ID: 1096518358

View in Genome Browser
Species Human (GRCh38)
Location 12:52170618-52170640
Sequence CCCTGGGAGTGGAAGCCAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 6, 3: 66, 4: 404}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096518358_1096518365 17 Left 1096518358 12:52170618-52170640 CCATCTGGCTTCCACTCCCAGGG 0: 1
1: 0
2: 6
3: 66
4: 404
Right 1096518365 12:52170658-52170680 GCAGCTTCCGGAGAAGCTGCTGG 0: 1
1: 0
2: 1
3: 32
4: 342
1096518358_1096518370 29 Left 1096518358 12:52170618-52170640 CCATCTGGCTTCCACTCCCAGGG 0: 1
1: 0
2: 6
3: 66
4: 404
Right 1096518370 12:52170670-52170692 GAAGCTGCTGGGAGCTGGCTGGG 0: 1
1: 1
2: 2
3: 46
4: 473
1096518358_1096518366 18 Left 1096518358 12:52170618-52170640 CCATCTGGCTTCCACTCCCAGGG 0: 1
1: 0
2: 6
3: 66
4: 404
Right 1096518366 12:52170659-52170681 CAGCTTCCGGAGAAGCTGCTGGG 0: 1
1: 0
2: 6
3: 53
4: 313
1096518358_1096518364 5 Left 1096518358 12:52170618-52170640 CCATCTGGCTTCCACTCCCAGGG 0: 1
1: 0
2: 6
3: 66
4: 404
Right 1096518364 12:52170646-52170668 ATTATGGCAAGAGCAGCTTCCGG 0: 1
1: 0
2: 2
3: 3
4: 166
1096518358_1096518371 30 Left 1096518358 12:52170618-52170640 CCATCTGGCTTCCACTCCCAGGG 0: 1
1: 0
2: 6
3: 66
4: 404
Right 1096518371 12:52170671-52170693 AAGCTGCTGGGAGCTGGCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 534
1096518358_1096518369 28 Left 1096518358 12:52170618-52170640 CCATCTGGCTTCCACTCCCAGGG 0: 1
1: 0
2: 6
3: 66
4: 404
Right 1096518369 12:52170669-52170691 AGAAGCTGCTGGGAGCTGGCTGG 0: 1
1: 0
2: 9
3: 62
4: 547
1096518358_1096518368 24 Left 1096518358 12:52170618-52170640 CCATCTGGCTTCCACTCCCAGGG 0: 1
1: 0
2: 6
3: 66
4: 404
Right 1096518368 12:52170665-52170687 CCGGAGAAGCTGCTGGGAGCTGG 0: 1
1: 0
2: 3
3: 46
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096518358 Original CRISPR CCCTGGGAGTGGAAGCCAGA TGG (reversed) Exonic
900282253 1:1878268-1878290 CCATGGGAGTGTCAGGCAGAGGG + Intronic
900493736 1:2966690-2966712 CTGTGAGAGTGGAAGCCACAGGG - Intergenic
900677056 1:3894212-3894234 CCCTAGAACTGGAACCCAGAAGG + Intronic
904683767 1:32246717-32246739 CCCTGGGAGGGGCAGGGAGATGG + Intergenic
904862146 1:33546431-33546453 CACAGGGAGGGGAAGCAAGAAGG + Intronic
904958159 1:34306262-34306284 CCCTGGGAGAGGCTGGCAGACGG - Intergenic
905342588 1:37289547-37289569 CCCTAGAAGTGGATGCCACATGG - Intergenic
906706524 1:47899157-47899179 CACCTGGAGTGGAAGTCAGATGG - Intronic
907178372 1:52547067-52547089 CCCAGGAGGTGGAGGCCAGAAGG + Intronic
908004016 1:59709903-59709925 CCATGGCAGTGGTAGCCAGCTGG + Intronic
908175093 1:61547576-61547598 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
910077628 1:83299105-83299127 CCCTGGTAGCGGAAGACAAAGGG + Intergenic
910240380 1:85079838-85079860 TACTGGGACTGGCAGCCAGATGG + Intronic
911678882 1:100691620-100691642 CCCTGGTAGTTGAAGACAAAGGG - Intergenic
911951424 1:104177820-104177842 CCCTGTGAATGGAAGCAAGGTGG + Intergenic
913493541 1:119405281-119405303 CCCTGGTAGTTGAAGACAAAGGG + Intergenic
915444616 1:155967616-155967638 CCCTGGGCCTGGAAGGGAGAAGG - Intronic
916209723 1:162350444-162350466 CCCTGGGACTCCAAGCCAGGTGG + Intronic
916758484 1:167795897-167795919 AACTGGGAGTGGAAGGCAGGAGG + Intergenic
917319008 1:173759298-173759320 CCCTGGTAGTGGAAGACAAAGGG + Intronic
917660405 1:177171840-177171862 GCCTGGCAGTGGCAGGCAGAGGG + Intronic
918133375 1:181647837-181647859 CAAGGGGAGTGGAAGCCAGTTGG + Intronic
919580817 1:199369957-199369979 CACAGGGAGAGGAACCCAGATGG + Intergenic
919581956 1:199387507-199387529 CACTCAGTGTGGAAGCCAGAAGG - Intergenic
919907397 1:202087258-202087280 CCCTGGCAGAGGGAGCCAGAGGG + Intergenic
919983429 1:202656887-202656909 GTCTGGCAGTGGAAGCCACAGGG - Intronic
920727015 1:208445763-208445785 CCCAGGTAGTGGAAGACAAAGGG - Intergenic
922026062 1:221750104-221750126 CCCTGGGTGTGAAATCCAGGTGG - Intergenic
922480693 1:225938594-225938616 CTTTGGGAGTGGAGGCCAGCGGG - Intronic
922618618 1:226977602-226977624 CTCTGGGAGTGTCAGCCAGCTGG + Intronic
922621601 1:226992886-226992908 ACCTGAGAGAGGAAGCCAGTCGG + Exonic
923035900 1:230285011-230285033 CACTGGTGGTGGAAGGCAGAGGG + Intergenic
923573705 1:235139989-235140011 CCCAGGGAGTGGAGGTCAGTGGG - Intronic
924193194 1:241577905-241577927 GCCTGGCAGGGGAGGCCAGAAGG - Intronic
1063979208 10:11440266-11440288 CCCTGGGAGTGCAACCCAGTAGG - Intergenic
1064154389 10:12891632-12891654 CCCAGGGAGTGGCAGCAGGAGGG + Intergenic
