031-74751053 CTGATCATGGAGAATCATTACGG - Intergenic
1099161026 12:79242038-79242060 CAGAGCATTCAGAAACAGTATGG + Intronic
1100568857 12:95826527-95826549 CTGTTCATTCAGAATCAGCAGGG + Intergenic
1102285679 12:111654475-111654497 CTGAAAATGCAGAAACTGGTCGG - Intronic
1104491365 12:129196253-129196275 CTTTTCATGCAGCAACAGGCAGG + Intronic
1105041631 12:132965784-132965806 CTGATCATCTAGGAACAGAATGG + Intergenic
1105068691 12:133220721-133220743 GGGATCCTGCAGAGACAGGAGGG - Intronic
1107314310 13:39114626-39114648 GAGATCATGGAGAAATAGGAAGG - Intergenic
1110811505 13:79816078-79816100 CTGATCATACAGAAATAAAAGGG - Intergenic
1112108913 13:96273202-96273224 CTCATCATGAAGCATCAGGAAGG - Intronic
1112304452 13:98261141-98261163 CTGCTCATGCAGACACTGGAAGG + Intronic
1112555351 13:100463066-100463088 CTGATGATGGAGAAAGAGGACGG + Intronic
1112979432 13:105363774-105363796 CTGTTCTTCCAGAAACAGGAAGG + Intergenic
1113750682 13:112774674-112774696 CTGTGCATGCAAACACAGGAAGG - Intronic
1118821751 14:69350480-69350502 AAGAGCATGAAGAAACAGGAGGG + Intronic
1121179519 14:91918261-91918283 CTGACTATGCAGAAACAGCTGGG - Intronic
1121319181 14:92981200-92981222 CTGGTCAGGAAGAAATAGGATGG - Intronic
1121445299 14:93974939-93974961 CTGTTCTTGCACAAACAGGCCGG - Intronic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1124720394 15:32106457-32106479 TTGATCATTCAGAAACGTGAGGG + Intronic
1125516820 15:40325194-40325216 CTTATATTTCAGAAACAGGAGGG - Intergenic
1127804806 15:62509665-62509687 CTGATCACACAGAACCAGGGAGG + Intronic
1127924492 15:63525421-63525443 CTGCTCATTCTGAAAGAGGATGG - Intronic
1130168126 15:81484120-81484142 CTGAGCATGCGGCAGCAGGAAGG + Intergenic
1132056454 15:98653778-98653800 CTGATCTTGCAACAATAGGAAGG - Intronic
1133350875 16:5099170-5099192 TTGATCTTGCAGGGACAGGAAGG + Intergenic
1137256989 16:46783888-46783910 CTGACCATACAGAAACACAAAGG + Intronic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1138269186 16:55682634-55682656 CTGATCTTGCAGAAACAGGCAGG + Intronic
1138436208 16:57001411-57001433 CTCAAGAGGCAGAAACAGGATGG + Intronic
1144428911 17:15172621-15172643 ATGATCATGTAGACACAGCAAGG + Intergenic
1145370344 17:22302129-22302151 CCAATCAAGCAGAAACAGGTTGG - Intergenic
1147988555 17:44320065-44320087 CTGATCATGATGGCACAGGAGGG + Exonic
1150162939 17:62914699-62914721 CTGATCATGTAGAACCCTGAAGG - Intergenic
1150182443 17:63138640-63138662 CTGATCATTAAGAAAGAGAAAGG - Intronic
1150962511 17:69930003-69930025 TAGATGATGCAGAAATAGGAGGG + Intergenic
1153499550 18:5734151-5734173 CTGATCCTTCAGAAAGATGATGG + Intergenic
1154931080 18:20997007-20997029 TTCATTAAGCAGAAACAGGAAGG + Intronic
1155319226 18:24602514-24602536 CTGATCCCGCAGAGACTGGATGG - Intergenic
1157837372 18:50918355-50918377 CTAATCAGGCAGAAACAGCCAGG - Intronic
1158070926 18:53469635-53469657 CTGATGATGCAGGAAAGGGAAGG - Intronic
1159605879 18:70474299-70474321 GTGATGATGCAGTAACAGAAAGG - Intergenic
