ID: 1096519399

View in Genome Browser
Species Human (GRCh38)
Location 12:52175714-52175736
Sequence CCCTTGGGTGTCTCCTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 306}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096519386_1096519399 26 Left 1096519386 12:52175665-52175687 CCTGTCTCTGCCCTGGAGCTGGC 0: 1
1: 0
2: 6
3: 80
4: 501
Right 1096519399 12:52175714-52175736 CCCTTGGGTGTCTCCTGCTGGGG 0: 1
1: 0
2: 1
3: 30
4: 306
1096519392_1096519399 -2 Left 1096519392 12:52175693-52175715 CCTGAACTCAGTGGCCAGCTGCC 0: 1
1: 0
2: 2
3: 17
4: 225
Right 1096519399 12:52175714-52175736 CCCTTGGGTGTCTCCTGCTGGGG 0: 1
1: 0
2: 1
3: 30
4: 306
1096519388_1096519399 16 Left 1096519388 12:52175675-52175697 CCCTGGAGCTGGCAGGACCCTGA 0: 1
1: 0
2: 3
3: 50
4: 388
Right 1096519399 12:52175714-52175736 CCCTTGGGTGTCTCCTGCTGGGG 0: 1
1: 0
2: 1
3: 30
4: 306
1096519389_1096519399 15 Left 1096519389 12:52175676-52175698 CCTGGAGCTGGCAGGACCCTGAA 0: 1
1: 0
2: 1
3: 47
4: 299
Right 1096519399 12:52175714-52175736 CCCTTGGGTGTCTCCTGCTGGGG 0: 1
1: 0
2: 1
3: 30
4: 306
1096519391_1096519399 -1 Left 1096519391 12:52175692-52175714 CCCTGAACTCAGTGGCCAGCTGC 0: 1
1: 0
2: 0
3: 28
4: 232
Right 1096519399 12:52175714-52175736 CCCTTGGGTGTCTCCTGCTGGGG 0: 1
1: 0
2: 1
3: 30
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096519399 Original CRISPR CCCTTGGGTGTCTCCTGCTG GGG Intronic
900018298 1:169795-169817 CCCTTGGGTTTCTCCTGGGTAGG - Intergenic
900048555 1:528391-528413 CCCTTGGGTTTCTCCTGGGTAGG - Intergenic
900070785 1:770243-770265 CCCTTGGGTTTCTCCTGGGTAGG - Intergenic
900980518 1:6043565-6043587 CACTTGGGTGTCTCTTGTGGGGG + Intronic
901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG + Intronic
902512199 1:16972533-16972555 CCCTTGGGGGCCTCAAGCTGGGG + Exonic
904390870 1:30185005-30185027 GCCTTGGGCTTCTCCTGCAGAGG + Intergenic
904490870 1:30858283-30858305 TCTCTGGGTGTCTCTTGCTGAGG - Intergenic
904910085 1:33928108-33928130 TCATTGTGAGTCTCCTGCTGTGG + Intronic
905009702 1:34739117-34739139 CCCTTAGGTGTCTCCTCCCTGGG + Intronic
905171571 1:36112918-36112940 CCCATGGCTGTCCCCTGCTCTGG + Intronic
906053962 1:42899932-42899954 CCCTTGGGTGGGTCTTGCTGCGG + Intergenic
906564052 1:46783943-46783965 TCCTTGGGTGGGTCTTGCTGTGG + Intronic
907431271 1:54413407-54413429 CCCATGGGTCTCTCATTCTGGGG + Intronic
908410974 1:63864721-63864743 CCCTTGGAACTCTGCTGCTGTGG + Intronic
910380720 1:86623578-86623600 TCCTTGGGTGGCTATTGCTGTGG - Intergenic
912506718 1:110161683-110161705 GCCTGGGGTGTTTCTTGCTGGGG - Intronic
913086743 1:115445308-115445330 CCCTTGAGTCTTTCCAGCTGAGG + Intergenic
913608944 1:120492206-120492228 GCCTTGGATATCTCCAGCTGAGG + Intergenic
914443052 1:147723649-147723671 CTTTTGGGTGACTCCAGCTGTGG + Intergenic
916735324 1:167602240-167602262 CCCTTGGTTAACTCCTGCTGTGG + Intergenic
918033058 1:180835788-180835810 CTCTTGGGTGTCTTGTGTTGTGG + Intronic
918119321 1:181524033-181524055 ACTTGGGGTGTCACCTGCTGGGG - Intronic
922106144 1:222515659-222515681 CCCTTGGGTTTCTCCTGGGTAGG - Intergenic
922359572 1:224809269-224809291 CCCTTGAGTGTCACCTTCTGTGG + Intergenic
