ID: 1096529789

View in Genome Browser
Species Human (GRCh38)
Location 12:52235310-52235332
Sequence TCCGCAGCTCCGCCTCCAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096529789_1096529792 -8 Left 1096529789 12:52235310-52235332 CCGCCTGGAGGCGGAGCTGCGGA 0: 1
1: 0
2: 2
3: 19
4: 188
Right 1096529792 12:52235325-52235347 GCTGCGGAGCATGCAGGATGTGG 0: 1
1: 0
2: 1
3: 14
4: 214
1096529789_1096529794 -2 Left 1096529789 12:52235310-52235332 CCGCCTGGAGGCGGAGCTGCGGA 0: 1
1: 0
2: 2
3: 19
4: 188
Right 1096529794 12:52235331-52235353 GAGCATGCAGGATGTGGTGGAGG 0: 1
1: 1
2: 2
3: 45
4: 391
1096529789_1096529793 -5 Left 1096529789 12:52235310-52235332 CCGCCTGGAGGCGGAGCTGCGGA 0: 1
1: 0
2: 2
3: 19
4: 188
Right 1096529793 12:52235328-52235350 GCGGAGCATGCAGGATGTGGTGG 0: 1
1: 0
2: 2
3: 29
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096529789 Original CRISPR TCCGCAGCTCCGCCTCCAGG CGG (reversed) Exonic
900145602 1:1157611-1157633 CCAGCAGCTCCGCCTCCTCGGGG - Intergenic
900244285 1:1630338-1630360 TCTGCAGCTCCTCCACCAGCTGG - Exonic
900385484 1:2408697-2408719 CCTGCAGCTCCTGCTCCAGGGGG + Exonic
901697737 1:11021679-11021701 TCCTGGGCTCAGCCTCCAGGGGG + Intronic
902449307 1:16486502-16486524 CCCGCAGCTGCTCCTCCAGCTGG + Intergenic
902449983 1:16490866-16490888 TCTGCGGCTCCTCCTCCAGCCGG + Intergenic
902468701 1:16633217-16633239 CCCGCAGCTGCTCCTCCAGCTGG + Intergenic
902504479 1:16930324-16930346 TCTGCTGCTCCTCCTCCAGCCGG - Exonic
902505441 1:16936775-16936797 CCCGCAGCTGCTCCTCCAGCTGG - Exonic
902624556 1:17668982-17669004 GCAGCAGCCCCGGCTCCAGGCGG - Intronic
903700814 1:25247107-25247129 GCCGTGGCTCCGCCTCCCGGAGG - Intronic
904806448 1:33135692-33135714 TCAGCAGAACCTCCTCCAGGAGG + Intergenic
907272432 1:53298769-53298791 TCCACAGCTCCGCCTCCCTTGGG + Intronic
912910984 1:113759120-113759142 GCCGCATCTTCCCCTCCAGGCGG + Exonic
914950328 1:152108392-152108414 ACAGCAGCTGCGCCGCCAGGAGG - Exonic
915037489 1:152941205-152941227 TCTGCAGTTCTGCCTCCAGGAGG - Intergenic
919742678 1:200990293-200990315 TCCGCAGTGCCTCCTGCAGGAGG + Exonic
919743214 1:200992766-200992788 TCTGCAGCTCAGCCTTCAGCAGG - Intronic
919804799 1:201375217-201375239 TGCCCAGCTGCCCCTCCAGGTGG + Intronic
920367334 1:205455148-205455170 GCCAGAGCTCCTCCTCCAGGTGG + Intronic
920418269 1:205813013-205813035 GCCGCCGCTCCGCTTCCACGCGG + Exonic
1063371428 10:5525214-5525236 CCCGCAGCTCGGCCTCCGTGGGG - Exonic
1064127995 10:12681037-12681059 TCCCCAGCTCTGCAGCCAGGAGG + Intronic
1065605434 10:27413645-27413667 ACCGCTTCTCCGCCTCCAGGAGG - Exonic