1160157264 18:76443115-76443137 CTGACCATGGAGAGATAGGACGG - Exonic
1160964286 19:1739210-1739232 GTGAAAATGCAGAAACTGGATGG + Intergenic
1163661487 19:18580602-18580624 CAGATGATCCAGCAACAGGATGG + Intronic
1165929843 19:39350353-39350375 CTCTTCATTCAGAAGCAGGATGG - Intronic
1167015746 19:46839825-46839847 CTGATCCTGGAGAGTCAGGAGGG + Intronic
925756841 2:7141403-7141425 CTGAGCATGCAGCTTCAGGAGGG + Intergenic
929445852 2:42000647-42000669 CTGCTAAAGCAGAACCAGGAAGG + Intergenic
929973043 2:46600571-46600593 CTAATCATTGAGAAACAGAATGG - Intronic
933490056 2:82974540-82974562 CTGATCATGAAGAAGCATGAGGG - Intergenic
934977042 2:98810059-98810081 CTGGTCATGCAGACACAGCCTGG + Intronic
939925633 2:148170815-148170837 CTGATTCTACAGAAACAGAATGG + Intronic
941198962 2:162485804-162485826 CTTATCACCCCGAAACAGGATGG + Intronic
941587244 2:167375917-167375939 CTGAACAGGCAAAAACTGGAAGG - Intergenic
941681450 2:168403762-168403784 GAGATCAGGCAGAAACTGGAGGG + Intergenic
941735753 2:168974245-168974267 CTGATCATGGATTAACAGTAAGG + Intronic
941988061 2:171527688-171527710 TTAATGATGCAGAAAAAGGAGGG - Intronic
942506590 2:176647847-176647869 CTGACCATGAAGAAACAGCAGGG - Intergenic
942863506 2:180644749-180644771 GTCATCTTGCAGAAGCAGGATGG + Intergenic
943427731 2:187757928-187757950 TTGATCAAGCAGAAAAAGAAAGG - Intergenic
943470168 2:188285285-188285307 CTGTTGATGCAGAACCAGCATGG + Intergenic
945928706 2:215832539-215832561 CTGATCCTAGAGAAACTGGAAGG - Intergenic
947670588 2:231933298-231933320 CTGAGCTTGCAGACACAGGGTGG + Intergenic
947671648 2:231940761-231940783 CGGGTCATGCAGGACCAGGATGG - Intergenic
948294029 2:236847746-236847768 GTGATCTTGCAGACACAGGGAGG - Intergenic
948383733 2:237568567-237568589 GTGAGCCTGCAGGAACAGGAAGG + Intergenic
1169524857 20:6413296-6413318 CTGAGGATGCAGAAAAAGAAAGG + Intergenic
1169872897 20:10266164-10266186 CTGATGATTCAGAAAATGGAAGG + Intronic
1171174031 20:23037851-23037873 ATGATCATCCAGAATCAGGCCGG - Intergenic
1172538844 20:35695670-35695692 CTGATCAGAAAGAAAAAGGAAGG + Intronic
1172830273 20:37828012-37828034 CAAATCATGAAGAAACAGTATGG - Intronic
1173410126 20:42802733-42802755 CTGATCATGCAGGAGAAGGGAGG - Intronic
1174556043 20:51396466-51396488 CTGAGAAAGCAGCAACAGGAAGG + Intronic
1176363204 21:6016038-6016060 CTGAGCATGAAGGCACAGGATGG - Intergenic
1179760314 21:43522507-43522529 CTGAGCATGAAGGCACAGGATGG + Intergenic
1180012097 21:45058281-45058303 CTGAGCATCCACATACAGGAGGG + Intergenic
1181668383 22:24413810-24413832 CTGAGCACGCAGGATCAGGAGGG - Intronic
950404939 3:12798357-12798379 GTGATCTAGCAGAAACATGAGGG - Intronic
950501016 3:13363883-13363905 CTGATAATCCAGAGCCAGGAGGG + Intronic
950708362 3:14797802-14797824 CTGGTCATGCAGAGCCAGGCAGG - Intergenic
952427982 3:33194676-33194698 CTGATAAGGCAGAAACCAGAAGG + Intronic
952655942 3:35785600-35785622 CTGAGCCTGCAGTAATAGGATGG + Intronic