924348324 1:243093226-243093248 CCCTTGGGTTTCTCCTGGGTAGG - Intergenic
924792510 1:247265960-247265982 CCCATGGGTGTCTCATACAGGGG - Intergenic
1064908134 10:20370179-20370201 TCCTTGGGTGAGTCTTGCTGTGG + Intergenic
1065275473 10:24081442-24081464 CCCTGGGATGGCACCTGCTGAGG + Intronic
1066010321 10:31188517-31188539 TCCATGGGTGGCCCCTGCTGGGG - Intergenic
1066145509 10:32553975-32553997 TCCTTGGGTGAGTCTTGCTGTGG + Intronic
1066728038 10:38411675-38411697 CCCTTGGGTTTCTCCTGTGTAGG + Intergenic
1067105208 10:43362013-43362035 CCCTGGGGAGTTTCCTGCTGGGG - Intergenic
1067749134 10:48958361-48958383 TCCCTGAGTGACTCCTGCTGTGG - Intronic
1069325290 10:67225209-67225231 TCCTTGGGTGGGTCTTGCTGTGG - Intronic
1070900393 10:80023118-80023140 CCCTTCGGTGACTAGTGCTGTGG - Intergenic
1071302260 10:84264840-84264862 AGCCTGGGGGTCTCCTGCTGAGG + Intergenic
1072621692 10:97083976-97083998 CCCTGGTGTCACTCCTGCTGAGG - Intronic
1073114761 10:101085510-101085532 CTCTTGGGGGTCCCCTGCTCTGG + Intergenic
1074965668 10:118488839-118488861 CCCTTTGCTGACTCATGCTGGGG - Intergenic
1075313558 10:121434044-121434066 CCCTGAGGTGTCGCCTGCTCAGG - Intergenic
1075705490 10:124497779-124497801 CTCTTGGATGCCTTCTGCTGTGG + Intronic
1076509577 10:131002868-131002890 CCCTTCTGTGTCACCTGCTTCGG + Intergenic
1076854683 10:133110068-133110090 CCCTGTGGTGTATCCTTCTGTGG - Intronic
1076974900 11:164991-165013 CCCTTGGGTTTCTCCTGGGTAGG - Intergenic
1078575377 11:12497660-12497682 CCCTCAGGTGTCTCCCTCTGCGG - Intronic
1079765918 11:24392807-24392829 GCCTTGGGAGTCTCCTACAGAGG + Intergenic
1079791714 11:24747711-24747733 TCCTTGGGTGGGTCTTGCTGTGG + Intronic
1080153029 11:29076230-29076252 TCCTTGGGTGGGTCTTGCTGTGG + Intergenic
1081651473 11:44826995-44827017 CTCTTGGGTGCTTCCTGTTGTGG + Intronic
1081970389 11:47194344-47194366 TCCTGGGGCGTCTCCTGCTGAGG - Intergenic
1083047386 11:59749076-59749098 CCCTGGGGTCTCTGCTGTTGGGG + Intronic
1083051635 11:59782273-59782295 TCCTTGGGTGGCTACTGATGAGG + Intronic
1083203443 11:61133436-61133458 CCCTTTGGTGGACCCTGCTGTGG - Intronic
1083631101 11:64095948-64095970 CCCTGGGGAGTCTCCAGCAGTGG + Intronic
1084147413 11:67272451-67272473 CTCTTAGGTGTCTCCTGCTCGGG - Intronic
1084565217 11:69924732-69924754 CCCTTTTGGGTCTGCTGCTGTGG - Intergenic
1084775012 11:71369287-71369309 CCTGTGGGAGGCTCCTGCTGTGG + Intergenic
1085502988 11:77039678-77039700 CCCTCTGGCGTCTCCTCCTGCGG - Exonic
1085649061 11:78250750-78250772 CTCTTTGGTGGCGCCTGCTGTGG + Intronic
1085747824 11:79129720-79129742 TCCTTGGGTGGGTCTTGCTGTGG - Intronic
1085772042 11:79334368-79334390 CTCTTTGGTATCTCTTGCTGTGG - Intronic
1088239528 11:107759024-107759046 TCCTTGGGTGGGTCTTGCTGCGG - Intergenic
1088599674 11:111463231-111463253 GCCTTGGGAGTCTCTTTCTGAGG - Intergenic
1089461628 11:118657487-118657509 CCCCTGGGCATCTCATGCTGGGG + Exonic
1090543208 11:127731689-127731711 TCATTGTGTGTCTTCTGCTGTGG - Intergenic
1091210528 11:133854464-133854486 TCCTTGGGTGGGTCTTGCTGCGG + Intergenic
1091571396 12:1690070-1690092 CCCTTTGTTATCTCTTGCTGTGG + Intronic
1094447352 12:30546180-30546202 TCCTTGGGTGGGTCTTGCTGTGG + Intergenic