1065792990 10:29278727-29278749 CCCTTGGAGTGGAAGATAAATGG + Intergenic
1065819406 10:29511238-29511260 CCTTAGGTGTGGAAGCCAGAAGG - Intronic
1065953441 10:30673176-30673198 CCTTAGGTGTGGAAGCCAGAAGG + Intergenic
1066145484 10:32553897-32553919 CCCTGGTAGGGGAAGACAAAGGG - Intronic
1068019665 10:51565526-51565548 GCCTGGGTGTAGAAGCCTGAAGG + Intronic
1068096599 10:52499358-52499380 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
1069242694 10:66162785-66162807 CCCTAGTAGTGGAAGACAAAGGG - Intronic
1069345264 10:67462124-67462146 CTGGGGCAGTGGAAGCCAGAAGG - Intronic
1069740661 10:70685158-70685180 CCCTGGGGCTGGAAGGCACATGG - Intronic
1069780606 10:70953101-70953123 GGTTGGGAGTGGAAGGCAGATGG - Intergenic
1069833863 10:71296595-71296617 CATTTGGAGTGGCAGCCAGAAGG + Exonic
1070776893 10:79114998-79115020 CCCTGGGAGTGGAAGTCTATGGG - Intronic
1071039273 10:81286887-81286909 CCCTGTCACTGGAACCCAGACGG + Intergenic
1071440147 10:85682889-85682911 CCCTGGGGAGGGATGCCAGAAGG - Intronic
1071574427 10:86715342-86715364 CACTGGAAGAGGAAGCCAGCTGG + Intronic
1071644211 10:87344598-87344620 CCCTGGTAGTGGAAAGTAGAAGG + Intergenic
1072306116 10:94108755-94108777 CCATGGGACTGGAAGGCAGCAGG - Intronic
1074119260 10:110481334-110481356 CCCTCCCAGAGGAAGCCAGAGGG + Intergenic
1075450999 10:122551904-122551926 CCCTGGGATAAGAAGCAAGAGGG + Intergenic
1075739511 10:124685768-124685790 CCATGGGAAAGGAAGGCAGATGG - Intronic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1076429402 10:130391195-130391217 CCCTGGGAGTGACAGCCTGATGG + Intergenic
1076734740 10:132453549-132453571 CCCTGGGGCTCAAAGCCAGAAGG - Intergenic
1077093428 11:789582-789604 CCCTGGGAGAGGCAGACAGGCGG - Intronic
1077096103 11:799777-799799 CCCTGGGGCTGGCAGCCAGCGGG + Intronic
1077355475 11:2114857-2114879 ACATGGGAGAGGAAGCCTGAGGG - Intergenic
1077501199 11:2910502-2910524 CCCTGGGTGTGGAAGCCAGGGGG + Intronic
1078059324 11:8033147-8033169 CCCAGGGTGTGGAAGCGACAGGG - Intronic
1078459283 11:11501059-11501081 CTCTGTGAGTGGAAACGAGAGGG - Intronic
1079332642 11:19546390-19546412 CCCTGGGTGTGGGGCCCAGATGG + Intronic
1079601930 11:22319706-22319728 CCCTAGGAGTGAAGGCCTGAGGG + Intergenic
1079791695 11:24747623-24747645 GCCTGGTAGTGGAAGACAAAGGG - Intronic
1080324151 11:31050419-31050441 CCCTGATAGTGGAAGACAAAGGG + Intronic
1080672525 11:34394650-34394672 CCCTGGTAGTAGAAGACAAAGGG - Intergenic
1081617229 11:44598040-44598062 ATCAGGGACTGGAAGCCAGATGG - Intronic
1081654937 11:44850903-44850925 ACCCTGGAGTGGAAGGCAGAGGG - Intronic
1082110745 11:48271054-48271076 TCCTGGGAGTGCAACCCAGTAGG + Intergenic
1083293583 11:61703251-61703273 CCCTGGTGGAGGGAGCCAGATGG + Intronic
1083315853 11:61814843-61814865 CCCTGAGAGGTGAAGCCAGCTGG - Intronic
1083943549 11:65911618-65911640 GCCTGGGAGTGGGAGCCAAATGG + Intergenic
1085005780 11:73088114-73088136 CACTGGGAGGGCAAGGCAGAAGG - Intronic
1085789239 11:79482503-79482525 ACCTGGGGGTGGAGGACAGAAGG + Intergenic
1085819901 11:79781102-79781124 CCCTGGGAATGGAAACCACAAGG - Intergenic
1087354240 11:97074172-97074194 CCATGGAAGTGGGACCCAGAAGG + Intergenic
1088137693 11:106577878-106577900 CCATGGTAGTGGAAGACAAAGGG - Intergenic
1088206437 11:107397584-107397606 CTCTGGTAGTGGAAGACAAAGGG + Intronic
1089335718 11:117722195-117722217 ACTTGAGGGTGGAAGCCAGAAGG + Intronic
1090985795 11:131765025-131765047 CACTGGTAGTGGAACCCAGCCGG + Intronic
1091128812 11:133126800-133126822 TCCTGGGATTCGAAGCCATAGGG + Intronic
1091210509 11:133854384-133854406 CCCTGGTAGCGGAAGACAAAGGG - Intergenic
1091266582 11:134276444-134276466 CCCTCGGAGGGGAAGCGGGAGGG - Intronic
1092693585 12:11144164-11144186 CCCTGGTAGTGGAAGACAAAGGG - Intronic
1092703918 12:11263531-11263553 ACTTGGAAGTGGAAGGCAGAGGG + Intergenic
1093172591 12:15876112-15876134 CCCAGGTAGTGGAAGACAAAGGG + Intronic
1093210381 12:16300956-16300978 TGCTGGGATTTGAAGCCAGATGG + Intergenic
1093720593 12:22437515-22437537 CCCTGGTAGTGGAAGACAAAGGG + Intergenic
1093988793 12:25567691-25567713 CAGTGAGAGTGGAAGCAAGATGG - Intronic
1094232500 12:28122983-28123005 CTCTGGGGGTGGAAATCAGATGG - Intergenic
1095892794 12:47250200-47250222 CCCTGGTAGTGGAAGATAAACGG + Intergenic
1096518358 12:52170618-52170640 CCCTGGGAGTGGAAGCCAGATGG - Exonic
1096956872 12:55534915-55534937 CCCTGGTCGTGGAAGACAAAAGG + Intergenic
1097760572 12:63459594-63459616 CCCTGGTAGTGGAAGACAAAGGG + Intergenic