952765294 3:36947916-36947938 CTGATCATGCATAAAACTGAGGG - Intergenic
955624241 3:60899834-60899856 GTGATAATAAAGAAACAGGATGG + Intronic
956091956 3:65677547-65677569 CTCAGCATGTGGAAACAGGAAGG + Intronic
956188351 3:66583795-66583817 GTGATCATGAATAAACAGAATGG - Intergenic
958744699 3:98118757-98118779 CTCACCATGGAGAAACTGGAAGG - Intergenic
959466611 3:106695338-106695360 CAGATGATGCAGCTACAGGATGG - Intergenic
960799665 3:121525447-121525469 CTGATGAAGGAGAAACAGAAGGG + Intronic
961299706 3:125915159-125915181 TTGATCTTGCAGGGACAGGAAGG - Intergenic
961564843 3:127755998-127756020 CTGGTCATTGAGACACAGGATGG + Intronic
962903972 3:139785309-139785331 CAGATCGTGCAAACACAGGAGGG - Intergenic
963098041 3:141566651-141566673 ATAATAATGCAGGAACAGGATGG + Intronic
963329652 3:143899913-143899935 CTGACCATGCACAACCAGAAAGG + Intergenic
965811127 3:172592594-172592616 GTGGTCAGGCGGAAACAGGATGG + Intergenic
969756050 4:9151832-9151854 TTGATCTTGCAGGGACAGGAAGG - Intergenic
969816377 4:9690997-9691019 TTGATCTTGCAGGGACAGGAAGG - Intergenic
971161865 4:24141551-24141573 CTTATCAAGCAAAAGCAGGAAGG + Intergenic
974392401 4:61288942-61288964 CTAATCGTTCAGAAACAGGATGG + Intronic
976717699 4:88140297-88140319 CTGATAAAGCAGGAAAAGGATGG + Intronic
977059592 4:92240587-92240609 CTGTTCATTCAGACACAGCAGGG - Intergenic
980254820 4:130365415-130365437 GTAATCATGTAGAAAGAGGAAGG - Intergenic
982777851 4:159460401-159460423 CTGATCTTGCAGTTAAAGGAAGG - Intergenic
986276092 5:6276273-6276295 GTGAGCTTGCAGACACAGGAGGG + Intergenic
986810148 5:11348859-11348881 TTAATTAAGCAGAAACAGGAAGG + Intronic
987841937 5:23233392-23233414 TTAAGCATGGAGAAACAGGATGG - Intergenic
988436310 5:31179001-31179023 CATATCATCCAGGAACAGGAAGG - Intergenic
990108647 5:52295189-52295211 CAAATCGTGCAGAAACTGGAAGG + Intergenic
992190584 5:74287774-74287796 TTTATCCTGAAGAAACAGGATGG - Intergenic
992307448 5:75457172-75457194 CTCTTCATCCAGAAACAAGATGG + Intronic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
993316068 5:86407922-86407944 GTGTACATGCAGAGACAGGAAGG + Intergenic
993620534 5:90162685-90162707 CTGGGCATGCAGAACCAGGAGGG - Intergenic
993687947 5:90963794-90963816 TTGATCAGGCAGGCACAGGAAGG + Intronic
993817785 5:92574109-92574131 CTGCTCATGCAGAAAAAGAAAGG + Intergenic
994157157 5:96516481-96516503 TTTATCATGCAGAATTAGGAAGG + Intergenic
994209292 5:97070286-97070308 TTGATCCTGGAGAAAGAGGAAGG - Intergenic
994493010 5:100472276-100472298 GAAATCATTCAGAAACAGGAAGG - Intergenic
995225809 5:109699696-109699718 CTGAGCATGCAGCTTCAGGAGGG + Intronic
995808988 5:116084382-116084404 CTGCAGATGCAGATACAGGAGGG + Intergenic
995921995 5:117325771-117325793 ATGATAATGTAGAAATAGGAAGG - Intergenic
996700200 5:126443320-126443342 CTGATCTTTCAGAAACTGTATGG + Intronic
996972190 5:129384872-129384894 ATATTCATGCATAAACAGGAAGG - Intergenic
997378589 5:133418210-133418232 CTGATCAAGAAGAAAAAAGATGG + Intronic