1073320822 10:102615441-102615463 CACCCAGCTCAGCCTCCAGGGGG + Intronic
1075600923 10:123768579-123768601 TCCGCGTCTCCTCCACCAGGTGG + Exonic
1076560207 10:131357840-131357862 TCAGCAGCTCCACCTCCTGAAGG + Intergenic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1077103065 11:830647-830669 TCTGCAGCTCCAGCTCCAGACGG - Exonic
1077141309 11:1026126-1026148 TCCACAGCTCCTGCTCAAGGGGG - Exonic
1077205100 11:1338258-1338280 TCCCCAGCTCAGCCTGCAGGAGG + Intergenic
1079520161 11:21316827-21316849 TCCCCAGCTCTACCTCCAGGAGG - Intronic
1080873991 11:36260274-36260296 TCCCCAGCTCAGCCTCCCCGGGG + Intergenic
1082817040 11:57515737-57515759 TCCGGAGCTGCGCCCCGAGGTGG + Exonic
1083678576 11:64341090-64341112 TCTGCCTCTCTGCCTCCAGGAGG + Exonic
1083678962 11:64342608-64342630 GCCTCAGCTCCTCCTGCAGGCGG - Exonic
1084089417 11:66870340-66870362 TCCGAAGCTGCGGGTCCAGGTGG + Exonic
1087157291 11:94917885-94917907 TCCGCAGCTCAGCTCCCTGGAGG - Intergenic
1087296964 11:96389409-96389431 TCCGTCACTCTGCCTCCAGGAGG + Intronic
1089760273 11:120717862-120717884 CCAGCTGCTCAGCCTCCAGGAGG - Intronic
1091222334 11:133936775-133936797 TCCCCAGCCCTGCCTCCTGGAGG - Intronic
1094375382 12:29783683-29783705 CCCGCAGCCCCGCCGCCGGGAGG + Exonic
1096214223 12:49790878-49790900 TCCCCAGCTCCCTCTCCAAGGGG + Intergenic
1096529789 12:52235310-52235332 TCCGCAGCTCCGCCTCCAGGCGG - Exonic
1096565141 12:52472100-52472122 TTCTCAGCTCCGAGTCCAGGCGG + Exonic
1097232251 12:57520023-57520045 TCCGCCGCTTCGCCACCAGCGGG - Intronic
1098326850 12:69312256-69312278 TCAGCAGCTCAGACTCTAGGGGG - Intergenic
1101090455 12:101280027-101280049 TGCGCAGCCCCGCCTCCTGTAGG + Intergenic
1101789222 12:107912496-107912518 TCCACAGCGCCCCCTGCAGGGGG - Intergenic
1102346355 12:112163580-112163602 TGCGCAGCTCCATCTCCAGTGGG + Exonic
1102989042 12:117301677-117301699 TCCACAGCCCGGCCCCCAGGAGG + Intronic
1103907599 12:124335495-124335517 GCCGCAGCTCCCCCTCCAGGTGG + Exonic
1104891979 12:132144536-132144558 TCGCCAGCACCGCCTCCAGCCGG - Exonic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1105899163 13:24741598-24741620 TCCTCAGCTCCCACCCCAGGGGG - Intergenic
1107388928 13:39942977-39942999 TTCTCAGCTCCGCCTCTAGAGGG - Intergenic
1116916607 14:50532146-50532168 CCCGCAGCTCCGTCTGCACGAGG + Exonic
1117338098 14:54771871-54771893 TCCCCTGCTCCACCTCCAGAAGG - Intronic
1117828423 14:59727053-59727075 TCCAGGGCTCCGTCTCCAGGGGG + Exonic
1118617006 14:67580799-67580821 TCCGCAGGTCAGCCTCCTGGTGG + Intronic
1120239534 14:81934001-81934023 TTAGCAACTCCGCCTCCAGTGGG + Intergenic
1121778849 14:96608770-96608792 TCAGCAGCTTGGCCTCCTGGGGG + Intergenic
1122987476 14:105219187-105219209 TCCACAGCTCGGCCTTCACGCGG + Exonic
1123177623 14:106436491-106436513 TCTTCACCTCCACCTCCAGGTGG + Intergenic
1123895857 15:24829320-24829342 TCCAAAGCTCCTCCTCCTGGAGG - Intronic
1125758128 15:42079608-42079630 CCCGCAGCTCCAGCTCCCGGCGG + Exonic
1127403139 15:58612444-58612466 TCAGCAGCTCAGACTCTAGGGGG - Intronic
1128782945 15:70374980-70375002 CCCGCAACACCCCCTCCAGGAGG + Intergenic
1129330290 15:74823652-74823674 CCCGAAGCTCCTCCTGCAGGAGG - Exonic
1129458803 15:75689672-75689694 TGCGCAGCTCAGCCTCCATCAGG + Exonic
1129725003 15:77897220-77897242 TGCGCAGCTCAGCCTCCATCAGG - Intergenic
1131031557 15:89190250-89190272 TCTGGAGCTCCGACACCAGGAGG - Intronic
1131302883 15:91215039-91215061 TCCGGAGCGCTGCCTGCAGGAGG + Intronic
1132178438 15:99733453-99733475 TCCCCAGTCCCGCCCCCAGGGGG - Intronic
1132483849 16:180378-180400 GCCGCAGCTTCGCCGCCCGGGGG - Intergenic
1132505158 16:304354-304376 TGCGCTGCACAGCCTCCAGGCGG + Exonic
1132557993 16:580851-580873 GCCACAGCTCCGGCTCCTGGTGG + Exonic
1132793348 16:1706107-1706129 GCCGCAGCCGCGCCGCCAGGGGG - Intergenic
1132838123 16:1964879-1964901 TCCGCAGCCCCGCCCCAAGCGGG + Intergenic
1133763449 16:8818631-8818653 CCAGCAGCACAGCCTCCAGGAGG + Intronic
1137392209 16:48091261-48091283 TCTGCAGCTCCCCGTTCAGGAGG + Intronic
1138537593 16:57668110-57668132 TCAGCAGCTCCCTCTGCAGGTGG + Intergenic
1139504789 16:67393461-67393483 TCCGCAGCTCCGCTCCCTGCCGG + Intronic
1139514146 16:67443505-67443527 TCCACAGCTGCCCCTCCAGAAGG - Intronic
1139655115 16:68382745-68382767 TCCCCAGCTGCCCCTCCTGGAGG - Intronic
1140263463 16:73400469-73400491 TCCACAGCTCGGTCTCCACGGGG + Intergenic
1141461206 16:84179741-84179763 CCAGCAGCTCCGCCCCCAGGTGG - Exonic
1142204754 16:88777698-88777720 TACGCAGCTCAGCCACCACGCGG - Intronic
1143471154 17:7177050-7177072 CCCGCAGCTCCTCCTGCAGCTGG + Exonic
1143648491 17:8248042-8248064 GCCGGAGCTCCGCCCCCGGGAGG + Exonic
1145207226 17:20991065-20991087 TCCCCAGCTCTGCCACAAGGAGG + Intergenic
1145912893 17:28552633-28552655 TCCGCAGCCCCGCCCCCGGCCGG + Exonic
1146910886 17:36647751-36647773 TCAGCAGTGCCACCTCCAGGAGG + Intergenic
1149939745 17:60851269-60851291 TCAGCAGCTCGGGCTGCAGGAGG + Intronic
1151324268 17:73369218-73369240 TCCCCAGCTCAGCCTCCCGTAGG - Intronic
1152586381 17:81191320-81191342 TCAGCAGCCACGCCTCCTGGGGG + Exonic
1153171931 18:2326735-2326757 TCTCCAGCTCCTCATCCAGGGGG + Intergenic
1153187224 18:2499282-2499304 TCCCCACCTCCCCCTTCAGGAGG - Intergenic
1153517068 18:5913588-5913610 TCCGCAGCTTCGCTCCCTGGAGG - Intergenic
1154377357 18:13821281-13821303 TCCGCAGGCCTGCCCCCAGGAGG + Intergenic
1157220854 18:45827634-45827656 TCCCCAGCTCCTCTTCAAGGTGG - Intronic
1157516430 18:48314936-48314958 CCCTCAGCTCCCCCTCCTGGGGG + Intronic
1161250016 19:3275550-3275572 TCCACTGCTCCCCCTCCAGGCGG - Intronic
1161483798 19:4524073-4524095 TCTCCAGCTCTGCCTGCAGGGGG + Exonic
1162036829 19:7944764-7944786 TCAGGAGCTCCCCCTCAAGGTGG + Intergenic
1162062989 19:8108030-8108052 CCTGCTGCTCAGCCTCCAGGTGG + Intronic
1162740229 19:12769883-12769905 GCCGCCGCTGCGCCTCCAGCTGG + Exonic
1162760369 19:12885326-12885348 TGCGCAGATGCGCCTTCAGGTGG + Exonic
1163282590 19:16326320-16326342 TCCCTAGCCACGCCTCCAGGAGG - Intronic
1165812412 19:38619443-38619465 TAAGCATCTCCTCCTCCAGGAGG - Intronic
1167509855 19:49890338-49890360 TCCGCAGCGCCTCCTGCATGTGG + Exonic
1167668378 19:50836112-50836134 CCCGCAGCCCCGCCCCCACGCGG + Intronic
1168105780 19:54164911-54164933 TCAGAGGCTCCGCCCCCAGGTGG + Intronic
926315634 2:11707670-11707692 CCTGCAGCTCCACCTCCAGTGGG - Intronic
926937720 2:18103222-18103244 TCCCCATCTCTGCCTCCAGCAGG - Intronic
931361955 2:61585441-61585463 GCCGCAGCCCCACCTCCAGAAGG + Intergenic
934686382 2:96325140-96325162 TCCGCTGCTCGGCCTCCCTGGGG - Intergenic
941779159 2:169426264-169426286 GCCTCCGCTCCGCCTCCAGCTGG - Intergenic
945188940 2:207166613-207166635 TGCGCCGCGCCCCCTCCAGGAGG - Intronic
946420178 2:219560557-219560579 TCCTCAGCCCAGCCACCAGGGGG - Intronic
947795749 2:232893025-232893047 TCCGGTGCTCCAGCTCCAGGAGG + Exonic
948046799 2:234951788-234951810 GCCGCGGCTCCGGGTCCAGGCGG - Intergenic
1169394049 20:5214295-5214317 TCCCAAGCTCTGCCCCCAGGAGG - Intergenic
1172464033 20:35142209-35142231 TCCCCACCTCACCCTCCAGGAGG + Intronic
1172969755 20:38864873-38864895 TCTGCAGCTCCAGCTCCAGGAGG - Intronic
1173495278 20:43514029-43514051 GCCGCGGCCCCGCCCCCAGGGGG + Exonic
1176055857 20:63148709-63148731 TCAGCAGCACAGGCTCCAGGGGG - Intergenic
1176623391 21:9073097-9073119 TCAGCAGCTCCGTCTCCACATGG + Intergenic
1178144876 21:29727874-29727896 TCCGGGGCTCCGCTTACAGGCGG - Intronic
1179624303 21:42639820-42639842 TCCACAGCACCTCCTCGAGGGGG - Intergenic
1179791018 21:43755979-43756001 TCCGCAGCTCCAGCTGCATGGGG - Exonic
1180033228 21:45226682-45226704 GCTGCAGCTCTGCCTCCACGTGG + Intergenic
1182442743 22:30373701-30373723 TCTGCAGCTGCTCCTCCACGCGG - Exonic
1183270086 22:36856508-36856530 TCCGCAGCGCCACCTAGAGGAGG - Intergenic
1183988792 22:41584339-41584361 GCAGCAGCTCCTCCCCCAGGTGG + Exonic
1184504649 22:44893450-44893472 TCCCCACCTCGGTCTCCAGGAGG + Exonic
