ID: 1096528423

View in Genome Browser
Species Human (GRCh38)
Location 12:52228139-52228161
Sequence AAGGAGAAGAAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7175
Summary {0: 3, 1: 22, 2: 241, 3: 1400, 4: 5509}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096528423_1096528428 19 Left 1096528423 12:52228139-52228161 CCCTCCTCCTTCTTCTTCTCCTT 0: 3
1: 22
2: 241
3: 1400
4: 5509
Right 1096528428 12:52228181-52228203 TTCTTTATATTTTGAAGAGATGG 0: 1
1: 2
2: 136
3: 2765
4: 29324
1096528423_1096528430 21 Left 1096528423 12:52228139-52228161 CCCTCCTCCTTCTTCTTCTCCTT 0: 3
1: 22
2: 241
3: 1400
4: 5509
Right 1096528430 12:52228183-52228205 CTTTATATTTTGAAGAGATGGGG 0: 1
1: 2
2: 172
3: 3203
4: 20959
1096528423_1096528429 20 Left 1096528423 12:52228139-52228161 CCCTCCTCCTTCTTCTTCTCCTT 0: 3
1: 22
2: 241
3: 1400
4: 5509
Right 1096528429 12:52228182-52228204 TCTTTATATTTTGAAGAGATGGG 0: 1
1: 3
2: 146
3: 2808
4: 22671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096528423 Original CRISPR AAGGAGAAGAAGAAGGAGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr