ID: 1096518265

View in Genome Browser
Species Human (GRCh38)
Location 12:52170264-52170286
Sequence GAGTGGGCATGGAGGGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2194
Summary {0: 2, 1: 0, 2: 14, 3: 203, 4: 1975}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096518251_1096518265 6 Left 1096518251 12:52170235-52170257 CCTTCTTCCTGGCCTGCTGGAGG 0: 1
1: 0
2: 5
3: 63
4: 505
Right 1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG 0: 2
1: 0
2: 14
3: 203
4: 1975
1096518256_1096518265 -1 Left 1096518256 12:52170242-52170264 CCTGGCCTGCTGGAGGCAGGGGG 0: 1
1: 0
2: 4
3: 94
4: 666
Right 1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG 0: 2
1: 0
2: 14
3: 203
4: 1975
1096518248_1096518265 17 Left 1096518248 12:52170224-52170246 CCTGGACTGTGCCTTCTTCCTGG 0: 1
1: 1
2: 3
3: 43
4: 473
Right 1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG 0: 2
1: 0
2: 14
3: 203
4: 1975
1096518258_1096518265 -6 Left 1096518258 12:52170247-52170269 CCTGCTGGAGGCAGGGGGAGTGG 0: 1
1: 0
2: 5
3: 97
4: 695
Right 1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG 0: 2
1: 0
2: 14
3: 203
4: 1975
1096518247_1096518265 26 Left 1096518247 12:52170215-52170237 CCAGACTTGCCTGGACTGTGCCT 0: 1
1: 0
2: 2
3: 20
4: 205
Right 1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG 0: 2
1: 0
2: 14
3: 203
4: 1975
1096518246_1096518265 27 Left 1096518246 12:52170214-52170236 CCCAGACTTGCCTGGACTGTGCC 0: 1
1: 0
2: 1
3: 21
4: 152
Right 1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG 0: 2
1: 0
2: 14
3: 203
4: 1975

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096518265 Original CRISPR GAGTGGGCATGGAGGGAGGA AGG Exonic
Too many off-targets to display for this crispr