1094526002 12:31231735-31231757 ACCTTGGGTGTCATCTGCTGTGG + Intergenic
1095390684 12:41702721-41702743 CTCTTTGCTGTCTCTTGCTGTGG + Intergenic
1096347880 12:50866466-50866488 TCCTTGGGTGGGTCTTGCTGAGG - Intronic
1096519399 12:52175714-52175736 CCCTTGGGTGTCTCCTGCTGGGG + Intronic
1097282008 12:57850760-57850782 TCCCTGTCTGTCTCCTGCTGTGG + Intergenic
1099494759 12:83333539-83333561 CCCTTTGTTGTATCCTGCTATGG - Intergenic
1100257559 12:92899885-92899907 CTCTTGGGTGTCTCCTCCAATGG + Intronic
1100377287 12:94029160-94029182 CCCTTAGTTGTGTCCAGCTGGGG - Intergenic
1100706327 12:97203845-97203867 TCCTTGGGTGGGTCTTGCTGTGG - Intergenic
1101842544 12:108338988-108339010 GCCTTGGGTGTCTTCTGAGGGGG - Intronic
1102156376 12:110732485-110732507 ACCATGGGTATCTCCTCCTGAGG + Intronic
1102793237 12:115665696-115665718 CCCATTGGTGTCCCCTCCTGTGG - Intergenic
1102967831 12:117141653-117141675 TCCGTGGCTGTCTCCTGCGGTGG + Intergenic
1103542200 12:121673890-121673912 GCTTTGGGGGACTCCTGCTGCGG + Intergenic
1104062583 12:125281091-125281113 CCGCTGGGGGTCCCCTGCTGGGG - Intronic
1104559069 12:129827584-129827606 GCCTGCGGTGTTTCCTGCTGTGG + Intronic
1105304884 13:19161425-19161447 GCCCTGGGTCGCTCCTGCTGTGG - Intergenic
1105908256 13:24835160-24835182 TCCTTGGGTGGGTCTTGCTGAGG - Intronic
1105930762 13:25049485-25049507 TCCTTGGGTGGGTCTTGCTGTGG - Intergenic
1106402122 13:29441198-29441220 CCCCTGGGCTTCTCCTGGTGGGG - Intronic
1107175587 13:37394893-37394915 CCCTTGGTGCTCTCCAGCTGGGG + Intergenic
1110561866 13:76918089-76918111 TCCTTGGGTGGGTCTTGCTGCGG - Intergenic
1110661207 13:78060947-78060969 TCCTTGGGTGGGTCTTGCTGTGG + Intergenic
1112500635 13:99940462-99940484 CCCTCAGTTGTCTGCTGCTGCGG - Intergenic
1113489570 13:110680532-110680554 CCCTTACGTGTCTCCTGGTGAGG + Intronic
1114665876 14:24376797-24376819 CCCCTGGATTTCTCCTGCTCCGG - Exonic
1117768478 14:59107831-59107853 TCCTTGGGTGGGTCTTGCTGTGG - Intergenic
1117993388 14:61456863-61456885 CCCTTGGGTGCCTTCTGCGGTGG - Intronic
1118165598 14:63332608-63332630 TCCTTGGGTGGGTCTTGCTGAGG - Intergenic
1119136300 14:72223944-72223966 CTCTCAGGTGTCTCCTGCAGTGG - Intronic
1121332182 14:93056520-93056542 CCCTTGGGGGTGCACTGCTGAGG - Intronic
1121896526 14:97653227-97653249 CCCTCAGGTGTCTCATCCTGAGG + Intergenic
1121951129 14:98171960-98171982 CTCTGGGCTGTTTCCTGCTGAGG - Intergenic
1122233618 14:100319958-100319980 CCATTGGCTATCTCCAGCTGAGG + Intergenic
1122366094 14:101195604-101195626 CCCGTGGGGCTCTCCTGCTCAGG + Intergenic
1122388987 14:101367659-101367681 CCCCAGGGCTTCTCCTGCTGGGG - Intergenic
1124169919 15:27363544-27363566 CCCTCGGGAGTCACCTGCTTAGG + Intronic
1124557135 15:30736441-30736463 TCCTTGGGTGCGTCTTGCTGAGG - Intronic
1127089989 15:55457389-55457411 CCCTTGGGTGGGGCTTGCTGTGG - Intronic
1127525242 15:59786483-59786505 TCCTTGGGTGGGTCTTGCTGTGG + Intergenic
1127782520 15:62329647-62329669 GCCTTGAGAGTCTCCTCCTGTGG + Intergenic
1129261833 15:74373074-74373096 CCCTTGGGAGGCCCCCGCTGCGG + Intergenic
1130919744 15:88334158-88334180 GCCTTGCCTGTCTCCTGCTGGGG + Intergenic
1132376533 15:101331905-101331927 GCCTTGGGTGGCTCCAGCTCTGG + Exonic
1132463850 16:68614-68636 GCTTTGGGTGTCTCCTGATGGGG - Intronic
1132627291 16:897533-897555 CCTTTGAGTCTCTCCTGCGGAGG - Intronic
1132978855 16:2724698-2724720 CTCTTGGGTTTCTCCTGATTTGG - Intergenic
1132996578 16:2826789-2826811 CCCTTGAGCGGCTGCTGCTGCGG - Intergenic
1134821442 16:17250740-17250762 CCCTTTGGCATCTCCTTCTGAGG - Intronic
1135304888 16:21359695-21359717 CCCAAGGGTTGCTCCTGCTGAGG - Intergenic
1136081499 16:27855184-27855206 CCCTGGCTTGTCCCCTGCTGAGG + Intronic
1136301637 16:29338888-29338910 CCCAAGGGTTGCTCCTGCTGAGG - Intergenic
1138266495 16:55663582-55663604 ACCTTGGGTCCCTCCAGCTGAGG + Intronic
1138418048 16:56882518-56882540 CCCCTGGGTGCCTCCTCCTGAGG - Intronic
1138540177 16:57683044-57683066 CCCTTGGAGGTTTCCTTCTGGGG - Intronic
1139355179 16:66363375-66363397 TCCTTGGGTGTCTCACGCTGTGG + Intergenic
1139389022 16:66593939-66593961 CCCTTTGGTGTCTCCTGCCCCGG + Intergenic
1140282050 16:73564024-73564046 CCCTAGTGTGTGTCCTGCTTTGG - Intergenic
1141545951 16:84769315-84769337 ACCTTCGGGGTGTCCTGCTGTGG + Intronic
1141880800 16:86857557-86857579 CCCATGGGTGTCTCTGGCTGAGG - Intergenic
1142190189 16:88713873-88713895 ACCTTCAGTGACTCCTGCTGTGG + Intronic
1142445362 16:90132666-90132688 CCCTTGGGTTTCTCCTGGGTAGG + Intergenic
1142462149 17:102804-102826 CCCTTGGGTTTCTCCTGGGTAGG - Intergenic
1143990837 17:10959925-10959947 TCCTTGGGTGGGTCTTGCTGTGG - Intergenic
1144139680 17:12336544-12336566 CCCTTGGGTGGGTCTTGCTGTGG + Intergenic
1144330786 17:14222402-14222424 CCCTTAAGTTTCTCCTGTTGTGG + Intergenic
1146491740 17:33288266-33288288 CTCTGGGGTTTCTCCTGCTTTGG - Intronic
1147165654 17:38591860-38591882 CCCTTTGGTGTCTGGAGCTGGGG - Intronic
1147371797 17:39997629-39997651 CCCTTGGGGGTCCCCTGCCCAGG + Exonic
1147463190 17:40589096-40589118 TCCTTGGGTGGGTCTTGCTGTGG + Intergenic
1149298478 17:55283144-55283166 CCCTGGGGTGTTTCCTTCTGTGG - Intronic
1149567382 17:57649825-57649847 CCCTTGGGAGCCTCCTGGTAGGG - Intronic
1152532135 17:80924844-80924866 GCTTTGGGTGTTTCCTGTTGTGG - Intronic
1152710587 17:81868988-81869010 CCCTTGGGTGCCTCCTCCACGGG + Exonic
1153424994 18:4953023-4953045 TCCTTGGGTGGGTCTTGCTGCGG - Intergenic
1156011377 18:32501335-32501357 TCCTTGGGTGGGTCTTGCTGTGG + Intergenic
1157384809 18:47251611-47251633 CACTTGGGGCTCTCCTGCCGCGG - Intergenic
1159798130 18:72867897-72867919 CCCTTGGGGATCTTCCGCTGAGG + Exonic
1159906556 18:74097596-74097618 TCCTTGGGTGGGTCTTGCTGTGG - Intronic
1160334459 18:78026292-78026314 CCACTGGGTGTCTCTCGCTGAGG - Intergenic
1160651852 19:235171-235193 CCCTTGGGTTTCTCCTGGGTAGG - Intergenic
1162098985 19:8328288-8328310 CCCCTGGTTGTCTTCTGCTACGG + Intronic
1162770157 19:12944489-12944511 CCCTCCTGTGTCTCCTTCTGGGG + Exonic
1163037337 19:14578085-14578107 GCCCTGGGAGTCTTCTGCTGAGG - Intergenic
1163378111 19:16946863-16946885 CCCTGGGGTCTCACCTGTTGGGG - Intronic
1164763584 19:30746066-30746088 CCCATGGGTCTCTCTTCCTGAGG + Intergenic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1166604255 19:44126695-44126717 TCCTTGGGTGGGTCTTGCTGTGG + Intronic
1166830160 19:45634466-45634488 CCCCTGGGTGGCTCCAGCTATGG - Exonic
1166865694 19:45835436-45835458 GCCTTGCCTGGCTCCTGCTGTGG - Intronic