1098097837 12:66979034-66979056 TCCTGGGGGAGGAACCCAGATGG - Intergenic
1098231557 12:68376355-68376377 CGCTGGGAGGAGAGGCCAGAGGG - Intergenic
1098596066 12:72273638-72273660 CCCGGGTATTGGAAGCCAGCTGG - Intronic
1098960905 12:76739068-76739090 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
1099351217 12:81571293-81571315 TCTTGGGAGTGGAAGGAAGAAGG + Intronic
1099628112 12:85102639-85102661 CCCTGTGAGTGGAAGCCTCATGG - Intronic
1100290972 12:93214817-93214839 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
1101606200 12:106248548-106248570 CCCCGGGAGTGGGAGTCAGCGGG + Intronic
1103006051 12:117421185-117421207 CCATGAGAGAGGAAGCAAGATGG - Intronic
1103507896 12:121453843-121453865 CCCTAGGAGAGGACGACAGAGGG + Intronic
1103906042 12:124327673-124327695 GCCGGGGAGGGGGAGCCAGAGGG + Intronic
1103917229 12:124382148-124382170 CCCTGGGACTGAAAGGCACAGGG + Intronic
1104814935 12:131640172-131640194 CCCAGGCAGTGAAAGCCCGAGGG - Intergenic
1105303392 13:19153920-19153942 GCCTGGGAGAGGAACCCAGGAGG + Intergenic
1106938130 13:34747146-34747168 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
1107445193 13:40464303-40464325 CCCTGGGAATGTAACACAGACGG + Intergenic
1107955485 13:45507044-45507066 CCTCAGGAGTGGCAGCCAGAGGG + Intronic
1109827457 13:67741099-67741121 CCCTGGGAATGGACCCCAGTAGG - Intergenic
1117080823 14:52150522-52150544 CCCTGCCACTGGTAGCCAGATGG - Intergenic
1117648213 14:57874800-57874822 CCCTGGGCTTGGTAGACAGAAGG + Intronic
1118213589 14:63787988-63788010 CGCTGAGAGTGGAAGCCAAGTGG - Intergenic
1118461047 14:65987426-65987448 ACATGGGAATGGAAACCAGATGG + Intronic
1118594009 14:67422124-67422146 CCCTGGGTGTATAGGCCAGATGG - Intergenic
1118711502 14:68523251-68523273 CCCTGGGATGGGAAGCCTGAGGG + Intronic
1121274345 14:92657595-92657617 CCCTGGGAGGGGAAGAGACATGG + Intronic
1121798092 14:96752308-96752330 CCCTGGGACTGGAGGTCAGGAGG + Intergenic
1122691782 14:103535092-103535114 CCCTGGGTGTTGAAGCCAAAGGG + Exonic
1123020303 14:105394881-105394903 CCCGGGGCTGGGAAGCCAGAAGG + Exonic
1123104207 14:105830466-105830488 CCCTTGTAGTTGAAGACAGAGGG - Intergenic
1123111273 14:105868106-105868128 CCCTGGATGTCCAAGCCAGAGGG + Intergenic
1123683560 15:22781567-22781589 CCGTGAGACTGGAAGCAAGATGG - Intronic
1124335763 15:28855937-28855959 CCGTGAGACTGGAAGCAAGATGG - Intergenic
1128670721 15:69572926-69572948 CCCTGGGATAGGGAGCCAGAGGG - Intergenic
1128712982 15:69885849-69885871 CCCTGGGAGGGGGAGCAAGTGGG + Intergenic
1128945620 15:71818322-71818344 GACTTGGAGTGGAACCCAGATGG - Intergenic
1129253396 15:74320667-74320689 CCCTGGGGGTGGGAGCCTGGAGG - Intronic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129702170 15:77774330-77774352 CCCTGGGAGAGGTGGGCAGAGGG - Intronic
1129709749 15:77814728-77814750 GCCTGGGCTTGGATGCCAGATGG - Intronic
1130284569 15:82544348-82544370 CGCTTGGAGGGTAAGCCAGAGGG + Exonic
1130694334 15:86115198-86115220 TCATGGGACTGGAAGCAAGATGG - Intergenic
1131058010 15:89387571-89387593 CCCAGGCAATGGAAGCCGGAGGG - Intergenic
1131539589 15:93265147-93265169 CCCTATGAGTGGAAGCCACATGG + Intergenic
1132663192 16:1070610-1070632 CCCTGGGGGTGGCGGCCAGGAGG - Intergenic
1133056672 16:3148869-3148891 CCCTGGGATTGGAAGGCAGAGGG + Intronic
1133129179 16:3665694-3665716 CCCAGGGAGTGGCAGGAAGAGGG - Intronic
1133433378 16:5758038-5758060 ACCTGGGGTTGGAAGCCTGACGG + Intergenic
1133788297 16:8989762-8989784 ATCTGGGTGTGGCAGCCAGAGGG - Intergenic
1134412921 16:14018158-14018180 TCCTGAGTGTGGAATCCAGAGGG + Intergenic
1135663670 16:24317815-24317837 CCCTAGGAGTGGGGGTCAGAGGG - Intronic
1135833788 16:25804526-25804548 CCTTGAGAGTGGAAAGCAGATGG + Intronic
1136276285 16:29181070-29181092 CCTTGGAAGAGGAAGGCAGAAGG + Intergenic
1136281378 16:29213427-29213449 CAGTGGGAGAGGAAGCCAAAGGG - Intergenic
1137637401 16:49998859-49998881 CTTTGGGAGTCCAAGCCAGAAGG + Intergenic
1139260609 16:65589880-65589902 CCCTGGGGGTGGAAGGGAGGGGG + Intergenic
1139588016 16:67916739-67916761 CCCAGGGAGTGGGATCCACATGG + Intronic
1139672032 16:68498632-68498654 CCAGGGGAGTAGAAGCTAGAAGG + Intergenic
1139955386 16:70690687-70690709 CCCTGGGAGGGGCAGACAGCTGG - Intronic
1140415991 16:74774424-74774446 GCCCGGGAGTGGAAGGCTGACGG + Intronic
1140535433 16:75705210-75705232 CCCAGGGAGGGGAAGCCTCAAGG - Intronic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1141858491 16:86700971-86700993 CCCTTGGAATCGAATCCAGAGGG + Intergenic
1141923690 16:87153318-87153340 CCTTGAGGGTGGAAGGCAGAGGG + Intronic
