ID: 1096530265

View in Genome Browser
Species Human (GRCh38)
Location 12:52238141-52238163
Sequence AAGCTTAAACTCCTACGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 31}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096530265_1096530269 21 Left 1096530265 12:52238141-52238163 CCTGTCCGTAGGAGTTTAAGCTT 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1096530269 12:52238185-52238207 GCTCAGACACCATCTTCACCTGG 0: 1
1: 0
2: 5
3: 28
4: 226
1096530265_1096530270 22 Left 1096530265 12:52238141-52238163 CCTGTCCGTAGGAGTTTAAGCTT 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1096530270 12:52238186-52238208 CTCAGACACCATCTTCACCTGGG 0: 1
1: 0
2: 2
3: 23
4: 247
1096530265_1096530271 23 Left 1096530265 12:52238141-52238163 CCTGTCCGTAGGAGTTTAAGCTT 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1096530271 12:52238187-52238209 TCAGACACCATCTTCACCTGGGG 0: 1
1: 0
2: 1
3: 11
4: 185
1096530265_1096530267 -7 Left 1096530265 12:52238141-52238163 CCTGTCCGTAGGAGTTTAAGCTT 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1096530267 12:52238157-52238179 TAAGCTTGAGAAAGTGCAGCTGG 0: 1
1: 0
2: 4
3: 8
4: 182
1096530265_1096530268 -1 Left 1096530265 12:52238141-52238163 CCTGTCCGTAGGAGTTTAAGCTT 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1096530268 12:52238163-52238185 TGAGAAAGTGCAGCTGGAAGAGG 0: 1
1: 0
2: 3
3: 47
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096530265 Original CRISPR AAGCTTAAACTCCTACGGAC AGG (reversed) Intronic
914827800 1:151147631-151147653 AAGAATAAACTACTACAGACAGG + Intergenic
915394256 1:155570286-155570308 AAACTTAAACTACTATGGAAGGG - Intergenic
920966797 1:210707735-210707757 AAGATGAAACTCCTACAGCCAGG + Intronic
1064426205 10:15231866-15231888 GATCTTAAACTCCTAGGCACAGG - Intronic
1065750719 10:28884554-28884576 AATATTAAACTCCTTCGGCCTGG - Intergenic
1074962318 10:118458302-118458324 AACCATAAACTCCTAGGCACAGG + Intergenic
1079213953 11:18489314-18489336 AGCCTTAAACTCCTACGCTCAGG + Intronic
1085382481 11:76132887-76132909 AAACTTAAGATCCTAGGGACTGG + Intronic
1090692046 11:129194138-129194160 CAGTTTAAACTCCCACTGACAGG - Intronic
1095567796 12:43646788-43646810 AAGCTTAGCCTCCTTTGGACAGG - Intergenic
1096530265 12:52238141-52238163 AAGCTTAAACTCCTACGGACAGG - Intronic
1131813390 15:96197620-96197642 AACCTTAAACTCCTAGGTTCAGG - Intergenic
1137980317 16:53063913-53063935 AAGCTTAAACTCCTAGGCTCTGG + Intronic
1145779646 17:27553793-27553815 CAGCTTCAGCTCCTACAGACTGG + Intronic
1145979150 17:29001671-29001693 AAGCTAAAACTCCTTTGGCCTGG + Intronic
1160088599 18:75804085-75804107 AAGAGTAAACTCCCAGGGACTGG + Intergenic
931630410 2:64293438-64293460 TAGCTTCAATTCCTAAGGACTGG - Intergenic
944879322 2:203995273-203995295 AAGCCCAAACTCCTATGAACTGG + Intergenic
949069323 2:242013888-242013910 AAGCTGAACCTCCTGCCGACAGG + Intergenic
1170316825 20:15051444-15051466 AAGCTTAAACTCCATAGGGCAGG + Intronic
958115547 3:89212075-89212097 AAGCTTAAACTGATAAGGAGTGG + Intronic
961694158 3:128692545-128692567 AACCTTAAACTCCTAGGCTCTGG + Intergenic
968143971 3:196282223-196282245 AAGCTTATACTTCTTCGGCCTGG + Intronic
972350083 4:38228663-38228685 AAGCATAAACTCATAAGGACAGG + Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
982568551 4:157019012-157019034 AAGCTTAAATTCATAAGGAGGGG - Intergenic
987864069 5:23518602-23518624 AAGCTGAAACTCCTCAGGGCTGG - Intronic
988819722 5:34869640-34869662 AAGCCTAAATTCCTCCTGACAGG - Intronic
999808132 5:155102775-155102797 AAGCATAAGGTCCTACGGAATGG + Intergenic
1002952374 6:1826983-1827005 AACCTTGAACTCCTACGCTCAGG - Intronic
1008323846 6:50152232-50152254 AAGGTTAAGCTCCTACTGACAGG + Intergenic
1037718484 8:21420713-21420735 GAGCTTTAACTCCTGCGGTCAGG + Intergenic
1038979390 8:32740649-32740671 AAGCTTAAACACATACTCACAGG + Intronic
1042312764 8:67395273-67395295 AACCTTCAACTCTTAAGGACAGG + Intergenic
1047660407 8:127027597-127027619 AAGATTAAACTCCTACATACTGG - Intergenic
1051478326 9:17532756-17532778 AAGCTGAAACTCCTAGGGTGTGG - Intergenic