1168515494 19:57007470-57007492 CCAGTGGGTGTCACCTGATGTGG - Intergenic
925383261 2:3443359-3443381 CCCTTCAGGGTCTCCTTCTGGGG + Intronic
926916003 2:17893082-17893104 TCCTTGGGTGGGTCTTGCTGTGG + Intronic
927108688 2:19848978-19849000 TCTTTTGGTTTCTCCTGCTGTGG + Intergenic
927873292 2:26638049-26638071 CCCCTGGGTAGCTCCTGCTCAGG - Intronic
929806013 2:45145525-45145547 TCCTTGGGTGGGTCTTGCTGTGG - Intergenic
931721235 2:65069143-65069165 CTCTTGGGTTTCTGCTGGTGGGG + Intronic
931993021 2:67809799-67809821 TCCTTGGGTGGGTCTTGCTGTGG - Intergenic
932701957 2:73998157-73998179 CTCTTGGAAGTCTTCTGCTGGGG + Intronic
932954635 2:76337299-76337321 TCCTTGGGTGGGTCTTGCTGTGG + Intergenic
933657184 2:84898698-84898720 CCCTTGGATTTCTCATTCTGGGG - Intronic
934873275 2:97887524-97887546 CCCGGGGGTCTCTCCTGCTTGGG + Intronic
937220928 2:120343063-120343085 CCCTTGTCTGTCTCCTGCATGGG - Intergenic
938901011 2:135798443-135798465 CCCTTGGATGGGTCCTGCAGAGG + Intronic
942046311 2:172101286-172101308 CCCTTGGGGGTTTCCAGCTTTGG + Intronic
944432078 2:199644687-199644709 TCCTTGGGTGGGTCTTGCTGCGG + Intergenic
944528875 2:200648743-200648765 TCCTTGGGTGGGTCTTGCTGTGG + Intronic
945048418 2:205801525-205801547 CCCTTGGAGGTCTCTTGCTTGGG - Intergenic
945132130 2:206584599-206584621 TCCTTGGGTGGGTCTTGCTGTGG - Intronic
947442145 2:230132759-230132781 CCCTTGGTTTTCTCCTGAAGGGG + Intergenic
948123237 2:235546274-235546296 CCCTCGGGTGCCACCTGATGGGG + Intronic
948574727 2:238942341-238942363 ACCTTGGTTGTTTCCTGCTCTGG - Intergenic
948991648 2:241558799-241558821 CTCTTGGGGGGCTCCTGCCGCGG - Exonic
949069267 2:242013569-242013591 CCCATGGGTGTCCCCTGACGGGG - Intergenic
1169789119 20:9391057-9391079 CCCATGGGAGGCTCATGCTGTGG + Intronic
1170776166 20:19376551-19376573 CCCTTGGCTGGCTCATGCTGGGG - Intronic
1171437852 20:25136873-25136895 CTCTTGGGTGACTCATGCTGGGG - Intergenic
1171456544 20:25275802-25275824 CACTTGGGTGTCGCCTTGTGGGG + Intronic
1171984485 20:31650130-31650152 CCCTTGAGTGTTTCCAGCTGAGG - Intergenic
1173191782 20:40882469-40882491 CCCTTGGGAGTCTTTTGTTGAGG - Intergenic
1175471538 20:59233357-59233379 CCTTTGGGTCCCTCCTGGTGTGG + Intronic
1179180641 21:39041944-39041966 CACTTGGGTGCCCACTGCTGGGG - Intergenic
1180206613 21:46264950-46264972 CCCTTGGGTGTGGCCTGGAGTGG - Intronic
1180261105 21:46669515-46669537 CCTTTGGGAGTCTCCAGCTGTGG - Intergenic
1180616500 22:17131730-17131752 CCCTTGGGTGGCAGCTTCTGTGG - Exonic
1183018616 22:35009624-35009646 TCCATGGGGGTCTCCTCCTGGGG - Intergenic
1183172567 22:36198894-36198916 CCCTGGGGTGTTTCCAGCAGAGG - Intronic
1183180678 22:36257806-36257828 CCCTGGGGTGTTTCCACCTGAGG + Intronic
1184168338 22:42743644-42743666 CCCTTTGGTCTCTCCCTCTGGGG + Intergenic
1184358578 22:43999194-43999216 CCATTGGGTGACTCCTGCAAAGG + Exonic
1185086419 22:48743269-48743291 CCCTTGGGAGGCTCCAGCAGAGG + Intronic
949262174 3:2115493-2115515 AACTTGTGTGTCTCGTGCTGTGG - Intronic
949495719 3:4629843-4629865 CCCATGGGTGCCTCCGACTGAGG - Intronic
949940420 3:9150270-9150292 GCCCAGGGTGTCTTCTGCTGGGG - Intronic
950117651 3:10461866-10461888 CCCTTGGGTGGCTTCTGGTGAGG + Intronic