1142080666 16:88147129-88147151 CCTTGGAAGAGGAAGGCAGAAGG + Intergenic
1142085748 16:88179355-88179377 CAGTGGGAGAGGAAGCCAAAGGG - Intergenic
1143432663 17:6898537-6898559 CACTGGTAGTGGAAGCCACGTGG + Intronic
1143499636 17:7331008-7331030 ACCTGAGGGTGGGAGCCAGAAGG + Intergenic
1144139656 17:12336464-12336486 CCCTGGTAGCGGAAGACAAAGGG - Intergenic
1144731288 17:17527946-17527968 TCCTGGCTGTGGAATCCAGATGG - Intronic
1146992593 17:37288652-37288674 CTCTGGGAGGGCAAGGCAGAAGG + Intronic
1147234956 17:39050530-39050552 CCCTGGGATAGGAAGCCTGCAGG - Intergenic
1147755232 17:42762967-42762989 TGCTGGGAATGGAAGCCAGGTGG + Exonic
1147965542 17:44192553-44192575 CCCTCCGAGAGGAGGCCAGAGGG - Exonic
1148076782 17:44941714-44941736 CCCGGGGAAGGGAAGGCAGAGGG + Intronic
1148079132 17:44957848-44957870 ACTGGGGAGGGGAAGCCAGATGG + Intergenic
1148107690 17:45128130-45128152 CCCTGGGTGTGGCAGCCAGCTGG - Intronic
1148907279 17:50919473-50919495 CCCTGGGTGTGGGATCCAGAAGG - Intergenic
1148958040 17:51370121-51370143 TCCTGGATGGGGAAGCCAGAGGG + Intergenic
1150354544 17:64471706-64471728 CCCTGGGAGGCCAAGGCAGAAGG + Intergenic
1150630952 17:66880185-66880207 GCCTGGAAGAGGAAGCAAGATGG + Intronic
1151380713 17:73723994-73724016 CCTTGGCAGGCGAAGCCAGAGGG - Intergenic
1151849178 17:76679879-76679901 CCCTGGGAATGCATGCCATAGGG + Intronic
1152044986 17:77929789-77929811 CCCTGGGAGAGGAAGAAGGATGG - Intergenic
1152246688 17:79188226-79188248 CCCTGGCAGAGGGAGGCAGAGGG - Intronic
1152320339 17:79605426-79605448 GGCTGTGAGTGGAAGCCAGCTGG - Intergenic
1152341815 17:79729846-79729868 GCCAGGCAGTGGAAGCCAGGCGG - Intergenic
1152764295 17:82127706-82127728 CCCTGGGAGGTGACACCAGAAGG + Exonic
1152897426 17:82920853-82920875 CCCTGGGCATGGAAGCGAGGAGG - Intronic
1153615450 18:6929581-6929603 CTCTCCGAGTGGAAGGCAGAGGG - Intergenic
1153965912 18:10182018-10182040 CCCTGGTAGCGGAAGACAAAGGG - Intergenic
1157754971 18:50209808-50209830 CCCTGGGATAGGAGGCCATAAGG - Intergenic
1158642090 18:59212647-59212669 CCTTGGGAGGCGAAGCCAGGAGG + Intergenic
1160219742 18:76965960-76965982 CCCTGGAAGCGGAAGACAAAGGG - Intronic
1160226031 18:77011585-77011607 CTCTGGGAGTGGCAGGCAGCCGG - Intronic
1160367454 18:78339606-78339628 GGCTGGGAGTGGGAGGCAGAAGG - Intergenic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1160766939 19:812904-812926 CCCTGGGAGTGGAAGGCGGCGGG - Exonic
1160845760 19:1165334-1165356 CCCCGAAAGTGGAAGCCACAGGG + Intronic
1161057863 19:2199716-2199738 CCCTGGGAGCTGCAGGCAGAAGG - Intronic
1161390265 19:4016998-4017020 GCCTGGCTGTGGAAGGCAGACGG - Intronic
1162305652 19:9871769-9871791 CCCTGGGAAAGGAAACCACAGGG + Intronic
1165062053 19:33209577-33209599 CCCTGGGAGCTGAGGCCTGAAGG + Intronic
1165708205 19:37991311-37991333 GCATGGAATTGGAAGCCAGATGG - Intronic
1166108965 19:40611352-40611374 CCTCGGGAGCGGAAGCCAGCAGG - Exonic
1166255267 19:41599812-41599834 CCCTGGGAGTGGATGGGAGGAGG + Intronic
1166763991 19:45241783-45241805 CCCAGGGACTGGGAGCCTGAGGG - Intronic
1167135592 19:47613401-47613423 GCCTGGGCTTGGAAGGCAGAGGG + Intronic
1167492898 19:49802165-49802187 CCCTGGGGGTGGCCGCGAGAAGG - Intronic
1167687904 19:50968111-50968133 TCCTGAGAGGGGAAGCCACATGG + Exonic
1168306142 19:55437390-55437412 TCCTGGGAGGGGAGACCAGAAGG + Intronic
1168485505 19:56758954-56758976 CAATGGGAGTGGAAGGCTGAGGG + Intergenic
925259792 2:2519564-2519586 CCCTGGGACTGGGTCCCAGACGG + Intergenic
926171026 2:10552685-10552707 CCCTGGGAGCTGATGCCAGGTGG + Intergenic
927198414 2:20563741-20563763 CCCTGGCAGTAGAATCCAGAGGG + Intronic
927676487 2:25110225-25110247 CCCTGGGAGGGTAAGGCAGGTGG - Intronic
928113446 2:28528232-28528254 TCCTGGGAGCAGAATCCAGAAGG - Intronic
928191701 2:29176470-29176492 CCCTGTGAGTGAAAGCAAGCTGG + Intronic
928733759 2:34261804-34261826 CCCTGGTAGGGGAAGACAAAGGG + Intergenic
929497363 2:42457705-42457727 CACTGGGAGGGCAAGGCAGAAGG + Intronic
931525197 2:63145331-63145353 CCCTGGTAGTAGAAGACAAATGG - Intronic
931547896 2:63408964-63408986 CCCTGGTAGTGGAAGACAAAGGG + Intronic
931762963 2:65432694-65432716 CCCCGGGAGTGGAAGCCAGGAGG - Intergenic
931962691 2:67499781-67499803 ACCTGGGGGTGGAAGCGAGTAGG - Intergenic
932002661 2:67898912-67898934 CCCTGGGGGTGGCATGCAGAAGG - Intergenic
932430654 2:71672013-71672035 CACTGGGAGGGAAGGCCAGAGGG + Intronic
932581466 2:72995060-72995082 CACTGAGAGGGGAAGCTAGAAGG - Intronic