1184782939 22:46658179-46658201 TCCGGAGCTCCTCCTCTATGGGG - Exonic
1185039748 22:48497930-48497952 TCTTCAGCCCCGCCTCCAGGTGG - Intronic
1185039762 22:48497965-48497987 TCTTCAGCCCCGCCTCCAGGTGG - Intronic
1185039776 22:48498000-48498022 TCTTCAGCCCCGCCTCCAGGTGG - Intronic
1185039825 22:48498137-48498159 TCTTCAGCCCCGCCTCCAGGTGG - Intronic
1185039874 22:48498274-48498296 TCTTCAGCCCCGCCTCCAGGTGG - Intronic
1185055102 22:48575360-48575382 TCCGCGGCTCCGCGGCCGGGAGG + Intronic
950498909 3:13351968-13351990 TGCGGAGCTCTGCCTGCAGGAGG + Exonic
950518009 3:13480074-13480096 TCGGAAGCTCCGCCCCCTGGCGG - Intronic
950518080 3:13480300-13480322 GCCGCAGCTCCGCGACCGGGCGG - Exonic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
954030939 3:47819478-47819500 CTCACAGCTGCGCCTCCAGGAGG + Intronic
954358252 3:50101028-50101050 TGAGCAGTTACGCCTCCAGGAGG - Intronic
954861596 3:53695171-53695193 TCCCCAGCACCTCCTCCACGGGG - Intronic
962210391 3:133472425-133472447 CCCTGAGCTCCGCCTCCAGCCGG - Exonic
966864515 3:184249844-184249866 GCCGCAGCTCCGGCTCTAGGAGG - Exonic
969426975 4:7130171-7130193 TCAGCAGCTCCACCTCCTGCAGG - Intergenic
973028971 4:45311102-45311124 TCAGCAGCTCAGACTCTAGGGGG - Intergenic
975986026 4:80202344-80202366 GACTCAGCTCCGCCTCCTGGTGG - Exonic
980448185 4:132938779-132938801 TCAGCAGCTCAGACTCTAGGAGG - Intergenic
983930741 4:173450649-173450671 TCTGCAGTTCCTCCTGCAGGAGG - Intergenic
991371746 5:65926177-65926199 TCCTCGGCTCCGGCTCCGGGTGG + Intergenic
992650500 5:78855037-78855059 TCAGCAGCTCAGACTTCAGGAGG + Intronic
997681011 5:135750682-135750704 CCAGCAGCTGCGCCCCCAGGTGG + Intergenic
998253269 5:140566789-140566811 TGAGCAGCTCAGCCTTCAGGTGG + Exonic
999106427 5:149075176-149075198 TCAGCAGCTCAGACTCCAGAGGG - Intergenic
1001950002 5:175809676-175809698 ACCTCAGCTCCTCTTCCAGGTGG + Intronic
1002094732 5:176824120-176824142 GCCGCACCTCCGCCTCCAGGCGG - Intronic
1002451719 5:179322693-179322715 TCGGCAGCTCCGCAGGCAGGTGG + Intronic
1002519051 5:179780508-179780530 TCTGCAGCCCTGCCTCCAGCAGG - Intronic
1002759195 6:188855-188877 TCCGAATTTCAGCCTCCAGGTGG + Intergenic
1004664902 6:17740807-17740829 TCAGCAGCTCAGGCTCTAGGGGG + Intergenic
1006793337 6:36717494-36717516 TCCCCAGCTCCTCCTGCAGCTGG + Intronic
1006839864 6:37021843-37021865 TCTGCAGCTCCAGCTGCAGGGGG + Intronic
1007767104 6:44166999-44167021 CCCACACCTCCGCCCCCAGGGGG - Intronic
1008868810 6:56247583-56247605 TCCCGGGCTCCGCCTCCAGGGGG - Exonic
1011279212 6:85660231-85660253 TCTTCAGCTCCACCTCCATGGGG + Intergenic