950378918 3:12594498-12594520 CCCTTTGGTGTCACCTGTTCTGG + Intronic
952962469 3:38601240-38601262 CCCTTGGATGTGTCCTCCTCAGG + Intronic
953245286 3:41185430-41185452 CCCCTGGGTGTCACTAGCTGTGG - Intergenic
953663336 3:44906942-44906964 CCCTCAGGTGTCTTCTGCTGTGG + Exonic
954924406 3:54219545-54219567 CCCTTGGGTTTCTCTTCCTTCGG + Intronic
955175629 3:56611224-56611246 TCCTTGGGTGGGTCTTGCTGTGG + Intronic
955681706 3:61508151-61508173 TCCTTGGGTTTCTCATGCTTGGG + Intergenic
958262977 3:91404126-91404148 TCCTTGGGTGGGTCTTGCTGCGG + Intergenic
958770676 3:98421960-98421982 TCCTTGGGTGGGTCTTGCTGTGG - Intergenic
959275227 3:104269637-104269659 TCCTTGGGTGGGTCTTGCTGTGG + Intergenic
960907471 3:122615837-122615859 ACCTTGGGTATCTCCTGCCATGG - Exonic
962401845 3:135067348-135067370 TCCTTGGGCGTGTCTTGCTGTGG + Intronic
963790789 3:149580448-149580470 CCCTGGGGTTTCTCCTGCAATGG - Intronic
968365978 3:198184796-198184818 CCCTTGGGTTTCTCCTGGGTAGG + Intergenic
969248849 4:5954227-5954249 CCCTTGTGTGTGTCAGGCTGGGG + Intronic
969307376 4:6333532-6333554 GGATTGGGGGTCTCCTGCTGTGG + Intronic
971472300 4:27040292-27040314 CCCTTGGGTGGGGCTTGCTGTGG + Intergenic
971900995 4:32658161-32658183 TCCTTGGGTGGGTCTTGCTGAGG + Intergenic
973179578 4:47251601-47251623 TCCTTGGGTGGGTCTTGCTGTGG + Intronic
975517255 4:75260325-75260347 TCCTTGGGTGGGTCTTGCTGTGG - Intergenic
975680205 4:76868364-76868386 TCCTTGGGTGGGTCTTGCTGTGG - Intergenic
979255016 4:118599955-118599977 CCCTTGGGTTTCTCCTGGGTAGG + Intergenic
979333945 4:119446058-119446080 CCCTTGGGTTTCTCCTGGGTAGG - Intergenic
979565713 4:122152378-122152400 CCCTTGGGTGTCGGTGGCTGCGG + Exonic
981760786 4:148192635-148192657 TCCTTGGGTGGGTCTTGCTGTGG + Intronic
982312151 4:153997332-153997354 TCCTTGGGTGGGTCTTGCTGTGG + Intergenic
982767816 4:159368456-159368478 CCCTGTGGCATCTCCTGCTGTGG + Intergenic
988344605 5:30021109-30021131 TCCTTGGGTGGGTCTTGCTGTGG - Intergenic
989643288 5:43603518-43603540 CCCTTTCTCGTCTCCTGCTGGGG + Intronic
994436970 5:99748700-99748722 GCCTTGGGAGTCTCCTGGTCTGG + Intergenic
994875309 5:105413984-105414006 TCCTTGGGTGGGTCTTGCTGTGG - Intergenic
994923579 5:106084176-106084198 CCCTTGGAAGTCTGCTGCTCAGG + Intergenic
995555243 5:113321504-113321526 CCCTTGGGAGTTTCCTAATGTGG - Intronic
995817811 5:116191627-116191649 TCCTTGGGTGGGTCTTGCTGTGG - Intronic
998065597 5:139155758-139155780 TCCTTGGCTGTCACCTGCTATGG - Intronic
998429718 5:142060535-142060557 CCCATCTGTGTCTCTTGCTGAGG + Intergenic
998651462 5:144125781-144125803 CTCTTCTGTGTCTCCTGTTGTGG + Intergenic
998777478 5:145618837-145618859 TCCTTGGGTGGGTCTTGCTGTGG + Intronic
999484853 5:151985317-151985339 TCCTTGGGTGGGTCTTGCTGTGG + Intergenic
1000779651 5:165465016-165465038 TCCTTGGGTGGGTCTTGCTGTGG - Intergenic
1001964527 5:175900902-175900924 CCCATGGGTGTCTGCCCCTGGGG + Intergenic
1002725204 5:181290021-181290043 CCCTTGGGTTTCTCCTGGGTAGG + Intergenic
1003510176 6:6773033-6773055 CCCTAGAGTGTCTCCAGTTGAGG + Intergenic
1003930481 6:10919730-10919752 TCCTTGGGTGGGTCTTGCTGTGG + Intronic
1005760274 6:28961259-28961281 TCCTTGGGTGGGTCTTGCTGCGG - Intergenic