933531540 2:83517840-83517862 CCCTGGTAGCGGAAGACAAAGGG + Intergenic
933704097 2:85277072-85277094 CGGTGAGGGTGGAAGCCAGAAGG + Intronic
933743275 2:85551753-85551775 CCCTGGCCAAGGAAGCCAGAAGG + Intronic
933973491 2:87489350-87489372 CTCAGGGAGTGTAAGCCAGTAGG + Intergenic
935284194 2:101549353-101549375 CACAGGGAGGGGAAGCCAGGCGG - Intergenic
935644112 2:105318885-105318907 CCCTGGAAGTGGAAGGGAGAGGG - Intronic
935976877 2:108586909-108586931 AGGTGGGAGTGGAAGGCAGATGG - Intronic
936023351 2:109012459-109012481 CCCTGGGATTGCAAAGCAGAAGG + Intergenic
936320234 2:111460863-111460885 CTCAGGGAGTGTAAGCCAGTAGG - Intergenic
937069230 2:119050221-119050243 CCCTGGTACTGGAAGACAAAGGG - Intergenic
938038057 2:128053099-128053121 CCCTGGTAGCGGAAGACAAAGGG - Intergenic
938761691 2:134431768-134431790 CCAAGGCAGTGGGAGCCAGACGG + Intronic
939487998 2:142841354-142841376 CAGTTGGAGAGGAAGCCAGAAGG - Intergenic
939563927 2:143764636-143764658 CTATGGGAGTGGAAGCTGGAAGG - Intronic
940205596 2:151198167-151198189 CCCTGGCAGTGTAAGGCAGACGG - Intergenic
943229881 2:185235296-185235318 GCATGGGAATGGTAGCCAGAGGG - Intergenic
944098161 2:195993225-195993247 AGCTGGGAGTGGAAGCAAGATGG + Intronic
944519712 2:200552852-200552874 TCCTGGGAGTGCAGCCCAGAAGG + Intronic
944858526 2:203791902-203791924 ATCTTGAAGTGGAAGCCAGAAGG - Intergenic
945042193 2:205751791-205751813 CCCTGGGAAGGGAAGTGAGAAGG + Intronic
946179155 2:217939691-217939713 CCCTGGGTGTGGGAGACAGGAGG - Intronic
946302062 2:218830159-218830181 GCCTGGGAGTGTGAGCTAGAAGG - Exonic
947238649 2:227970618-227970640 CCCAGGGAGTTGGAGCAAGAGGG + Intergenic
947714060 2:232331093-232331115 CCCTGGGACAGGAAACCACATGG - Intronic
947733268 2:232442473-232442495 CCCTGGGACAGGAAGCCACATGG - Intergenic
948368382 2:237473117-237473139 CCCTCGGTGTGGAAGGCAAAGGG + Intergenic
948374973 2:237515429-237515451 CTCTGGGAGTGAAAACCACAAGG + Intronic
948531221 2:238606818-238606840 CCCTGGTAGATGAAGACAGAGGG + Intergenic
948988389 2:241539894-241539916 CCCTGGGAGTGGGTTCCAGAAGG + Intergenic
949054868 2:241922168-241922190 CCCTGGGACAGGAGGCCAGGAGG + Intergenic
949054912 2:241922327-241922349 CCCTGGGACAGGAGGCCAGGAGG + Intergenic
949054925 2:241922367-241922389 CCCTGGGACAGGAGGCCAGGAGG + Intergenic
949054944 2:241922430-241922452 CCCTGGGACAGGAGGCCAGGAGG + Intergenic
1168876718 20:1176944-1176966 CCCAGGGAGAGGAAGGCAAATGG + Intronic
1169121672 20:3100337-3100359 GCCTGGGAGTGGCATCCACAGGG + Intergenic
1169532189 20:6497158-6497180 TGATGGGAGTGGAAGTCAGAGGG - Intergenic
1170245743 20:14220104-14220126 CCCTGGTAGTGGAAGACAAAGGG - Intronic
1170861730 20:20110834-20110856 CCCTGTGAGCTGAAGCTAGATGG - Intronic
1171165617 20:22967611-22967633 CCCTGGTAGTGGAAGACAAAGGG + Intergenic
1171358108 20:24566188-24566210 CCCTGGTGGTGGCAGCCAGCAGG - Intronic
1171395172 20:24828527-24828549 ACCTGGCTGTGGAGGCCAGAGGG - Intergenic
1172122146 20:32604728-32604750 CCCTGGGACTGAAAGTCAGGAGG - Intronic
1172149211 20:32778857-32778879 CCCTGGGAGTTGAAGCCTACAGG + Intronic
1172785171 20:37464001-37464023 CCCAGGGAGAGGAGGCCACATGG - Intergenic
1173095435 20:40023383-40023405 CCCTGGGAGTGGAAAAGTGATGG + Intergenic
1173672777 20:44809986-44810008 CCCTGGGGGAGAAGGCCAGAAGG + Intronic
1173725330 20:45293396-45293418 CTGGGGGAGGGGAAGCCAGACGG - Intergenic
1173859273 20:46271569-46271591 TGTTGGGAGTAGAAGCCAGATGG - Intronic
1174386385 20:50190574-50190596 CCCCGGGATTGGGAGCGAGAGGG - Intergenic
1175751196 20:61499198-61499220 CCCTGGTTGCGGAAGCCAGTAGG + Intronic
1176125607 20:63473241-63473263 CCCTGGGAGTGGACGCCTCCGGG + Intergenic
1176194904 20:63832302-63832324 CCCGGGGAGAGGAAGCGAGGTGG - Intergenic
1177393766 21:20507959-20507981 CACTGGGAGTCCAAGCCAGTGGG + Intergenic
1177588529 21:23130902-23130924 CCCTGGGACTGGAATCCAAAAGG - Intergenic
1178504301 21:33150663-33150685 CCCCGGGAGTCGAAGCCCCAGGG + Intergenic
1178553957 21:33569720-33569742 CCATGGGACTGGAAGCCTGAGGG + Intronic
1180151699 21:45951493-45951515 CCCTGGGAGCCGCAGACAGAGGG - Intergenic
1180796546 22:18608606-18608628 CCCAGGGAGTGGTGGACAGAGGG - Exonic
1181967813 22:26668850-26668872 CTCTGGGAGGGGCAGCCAGAGGG + Intergenic
1182518286 22:30871271-30871293 CCCTGGCTCTGGAAGCCACACGG + Intronic
1183356308 22:37361610-37361632 GCCTGGGGGTAGAAGTCAGATGG - Intergenic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1185023441 22:48394054-48394076 CCCAGAAAGGGGAAGCCAGATGG - Intergenic