1012916919 6:105180106-105180128 TCCGCAGCCCCGCACCCCGGTGG - Intergenic
1013349105 6:109290189-109290211 ACCGCCTCTCCACCTCCAGGAGG - Intergenic
1013454429 6:110317490-110317512 TCCTGAGCTCCACCTCCAGTGGG + Intronic
1013455981 6:110330090-110330112 CCCGCAGTTCAGGCTCCAGGAGG + Intronic
1018887415 6:167951647-167951669 TCTCCCGCTCCTCCTCCAGGCGG - Exonic
1019575421 7:1735430-1735452 TCCCCAGCCCGGCCTCCTGGAGG + Intronic
1023654887 7:42409457-42409479 TCCTCAGACCCGCCTCCAAGGGG - Intergenic
1025004398 7:55343387-55343409 TCCACAGGCACGCCTCCAGGGGG - Intergenic
1025254319 7:57373171-57373193 TCTGCAGCTGCCCCACCAGGTGG + Intergenic
1025875524 7:65477182-65477204 TCCCCATCTCCACCTCCAGCAGG + Intergenic
1026499807 7:70934905-70934927 TCCACACCTCCTCCTCCAGGAGG + Intergenic
1026789883 7:73324631-73324653 AGCGCAGCTCGGCATCCAGGTGG + Exonic
1029305856 7:99619741-99619763 TCGGCAGTTCCGCTACCAGGAGG + Exonic
1032439151 7:131928564-131928586 CCCCCAGCTCCTCTTCCAGGTGG - Intergenic
1034172105 7:149070695-149070717 TGAGCAGCTGCGCCTTCAGGCGG + Exonic
1034269417 7:149796481-149796503 CCAGCAGCTCCACCTGCAGGGGG - Intergenic
1034513388 7:151554035-151554057 CCCTCAGCTCCGCCTCAAGGCGG + Intergenic
1035085198 7:156252283-156252305 TTCCCAGCTCCGCCTCCACCTGG + Intergenic
1035343058 7:158176884-158176906 TCCACACCTGCTCCTCCAGGTGG + Intronic
1036648044 8:10624462-10624484 TCTGCATCACCTCCTCCAGGAGG - Intronic
1040495354 8:47960844-47960866 TACGTGGCTCCGCCTCCGGGAGG - Intronic
1049375994 8:142289447-142289469 TCCCCAGCTCGGTCGCCAGGAGG - Intronic
1053070875 9:35101261-35101283 TCCGCCGCTCTGCCTCCACCTGG + Exonic
1057605728 9:96496709-96496731 TCCGCTGCACCTCCTCCAGCGGG - Intronic
1060970449 9:127734746-127734768 TCGGCAGCGCCCCCACCAGGCGG + Intronic
1060978731 9:127780348-127780370 ACAGCAGCTCCCCCTCCATGGGG + Intergenic
1062430656 9:136525579-136525601 GCCGCAGCCCCGCACCCAGGTGG - Intronic
1062585143 9:137245816-137245838 TCCGCAGCTGCGCTACCAGGTGG - Exonic
1062718353 9:138022485-138022507 TCCCCATCGCTGCCTCCAGGAGG - Intronic
1062727474 9:138083742-138083764 TCAGCAGCTCAGACTCCAGGGGG - Intronic
1203746574 Un_GL000218v1:43525-43547 TCAGCAGCTCCGTCTCCACATGG + Intergenic
1203563536 Un_KI270744v1:75955-75977 TCAGCAGCTCCGTCTCCACATGG - Intergenic
1185455391 X:307829-307851 TCTGGAGCTCCGCCTCGGGGTGG + Exonic
1185476556 X:419060-419082 TCCCCAGGGCCGCCTCCAAGAGG + Intergenic
1190291192 X:48993470-48993492 TCAGCAGCTCCCCATCCACGAGG + Exonic
1197981258 X:132219437-132219459 TCCCCAGCTCTGGCTCCAGCTGG + Intronic
1201159902 Y:11158539-11158561 TCAGCAGCTCCGTCTCCACATGG + Intergenic