1006753003 6:36391116-36391138 CCGTTGGGTGTTTCCTTCTCAGG - Exonic
1007547764 6:42707457-42707479 TCCTCTGGTCTCTCCTGCTGGGG + Intronic
1008992431 6:57618761-57618783 TCCTTGGGTGGGTCTTGCTGTGG - Intronic
1009181056 6:60517874-60517896 TCCTTGGGTGGGTCTTGCTGCGG - Intergenic
1010714097 6:79208063-79208085 CTATTTGGTGTCTCCTTCTGTGG - Intronic
1011781695 6:90796696-90796718 GCCATGGGTCTCTCCTTCTGAGG + Intergenic
1012113200 6:95261825-95261847 CCCATGGGTGGCACCTGCCGGGG - Intergenic
1013221318 6:108080307-108080329 TCCTTGGGTGGGTCTTGCTGCGG + Intronic
1013431019 6:110054889-110054911 CCCTGGGGTTCCTCATGCTGGGG - Intergenic
1014531388 6:122563617-122563639 TCCTTGGGTGGGTCTTGCTGCGG + Intronic
1016171792 6:141026646-141026668 GCTTTGGGTTTCTCCTGCTGAGG + Intergenic
1016598567 6:145829300-145829322 CTGTTGGCTGCCTCCTGCTGTGG + Intergenic
1017929367 6:158939027-158939049 CCCTTGGGGGCCCCCGGCTGTGG + Intergenic
1018099826 6:160427449-160427471 CTGGTAGGTGTCTCCTGCTGGGG - Intronic
1019315883 7:386370-386392 CCATTGTCTGTCTCCTGCTCTGG + Intergenic
1019444510 7:1064418-1064440 ACCTTCCATGTCTCCTGCTGGGG - Intronic
1019549189 7:1593812-1593834 GGCTTGGGGGTCTCCTGCGGGGG - Intergenic
1023275041 7:38509850-38509872 CTGTTCGGTGTCTCCTGCTGTGG + Intronic
1024056517 7:45662996-45663018 CCCTTTGATGGCTCCTGCAGTGG - Intronic
1024070114 7:45777644-45777666 CCCTTGGGTTTCTCCTGGGTAGG + Intergenic
1024545481 7:50513809-50513831 TCCTTGGGTGGGTCTTGCTGCGG - Intronic
1025099319 7:56122327-56122349 CCCTTGGGTTTCTCCTGGGTAGG - Intergenic
1025990189 7:66491714-66491736 CCCTTGGGTTTCTCCTGGGTAGG + Intergenic
1027212854 7:76164765-76164787 CCCTTGGGTTTCTCCTGGGTAGG - Intergenic
1027266106 7:76496111-76496133 CGCTTTGGTGTCTCCTGCTGAGG + Intronic
1027614856 7:80409288-80409310 CCATTGAGTGTTTCCAGCTGAGG + Intronic
1032047505 7:128621927-128621949 CCCTTGGGTTTCTCCTGGGTAGG + Intergenic
1032128382 7:129210857-129210879 CCCTTGGGAGCCTCCTTCTCTGG + Intronic
1033445959 7:141422334-141422356 CCATTGATTGTCTCCTGATGTGG + Intronic
1034093149 7:148382312-148382334 CCCCTTGGTATCTCCTTCTGAGG - Intronic
1034506328 7:151494741-151494763 CCCTTGGGTCTCTCCTCCCTGGG + Intronic
1034683193 7:152946979-152947001 TCCTTGGGTGAGTCTTGCTGTGG + Intergenic
1035072220 7:156153950-156153972 CCCTAGGGTCTCTCCCGTTGAGG - Intergenic
1035786244 8:2263512-2263534 CCTCTGGGTGTCTACTCCTGTGG - Intergenic
1035806563 8:2458204-2458226 CCTCTGGGTGTCTACTCCTGTGG + Intergenic
1036010480 8:4716177-4716199 CCATTGGGTGGCGCCTGCTCAGG - Intronic
1038282399 8:26177906-26177928 CTCTTGGATGGCTCCTTCTGGGG - Intergenic
1039944554 8:42118255-42118277 CACTTGGGTCTCCCTTGCTGTGG + Intergenic
1041293746 8:56333451-56333473 TCCTTGGGTGGGTCTTGCTGTGG + Intergenic
1042183340 8:66113410-66113432 CCTAAGGATGTCTCCTGCTGAGG - Intergenic
1043295262 8:78654131-78654153 CCCATGGGTGTCTCACACTGGGG - Intergenic
1047130755 8:122017423-122017445 TCCTTGGGTGGGTCTTGCTGTGG + Intergenic
1048765803 8:137843299-137843321 CCAGTGGGTCTGTCCTGCTGAGG + Intergenic
1049614333 8:143569507-143569529 CCCTGAGGAGGCTCCTGCTGCGG - Exonic
1049809002 8:144554919-144554941 CCCCTGGGTGGCCCATGCTGCGG + Intronic
