ID: 1096520822

View in Genome Browser
Species Human (GRCh38)
Location 12:52183626-52183648
Sequence GCGGATAGAAACCAGGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096520815_1096520822 26 Left 1096520815 12:52183577-52183599 CCAGAGAGAGGAAGAGAGGCTCA 0: 1
1: 0
2: 4
3: 47
4: 484
Right 1096520822 12:52183626-52183648 GCGGATAGAAACCAGGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 67
1096520814_1096520822 27 Left 1096520814 12:52183576-52183598 CCCAGAGAGAGGAAGAGAGGCTC 0: 1
1: 0
2: 3
3: 45
4: 479
Right 1096520822 12:52183626-52183648 GCGGATAGAAACCAGGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 67
1096520817_1096520822 2 Left 1096520817 12:52183601-52183623 CCTAAGCAGTAGAGTCAGGTAGC 0: 1
1: 0
2: 0
3: 11
4: 86
Right 1096520822 12:52183626-52183648 GCGGATAGAAACCAGGCGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096520822 Original CRISPR GCGGATAGAAACCAGGCGGC AGG Intronic