999251348 5:150184042-150184064 CTGATCCTGGAGAAAAGGGATGG + Exonic
999557446 5:152759442-152759464 TTGATCACACAGAAACAGAATGG + Intergenic
1000516261 5:162239092-162239114 GTGGTCCTGCAGGAACAGGAAGG - Intergenic
1003160670 6:3631261-3631283 CATATCATGCAGAAACAGAATGG + Intergenic
1005136961 6:22580272-22580294 CTGATCCTGTAGGACCAGGATGG + Intergenic
1006074923 6:31526085-31526107 TTGATCATCTAGGAACAGGAAGG - Intergenic
1007197933 6:40079290-40079312 CTGAGCAGACAGAAACAGCACGG + Intergenic
1009613882 6:65980446-65980468 CTAATACTGGAGAAACAGGATGG - Intergenic
1010212417 6:73372569-73372591 CTGAGCCTGCCAAAACAGGAGGG + Intronic
1012978211 6:105802581-105802603 CTGATGATGCAGAAAAGAGAAGG - Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1014228043 6:118870780-118870802 CTGATAATACAGAAATATGAAGG + Intronic
1014684036 6:124472575-124472597 CTTTTCATGCAGACACAGAATGG + Intronic
1016356594 6:143225135-143225157 TTGAACAGGCAGAGACAGGAGGG - Intronic
1018219726 6:161565987-161566009 CTGATGATGCAGAAGGGGGAAGG - Intronic
1018265207 6:162016862-162016884 AGGATCATGCAGTAACAAGAGGG + Intronic
1018343205 6:162874113-162874135 CAGATCAGGCAAAAACATGAGGG + Intronic
1018463188 6:164018496-164018518 CTGATCATGAAGAACCGTGAAGG - Intergenic
1018832228 6:167451989-167452011 CTTTTCATGAAGAAACAGGATGG - Intergenic
1018872249 6:167792168-167792190 CTGATCAGGAAGGAACAAGAAGG - Intronic
1020775104 7:12443235-12443257 CTAATCATGCAGTATCAGAAGGG - Intergenic
1021251909 7:18339144-18339166 CTGATCATGGAGAAAAAAAAAGG - Intronic
1022475562 7:30707393-30707415 CTGAGCAGGCAGAAAAAGGTTGG - Intronic
1024505125 7:50156334-50156356 CAGATCAAGCAGAAACAGTCAGG - Intronic
1025295639 7:57773630-57773652 CCAATCAAGCAGAAACAGGTTGG - Intergenic
1026014533 7:66662612-66662634 CTGATCTTCAAGAGACAGGATGG + Intronic
1026449776 7:70518106-70518128 ATGAACATTCAGAAACAGAATGG + Intronic
1030661110 7:112220794-112220816 CTAATTAGGCAAAAACAGGAGGG + Intronic
1030903266 7:115150325-115150347 CTGAGGATACAGACACAGGATGG - Intergenic
1030909818 7:115233322-115233344 CTGTCCAGGTAGAAACAGGATGG + Intergenic
1032381349 7:131485710-131485732 CTGATCATGAAGAAACAATCAGG + Intronic
1034931701 7:155168337-155168359 CAGAACATGCAGCAGCAGGAGGG - Intergenic
1036379299 8:8227137-8227159 TTGATCTTGCAGGGACAGGAAGG - Intergenic
1036850261 8:12195476-12195498 TTGATCTTGCAGGGACAGGAAGG + Intergenic
1036871623 8:12437749-12437771 TTGATCTTGCAGGGACAGGAAGG + Intergenic
1037529725 8:19760787-19760809 CTGATAATGCAGTAATAGTAAGG + Intergenic
1038244933 8:25846709-25846731 CTGAGCACCCAGAAAAAGGAAGG - Intronic
1039191830 8:34984995-34985017 CTGATGATTCAGAGACAGCATGG + Intergenic
1039634065 8:39144019-39144041 CTGCTGAGGCAGACACAGGAGGG + Intronic
1040089425 8:43381760-43381782 CTGAGCATGCAGCTTCAGGAGGG - Intergenic
1040386554 8:46918290-46918312 CTGATCCTTCAGAGCCAGGATGG + Intergenic