1052271953 9:26636409-26636431 CCCTTGGGTGTCTGGTTATGTGG + Intergenic
1052731455 9:32291215-32291237 TCCTTGAGTGGGTCCTGCTGGGG + Intergenic
1053409892 9:37909143-37909165 CCCATGGGTGTCTTATGATGAGG - Intronic
1053491245 9:38505304-38505326 CCCATGGGCTTCTTCTGCTGGGG + Intergenic
1057119494 9:92558788-92558810 TCCTTGGGTGGGTCTTGCTGCGG + Intronic
1057671552 9:97094505-97094527 CCCATGGGCTTCTTCTGCTGGGG + Intergenic
1057866672 9:98687062-98687084 CTCTTGGCCCTCTCCTGCTGAGG + Intronic
1058085037 9:100739724-100739746 TCCTTGGGTGGGTCTTGCTGCGG + Intergenic
1060884586 9:127141441-127141463 CCCTTGGGGGTTTCCAGCTCAGG + Intronic
1061791793 9:133063021-133063043 CCCCTGTGTGACTCCTGCTGGGG - Intronic
1061795468 9:133083587-133083609 CCCCTGTGTGACTCCTGCTGGGG - Intronic
1061870406 9:133517273-133517295 CCCCTGGGAGTCACCTGGTGGGG - Intronic
1062276261 9:135732946-135732968 CCCCTGGTTGCCTCCTGATGAGG + Intronic
1062385523 9:136309503-136309525 GCCTGGTGTGTCTGCTGCTGGGG - Intergenic
1062457291 9:136645735-136645757 CCCATGGGTTTCACGTGCTGGGG + Intergenic
1062459447 9:136656786-136656808 CGTTCGGGTGTCTCCTCCTGGGG - Intergenic
1062518107 9:136946079-136946101 CCCTCGGGCGTCTCGGGCTGGGG - Exonic
1062750347 9:138247663-138247685 CCCTTGGGTTTCTCCTGGGTAGG + Intergenic
1185935535 X:4253186-4253208 GCCTAGGGTGTGTCCTGCAGAGG + Intergenic
1186250471 X:7660511-7660533 CCCAGGGATGTCTCCTGCTCTGG - Intergenic
1187748386 X:22433679-22433701 TCCTTGGGTGGGTCTTGCTGCGG - Intergenic
1188045897 X:25426099-25426121 TCCTTGGGTGGGTCTTGCTGCGG + Intergenic
1189804412 X:44720775-44720797 CCCTTGGGTGTCTGCTCTGGAGG + Intergenic
1190034733 X:47011004-47011026 CTCTGGGGTGTCTCCTTCTAAGG + Intronic
1192069066 X:67918068-67918090 TCCTTGGGTGGGTCTTGCTGTGG + Intergenic
1192609653 X:72554711-72554733 TCCTTGGGTGGGGCCTGCTGTGG - Intronic
1192979045 X:76319105-76319127 TCCTTGGGTGGGTCTTGCTGTGG + Intergenic
1193077012 X:77365004-77365026 TCCTTGGGTGGGTCTTGCTGTGG - Intergenic
1193203085 X:78715185-78715207 TCCTTGGGTGGGTCTTGCTGTGG - Intergenic
1193244390 X:79211470-79211492 TCCTTGGGCGTCTCCAGGTGCGG + Intergenic
1193680972 X:84518626-84518648 TCCTTGGGTGTGTCTTGCTGTGG + Intergenic
1194926913 X:99836507-99836529 TCCTTGGGTGGGTCTTGCTGCGG + Intergenic
1195062433 X:101209496-101209518 GTCTTGGGGGTCTCCTGCTGGGG - Intergenic
1197953700 X:131923885-131923907 TCCTTGGGTGGGTCTTGCTGAGG - Intergenic
1198049024 X:132930675-132930697 CCCTTGGGTGTCTTTTGGTGGGG - Intronic
1198313104 X:135438795-135438817 CCCTTGGGGGCCTCGAGCTGAGG + Intergenic
1199547823 X:149025930-149025952 TCCTAGGGTGTATCCTGCTAGGG - Intergenic
1199668528 X:150121271-150121293 TCCTTGGGTGGGTCTTGCTGTGG - Intergenic
1199974230 X:152883173-152883195 CCGTGGGGCGTTTCCTGCTGGGG + Intergenic
1200515163 Y:4135282-4135304 CACTAGGGTGTGCCCTGCTGGGG - Intergenic
1202174503 Y:22085109-22085131 CCCATGGGTGTCTCATACAGGGG - Intronic
1202216857 Y:22501273-22501295 CCCATGGGTGTCTCATACAGGGG + Intronic
1202326330 Y:23694797-23694819 CCCATGGGTGTCTCATACAGGGG - Intergenic
1202544442 Y:25975257-25975279 CCCATGGGTGTCTCATACAGGGG + Intergenic