1185127960 22:49022271-49022293 CGCAGAGAGTGGAAGCCAGGAGG + Intergenic
1185148766 22:49152748-49152770 CTCTGGGAGCTGCAGCCAGATGG - Intergenic
1185266704 22:49907852-49907874 CCCTGGGCTTGGTAGACAGAAGG - Exonic
949172345 3:1015735-1015757 GGCTGAGAGTGGAAGCCTGATGG + Intergenic
949470402 3:4390116-4390138 CCCTGGCAGGGGAAGAGAGAAGG + Intronic
949966770 3:9363259-9363281 GCCTGGGAGAGGGAGCAAGATGG - Exonic
950226679 3:11241381-11241403 CACTGAGAGTTGAAGCCAGCTGG + Intronic
950547352 3:13646367-13646389 CCCTGGCAGGGGAGGCCAGCAGG - Intergenic
950838318 3:15941889-15941911 CCCTGAGAGGTGAAGCCAGCTGG - Intergenic
951269638 3:20608420-20608442 CCCTGGTAATGGAAGACAAAGGG + Intergenic
951563735 3:23992218-23992240 CCAATGGAGGGGAAGCCAGAAGG + Intergenic
951577461 3:24128321-24128343 CCCAGGGACTTGAAGGCAGAGGG + Intronic
952519814 3:34145420-34145442 CCCTGGGAATCCAAGCCAGCAGG - Intergenic
952889706 3:38031711-38031733 CCCTGGGAGTTGAGGGCAGAGGG - Intergenic
953361593 3:42301872-42301894 TGATGGGAGTGGAACCCAGATGG + Intergenic
953749410 3:45597727-45597749 CCCTGGGAGAGGAAGACAGCTGG + Intronic
954201921 3:49028469-49028491 CCATGGGAGAGGAAACCAGTGGG + Exonic
954445010 3:50541837-50541859 CCCTGTGGCTGGAACCCAGAGGG + Intergenic
954608627 3:51932656-51932678 CCCTGAGAGACGAAGCCACAGGG - Intergenic
955778991 3:62463544-62463566 GCCTGGCACTGGAAGGCAGATGG - Intronic
957427930 3:80064029-80064051 CCCTGGCAGTGGAAGACAAAGGG + Intergenic
958505632 3:94973706-94973728 CCCTGGTAGTGGAAGACAAAGGG + Intergenic
958696852 3:97538783-97538805 TCATGGGAATGGAGGCCAGATGG + Intronic
959476473 3:106818301-106818323 CCCTGGGAGCTGCAGTCAGAAGG - Intergenic
960254585 3:115498569-115498591 CCCTGAGAGTGGGAGGCTGACGG - Intergenic
961708629 3:128809408-128809430 CCCAGGGAGGGGAACTCAGAGGG - Intronic
963043434 3:141085420-141085442 CTATGGGAATGGAAGCCACAAGG - Intronic
965052692 3:163671250-163671272 CCCTGGTAGTGGAAGACAAATGG - Intergenic
965321875 3:167261405-167261427 CCCTAGTAGTGGAAGACAAATGG - Intronic
965515374 3:169616037-169616059 AACTGGGAGTGGGAGGCAGAGGG + Intronic
965895417 3:173570085-173570107 TCTTGGGAGTGGGGGCCAGAAGG + Intronic
966932502 3:184685067-184685089 GTCTGGCAGTGGAAGACAGAAGG + Intergenic
968064712 3:195752257-195752279 CTCTGGCAGTTGAATCCAGATGG + Intronic
968970861 4:3792984-3793006 CCCTGGGAAGGCAAGCCTGAAGG + Intergenic
970150129 4:13080942-13080964 GCCAGAGAGAGGAAGCCAGAAGG - Intergenic
970324010 4:14904251-14904273 CACTGGAAGTGTAAACCAGAGGG - Intergenic
972252326 4:37316313-37316335 CAGAAGGAGTGGAAGCCAGAAGG - Intronic
972775563 4:42236728-42236750 CCCTGGGAGGGGAAGGGAGTGGG + Intergenic
973041102 4:45471639-45471661 GCATGGGAGGGGAAGCCAGGGGG + Intergenic
973986838 4:56362747-56362769 CCCTGGGGGTGGAGCCAAGATGG + Intronic
975680230 4:76868445-76868467 CCCTGGTAGGGGAAGACAAAGGG + Intergenic
976686325 4:87819372-87819394 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
976856500 4:89610339-89610361 CCCTGGTAGCGGAAGACAAAAGG + Intergenic
977733244 4:100380054-100380076 CCCTGGTAGTGAAAGACAAAGGG + Intergenic
978098787 4:104811867-104811889 CCCTTGGGTGGGAAGCCAGAGGG - Intergenic
981084940 4:140673901-140673923 CCCGGGAGGGGGAAGCCAGAAGG + Intronic
981346661 4:143684072-143684094 CCCTGGTAGTGGAAGACAAAGGG + Intronic
981461129 4:145014504-145014526 CCCTGGTAGTTGAAGACAAAGGG + Intronic
982274114 4:153622247-153622269 CCCTGGGAGTGGTAGGCAGAGGG + Intronic
982680125 4:158418965-158418987 CCCTGGTAGCGGAAGACACAGGG - Intronic
982960301 4:161827527-161827549 CCCTGGTAGTCGAAGACAAAGGG - Intronic
984527533 4:180875357-180875379 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
985058474 4:186056581-186056603 AGCTGGGGGTGGAAGGCAGAAGG - Intergenic
985899058 5:2773206-2773228 CCCAGGGAGAGGAAGCCAGGGGG - Intergenic
987005997 5:13709878-13709900 CCCTGGTAGTGGAAGACAAACGG + Intronic
988440385 5:31226644-31226666 CCCTGGGAGAGGAGGCAAAAAGG - Intronic
988902248 5:35745737-35745759 CCCTGGTAGTGGAAGACAAAGGG + Intronic
989153924 5:38326199-38326221 TCATAGCAGTGGAAGCCAGAGGG - Intronic
990233355 5:53739403-53739425 CCCTGGTAGTGGAAGACAAAGGG + Intergenic
990374094 5:55152010-55152032 CCCTGTAAGAGGAAGGCAGAGGG + Intronic
990776197 5:59308820-59308842 CCCTGGGAGTGGAAGACAAAGGG - Intronic
993596287 5:89860192-89860214 CCCTAGGAGAGGAAGAGAGATGG + Intergenic
994568350 5:101482840-101482862 CCCAGGTAGTGGAAGACAAAGGG - Intergenic
994886131 5:105564115-105564137 CCCTGGATGTGGTAGCCAGAAGG - Intergenic
995472987 5:112523198-112523220 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
996141428 5:119913814-119913836 CCTTGGGAGTGGAAGGCAGGAGG - Intergenic
996504768 5:124257092-124257114 TCCTGGTAGTGGAAGACAAAGGG - Intergenic
997612281 5:135223591-135223613 AGCTGGGCGTGGAATCCAGAAGG + Intronic
997852595 5:137346164-137346186 TGCTGGGAGAGGAAGCCAAAGGG - Intronic
998106221 5:139471077-139471099 CCTTGGGACTGGCAGCCAGCTGG - Intergenic
999202259 5:149824786-149824808 CCCTGGGGATGGAGGCCCGAGGG - Intronic
999484832 5:151985240-151985262 CCCTGGTAGTTGAAGACAAAGGG - Intergenic
1000334326 5:160230800-160230822 GCCTGGGAGAGGAAACCAAAGGG + Intronic
1000999134 5:167988680-167988702 CAGTGGGAGAGGTAGCCAGAGGG + Intronic
1001381042 5:171306936-171306958 CCCGGGCACTGGAAGCCAGAAGG + Exonic
1002295226 5:178227018-178227040 CCCTGGGAGAGCGAGCCAGAGGG + Intronic
1003426608 6:6002205-6002227 GCCTGGGGGTTGGAGCCAGAAGG + Intronic
1003450901 6:6230508-6230530 CCCTGCTAGTGGAAGACAAAGGG + Intronic
1003523237 6:6876505-6876527 CTCTGGGAGTCCAAGGCAGAAGG + Intergenic
1004141320 6:13020507-13020529 CCCTGGGGGTGAAGGCCAGCAGG + Intronic
1004934157 6:20491423-20491445 TCCTGGGAATGGAAGCACGATGG - Exonic
1005060412 6:21771799-21771821 CCCCAGGACTGGAAGCAAGACGG - Intergenic
1005191408 6:23228398-23228420 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1006425900 6:33962877-33962899 CCCTGGGTGTGGCAACCTGAGGG - Intergenic
1006809441 6:36810519-36810541 CCCTGGGAATAGGAGCCAGGTGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1009453199 6:63825318-63825340 CCCTGGTAGTGGAAGACAAAGGG + Intronic
1010085305 6:71910432-71910454 CCCAGGCAGTGGTAGCCAGTTGG + Intronic
1010134578 6:72535740-72535762 ACCTGGGATTGTAAGCAAGAAGG + Intergenic
1010577521 6:77550804-77550826 ATCTGGGAGTGGGAGCTAGATGG - Intergenic
1010808015 6:80261552-80261574 CCCTGAGAGTGGTAGGCAGTAGG + Intronic
1011789706 6:90885355-90885377 CCCTGGTAGTGGAAGATAAAGGG - Intergenic
1011794409 6:90936924-90936946 CCCAGGGATTGGGAGCTAGACGG + Intergenic
1013007367 6:106086311-106086333 AGCAGGGAGGGGAAGCCAGACGG + Exonic
1013721016 6:113028290-113028312 CCTTGGTAGTGGAAGACAAAGGG - Intergenic
1013996500 6:116314998-116315020 CTCTGGGGCTGGAAGACAGATGG - Intronic
1014127677 6:117795243-117795265 CTCTGAGAGGGGAAGCCATAGGG + Intergenic
1019394238 7:808429-808451 CTCTGGGAGGGGAGCCCAGAAGG - Intergenic
1019517148 7:1445073-1445095 CCGTGGGAGTGGGGGCCAGGCGG + Exonic
1019750416 7:2725646-2725668 CTCTGGGAGTGGAGCCCACAGGG - Intronic
1019801963 7:3094506-3094528 CCCCGGGACTGGAAACCAGAAGG + Intergenic
1020915266 7:14184696-14184718 CCCTGGTAGTGGAAGACAAAGGG + Intronic
1021093676 7:16511384-16511406 CCCTGTGAGTGGAAGTGAGTAGG + Intronic
1022418636 7:30199467-30199489 CCGTAGGAGTGTAGGCCAGAAGG - Intergenic
1022777683 7:33544768-33544790 CCCTGGTAGTGGAAAACAAAGGG - Intronic
1023748951 7:43351440-43351462 CCCTGGTAGTGGAAGATAAAGGG - Intronic
1023983166 7:45081262-45081284 GCCTGGGAGTAGAGGGCAGAGGG + Exonic
1024134153 7:46389597-46389619 CCTTTGGACTTGAAGCCAGAGGG + Intergenic
1024433808 7:49324470-49324492 TCCTGGGAATGGAGGCCAGTAGG + Intergenic
1026534571 7:71229272-71229294 ACTTGGGAGTTGCAGCCAGAAGG + Intronic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1027139771 7:75648783-75648805 CCCTGGGAATGGGAGGCAGTGGG + Intronic
1028155309 7:87422702-87422724 CCCTCTGGGTGGAAGCCTGATGG - Intronic
1028182939 7:87747558-87747580 CCCTGGCAGCGGAAGACAAAGGG - Intronic
1028237264 7:88377708-88377730 TCCTGAGAGAGGAAGCCAAAGGG - Intergenic
1029110845 7:98212370-98212392 CCCGGGGAGGGGACGCCCGACGG + Exonic
1029546338 7:101212373-101212395 TCCTGGGAGGGGAAGACATAGGG + Exonic
1030630259 7:111887942-111887964 CCCTGAGACAGGAAGCCGGAAGG + Intronic
1031535874 7:122932351-122932373 CCCTGGGAATAGCAGCCAGCAGG - Intergenic
1031883701 7:127223706-127223728 CCGTGGGAGTGGAGGTCACATGG + Intronic
1032476319 7:132213838-132213860 CACTGGGAGTGAGAGCCAGGAGG + Intronic
1032568258 7:132970865-132970887 CCCTGGGAGACCAAGGCAGAAGG + Intronic
1033433823 7:141314228-141314250 TCCTGAGAGTTGAAGCCATATGG - Intronic
1034406941 7:150910775-150910797 CCCTTGGAGCAGAAACCAGAAGG + Intergenic
1034688527 7:152995320-152995342 CCCTGGGAGGTCAAGGCAGAAGG - Intergenic
1035251165 7:157598187-157598209 CGCTGGGTGGGGAAGACAGAGGG - Intronic
1035839561 8:2795707-2795729 TCCTGGGAGGGGAGGGCAGAGGG + Intergenic
1037615117 8:20512219-20512241 CCCTGGGAGGAGATCCCAGATGG - Intergenic
1037802778 8:22044275-22044297 CCCTGGGAGGGGGGGCCAGCAGG + Intronic
1038490178 8:27965156-27965178 CCCTGAGTGTGGAAACCTGAAGG + Intronic
1039123598 8:34175752-34175774 TCCTGGTAGTGGAAGACAAATGG + Intergenic
1040869247 8:52083323-52083345 CCCTGGGACAGGAACCCAGTTGG + Intergenic
1040993834 8:53380804-53380826 CCCAGGGTGTGGTAGACAGAGGG - Intergenic
1041227787 8:55717259-55717281 CCCTGGTAGCGGAAGACAAACGG + Intronic
1041476006 8:58266701-58266723 CCCGGGGAGAGGAAGAGAGATGG + Intergenic
1045714586 8:105026469-105026491 GCCTGGGCGTGGAAGCAGGAGGG - Intronic
1047034753 8:120925119-120925141 CCCTGGGCTTTGAAGTCAGAAGG + Intergenic
1047389957 8:124442377-124442399 TCCTGGGAATGGAATCCAGCAGG + Intergenic
1048426779 8:134330455-134330477 CCCTTGCAGTGGTAGGCAGAGGG - Intergenic
1048935253 8:139349870-139349892 CCCTGGGGCCAGAAGCCAGAGGG - Intergenic
1049082939 8:140457255-140457277 GCCCGGGAGGGGAAGCCAGGCGG + Intronic
1049337108 8:142092405-142092427 TCCTGGGCCTGGAAGCCACAGGG + Intergenic
1050147409 9:2583737-2583759 CCCTGGTAGTGGACGACAAAGGG + Intergenic
1050492118 9:6198940-6198962 TCCTGGGAGGGGAAGACTGAAGG + Intergenic
1050502709 9:6315371-6315393 CCCTGGTAGCGGAAGACAAACGG + Intergenic
1051029036 9:12651887-12651909 CTCATGGAGTGGAAGGCAGAGGG - Intergenic
1051371367 9:16362129-16362151 CCCTGGGAGAGGCAGCCAGTGGG - Intergenic
1051601695 9:18881439-18881461 CCCCAGGAGAGGAAGCAAGATGG + Intronic
1052731432 9:32291135-32291157 CCCTGGTAATGGAAGACAAAGGG - Intergenic
1053172487 9:35899384-35899406 CCCTAGGAGAGGAAGAGAGATGG + Intergenic
1053380817 9:37648872-37648894 CTCTGGGTTTGGAAGACAGAAGG + Intronic
1053517781 9:38745939-38745961 CCACGGAAGTGGAAGCCAGGTGG - Intergenic
1056938865 9:90938034-90938056 CCCTGAGAGTGGAAGGAACATGG - Intergenic
1057081816 9:92179125-92179147 TCCTGGGTGTGGAAGGCAGAGGG + Intergenic
1058623187 9:106905497-106905519 CCCTAGTAGTGGAAGACAAAGGG - Intronic
1058860969 9:109117454-109117476 ACCTGGGAGTGGGAGAAAGAAGG - Intronic
1059329042 9:113523658-113523680 TCGTGGGAGGGGAAGCCAGCTGG + Intronic
1059510368 9:114839592-114839614 CCCTGGGAGAGGCTGGCAGATGG - Intergenic
1060939684 9:127536221-127536243 CCCCAGGTGTGGAGGCCAGAGGG + Intronic
1060964298 9:127703979-127704001 CCCTGGGAGGGGAAGGCTGCTGG - Intronic
1061226076 9:129281695-129281717 CGCTGGGAGTGGAGGGCTGAGGG + Intergenic
1061946063 9:133908653-133908675 CTCAGGGAGTGGAAGGCAGCAGG + Intronic
1062039941 9:134399900-134399922 CCCTGGGAGAGGAAGCAAGAGGG + Intronic
1062492057 9:136809914-136809936 CCCGTGGAGTGGAAGCCTGGGGG + Intronic
1062512435 9:136914205-136914227 CCATGGAACTGGAAGCCAGCTGG - Intronic
1188247483 X:27853585-27853607 CCCTTGAGGTGGAAGTCAGAGGG - Intergenic
1189289648 X:39876095-39876117 CCCTGGGAGTGGGAGGCTGGGGG - Intergenic
1189879072 X:45470654-45470676 CCCTGGTAGTGGAAGACAAAGGG + Intergenic
1189879159 X:45471287-45471309 CCCTGGAAGTGGAAGACAAAGGG - Intergenic
1190144329 X:47876925-47876947 ACCTGGGAGAGGAAGGGAGATGG + Intronic
1190448953 X:50558171-50558193 CCTTGGTAGTGGAAGACAAAGGG + Intergenic
1190947959 X:55114239-55114261 ACCTGGATGTGGAATCCAGATGG - Intronic
1191039932 X:56068280-56068302 CCCTGCCACTGGAAGCCAGGTGG + Intergenic
1191970936 X:66815514-66815536 CCCTGGTAGTCGAAGACAAAGGG - Intergenic
1192917896 X:75673549-75673571 CCCTGGGAGTGGCTGGCAGCAGG - Intergenic
1193317189 X:80077535-80077557 CCCAGGGAGGAGAAGCCAGATGG + Intergenic
1193578537 X:83232909-83232931 CCCTGGTAGTGGAAGACAAAGGG + Intergenic
1194206693 X:91019115-91019137 CTCAGGCAGTGGAAGTCAGAGGG + Intergenic
1194543444 X:95203398-95203420 TCCTGGTAGTGGAAGACAAAGGG - Intergenic
1196464845 X:115960975-115960997 CCCTGGTAGTGTAAGACAAAGGG + Intergenic
1196607737 X:117674861-117674883 CCCTGGGAGAGGCTGGCAGATGG - Intergenic
1196613775 X:117743675-117743697 GCCTGGGTGTGGAGTCCAGAGGG - Intergenic
1196737512 X:118992586-118992608 CCCTGGTAGTGGAAGACAAAGGG + Intronic
1199248245 X:145631405-145631427 ACCTCGGAGCGGATGCCAGAGGG + Intergenic
1199502918 X:148529128-148529150 CCCTTGGAGTAGAAAACAGATGG - Intronic
1199521488 X:148741215-148741237 CCCTGGTAGTGGAAGACAAAGGG - Intronic
1199792316 X:151166915-151166937 CACTGGGAGTGGACACGAGAGGG + Intergenic
1200552441 Y:4593904-4593926 CTCAGGCAGTGGAAGTCAGAGGG + Intergenic
1202023435 Y:20492390-20492412 TCCTGGTAGTGGAGGCCACAGGG + Intergenic