1040547868 8:48414524-48414546 CTGATCTTGCAGAAATAAAAAGG + Intergenic
1044192718 8:89338403-89338425 CTGATACTGCAGAAACTTGAAGG - Intergenic
1045657352 8:104400538-104400560 CTGCTCTGGCAGCAACAGGAAGG + Intronic
1045899144 8:107254813-107254835 CTGATCATGGACAAGCAGGCTGG - Intronic
1045931574 8:107633278-107633300 CAGGTCATGCTGATACAGGAGGG - Intergenic
1047778891 8:128095882-128095904 CTGACCATGCCGAAAGAGCATGG - Intergenic
1048945295 8:139441451-139441473 CTCATCATACAAAAACAGCAGGG + Intergenic
1049225061 8:141446477-141446499 CAGAGCCTGCAGAGACAGGATGG + Intergenic
1052827219 9:33186016-33186038 CTGATCCTACACAAACAAGAAGG - Intergenic
1054161609 9:61675261-61675283 CCTATCAAGCAGAAACAGGTTGG + Intergenic
1055217446 9:73883621-73883643 CTGCTCATGAAGAAAGATGAGGG - Intergenic
1055335635 9:75230376-75230398 CTGAGCATGAAAAAAAAGGAAGG - Intergenic
1055706967 9:79016136-79016158 CTGATCACGCAGCAATAGGCTGG - Intergenic
1056835390 9:89951096-89951118 CTGAGGATGCAGGACCAGGAAGG + Intergenic
1057389092 9:94628012-94628034 CTGATCATGCAGGGGCAGGAAGG + Intronic
1058363760 9:104182989-104183011 CTGGAGATGCAGAAACAAGAAGG + Intergenic
1059297929 9:113288839-113288861 CTGAACTTACAGAACCAGGAAGG - Intronic
1059789013 9:117619670-117619692 CAGATCAAACAGAAACAGGCAGG + Intergenic
1059883838 9:118722257-118722279 TTGATGATTCAGAATCAGGAAGG + Intergenic
1062077824 9:134601473-134601495 CTGAGCTAGCAGATACAGGAAGG + Intergenic
1188105907 X:26146399-26146421 CTTACCATGCAGAAATAGAAAGG + Intergenic
1189273593 X:39768949-39768971 CTGACCAAGCAGATTCAGGAGGG + Intergenic
1190651280 X:52571177-52571199 CTGATCTTGCAGAAAGACCAAGG - Intergenic
1192321659 X:70095020-70095042 CTGCTTTTGCAGAAACAGCAAGG + Intergenic
1193561718 X:83025983-83026005 CTGATAATGCAGAAATACAAAGG + Intergenic
1194508368 X:94761392-94761414 CAGATAATTGAGAAACAGGATGG + Intergenic
1195651165 X:107286648-107286670 TTCCACATGCAGAAACAGGAAGG + Intergenic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1197425520 X:126292745-126292767 ATGATCTTGCAGAAATAAGAAGG + Intergenic
1198749691 X:139926445-139926467 CACATCATGCAGACACAGCAAGG + Intronic
1199494575 X:148438883-148438905 CTGAGCCTGGAGAAACAGGCAGG + Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1200989330 Y:9334865-9334887 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200991999 Y:9355195-9355217 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200994653 Y:9375475-9375497 CGGATCAAGGAGAAAGAGGATGG + Intronic
1200997316 Y:9395821-9395843 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200999831 Y:9464358-9464380 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201002489 Y:9484667-9484689 CGGATCAAGGAGAAAGAGGATGG + Intronic
1201005149 Y:9504954-9504976 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201007807 Y:9525281-9525303 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic