ID: 1096530459

View in Genome Browser
Species Human (GRCh38)
Location 12:52239487-52239509
Sequence GTCCAGAAGGGATAAAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 204}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096530459_1096530473 18 Left 1096530459 12:52239487-52239509 CCTGCCCTTTATCCCTTCTGGAC 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1096530473 12:52239528-52239550 CTAAGGATTCGGGAGGAGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 135
1096530459_1096530466 -5 Left 1096530459 12:52239487-52239509 CCTGCCCTTTATCCCTTCTGGAC 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1096530466 12:52239505-52239527 TGGACTCAGGAATTCAGGACAGG 0: 1
1: 0
2: 3
3: 58
4: 448
1096530459_1096530467 1 Left 1096530459 12:52239487-52239509 CCTGCCCTTTATCCCTTCTGGAC 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1096530467 12:52239511-52239533 CAGGAATTCAGGACAGGCTAAGG 0: 1
1: 0
2: 3
3: 41
4: 660
1096530459_1096530470 11 Left 1096530459 12:52239487-52239509 CCTGCCCTTTATCCCTTCTGGAC 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1096530470 12:52239521-52239543 GGACAGGCTAAGGATTCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 93
1096530459_1096530475 20 Left 1096530459 12:52239487-52239509 CCTGCCCTTTATCCCTTCTGGAC 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1096530475 12:52239530-52239552 AAGGATTCGGGAGGAGGTGGGGG 0: 1
1: 0
2: 2
3: 49
4: 504
1096530459_1096530468 7 Left 1096530459 12:52239487-52239509 CCTGCCCTTTATCCCTTCTGGAC 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1096530468 12:52239517-52239539 TTCAGGACAGGCTAAGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 187
1096530459_1096530469 8 Left 1096530459 12:52239487-52239509 CCTGCCCTTTATCCCTTCTGGAC 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1096530469 12:52239518-52239540 TCAGGACAGGCTAAGGATTCGGG 0: 1
1: 0
2: 2
3: 15
4: 132
1096530459_1096530465 -10 Left 1096530459 12:52239487-52239509 CCTGCCCTTTATCCCTTCTGGAC 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1096530465 12:52239500-52239522 CCTTCTGGACTCAGGAATTCAGG 0: 1
1: 1
2: 2
3: 40
4: 239
1096530459_1096530471 14 Left 1096530459 12:52239487-52239509 CCTGCCCTTTATCCCTTCTGGAC 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 101
1096530459_1096530474 19 Left 1096530459 12:52239487-52239509 CCTGCCCTTTATCCCTTCTGGAC 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1096530474 12:52239529-52239551 TAAGGATTCGGGAGGAGGTGGGG 0: 1
1: 0
2: 2
3: 15
4: 249
1096530459_1096530472 17 Left 1096530459 12:52239487-52239509 CCTGCCCTTTATCCCTTCTGGAC 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1096530472 12:52239527-52239549 GCTAAGGATTCGGGAGGAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096530459 Original CRISPR GTCCAGAAGGGATAAAGGGC AGG (reversed) Intronic
900196131 1:1376484-1376506 GTGCAGCAGGGGTGAAGGGCGGG - Intergenic
900432271 1:2607936-2607958 GCCCACTGGGGATAAAGGGCTGG + Intronic
900616695 1:3568690-3568712 GTCAGGAGGGGCTAAAGGGCTGG - Intronic
900647467 1:3715426-3715448 GCCCAGCAGTGACAAAGGGCTGG + Intronic
900839447 1:5036113-5036135 GCCCAGAGGGGATGAATGGCAGG - Intergenic
901131248 1:6963320-6963342 GGCCAAAAGGGATGGAGGGCGGG - Intronic
901545624 1:9954503-9954525 GTCAAAAAGTGATACAGGGCTGG - Intronic
901780922 1:11594052-11594074 GGCCAGAAGGGACACAGGGAGGG - Intergenic
902140416 1:14349201-14349223 GTCCAGGAGGGATACATGGCTGG + Intergenic
903557175 1:24202493-24202515 GTGCAGATGGAATAAAAGGCAGG + Intergenic
903763357 1:25715256-25715278 GTCCAGAGGGATGAAAGGGCTGG + Intronic
904418653 1:30377653-30377675 GCCCAGTAGGGTTAAGGGGCTGG + Intergenic
904990124 1:34585823-34585845 GTCAGGCAGGGATAAATGGCAGG - Intergenic
905167538 1:36091817-36091839 GTGCAGAAGGTATTCAGGGCGGG + Exonic
905234870 1:36539120-36539142 GTCCAGATGGGAGGAAGGGTGGG - Intergenic
905581968 1:39089075-39089097 GGACAGAAGGGAGAAAAGGCCGG + Intronic
905665676 1:39761635-39761657 GGCCAGCAGGGAGAAGGGGCTGG - Intronic
906416475 1:45623944-45623966 CTGCAGAAGGGATCAAGGGCAGG + Exonic
908122918 1:61002805-61002827 GTACAGCAGAGAGAAAGGGCTGG - Intronic
908406348 1:63817712-63817734 CTCGAGAAGGGTTAAAGGGAGGG + Intronic
908850193 1:68368074-68368096 GTCCAGAGGTGATACAGGGAAGG - Intergenic
909591064 1:77350218-77350240 GGCCAGGAAGAATAAAGGGCAGG + Intronic
910547076 1:88430730-88430752 GTCCAGATGGGAAATAAGGCTGG - Intergenic
912519832 1:110237765-110237787 GCCCATCAGGGATATAGGGCAGG + Intronic
914246613 1:145890996-145891018 GACCAGAAAGTATAAAGGTCTGG - Intergenic
914844243 1:151272506-151272528 GTAAAGAAGTGAAAAAGGGCAGG - Intergenic
916533931 1:165685478-165685500 GTCCAGAAGGAAAAAATGGAGGG + Intronic
917659220 1:177161622-177161644 GGCTTGGAGGGATAAAGGGCTGG + Intronic
917728434 1:177849876-177849898 CAGCAGAAAGGATAAAGGGCAGG + Intergenic
919924094 1:202183364-202183386 CTCCTGCAGGGATCAAGGGCAGG - Intergenic
920780333 1:208984795-208984817 GTCCAGAGGGTATAAAGTCCTGG - Intergenic
921930605 1:220751452-220751474 GTGCAGAAGAAATAAAGGACTGG - Intronic
922793349 1:228323069-228323091 AGGCAAAAGGGATAAAGGGCTGG - Intronic
1063837772 10:10035241-10035263 GAACAGAAGGCATAAAGGCCTGG + Intergenic
1065569415 10:27054661-27054683 GACTAAAAGGGGTAAAGGGCAGG + Intronic
1067729941 10:48803406-48803428 GTCCAGAACAGAGACAGGGCAGG + Intronic
1070253928 10:74797873-74797895 GTCTAGAAGGGAGGCAGGGCAGG - Intergenic
1071962086 10:90816945-90816967 GGCCAGATGGCATAGAGGGCAGG - Intronic
1072280870 10:93864059-93864081 GGCCTGAAGGGATAAGGGGGAGG - Intergenic
1074449717 10:113549335-113549357 GCCCAGAAAGGATAAATGACTGG + Intergenic
1074900998 10:117816503-117816525 GTTCAGAAGGGAAAAAAGGCAGG - Intergenic
1079609625 11:22415763-22415785 TTCCAGAAGGGGAAAAGAGCTGG + Intergenic
1088515755 11:110631701-110631723 ATCCAGAAGGGAAGGAGGGCAGG - Intronic
1089096047 11:115920930-115920952 GTCAAGCAGGGATACTGGGCTGG + Intergenic
1090940611 11:131384927-131384949 GTCCAGATGGCAGAAAGGCCTGG - Intronic
1091002081 11:131918160-131918182 TTCCAGAAGGGTGAGAGGGCCGG + Intronic
1091689834 12:2588356-2588378 GACCACTAGGGAGAAAGGGCCGG + Intronic
1096530459 12:52239487-52239509 GTCCAGAAGGGATAAAGGGCAGG - Intronic
1098228278 12:68347061-68347083 GTGCAGTAGGGAGACAGGGCAGG - Intergenic
1098514490 12:71358386-71358408 GGCCAGTAGGGATATAGGGTGGG - Intronic
1098645282 12:72892965-72892987 GTCTAGGAGGGAGACAGGGCAGG + Intergenic
1099099613 12:78422308-78422330 ATCCAGATGGGATAAAGGGAAGG + Intergenic
1101040417 12:100749869-100749891 GTCCAAAAGGGATAATGCGAGGG + Intronic
1102597582 12:114004686-114004708 GACCAGAAGGGACCAAGGGGAGG - Intergenic
1103232203 12:119340751-119340773 GACCTGAAGAGATAAATGGCGGG + Intronic
1104523555 12:129497441-129497463 GGCCTGGAGGGATAAAGGGAGGG - Intronic
1106376408 13:29192893-29192915 GTCCAGAATGGATGAAAAGCAGG + Intronic
1109485416 13:63011941-63011963 GTGCAGAAGAGATAAAGGAAGGG + Intergenic
1110176527 13:72562630-72562652 GTCCAGAAAGGTTAGATGGCCGG - Intergenic
1110230423 13:73162043-73162065 ATCTAAAAGGGAGAAAGGGCTGG + Intergenic
1111558364 13:89910716-89910738 CACCAGCAGGGACAAAGGGCTGG + Intergenic
1112294375 13:98173777-98173799 GTCCAGACAGGATAAAGTGCCGG + Intronic
1113496682 13:110735899-110735921 GTCAAGAAGAGATAGAGGCCAGG - Intergenic
1114746367 14:25152442-25152464 GTGCATAAAGGACAAAGGGCAGG - Intergenic
1118411764 14:65486989-65487011 TTCCAGAAGGGCAACAGGGCAGG - Intronic
1118734277 14:68690809-68690831 TCCCAGAAGGGAGGAAGGGCTGG - Intronic
1119098423 14:71856059-71856081 GACCAGAAGAGAGAAAGGACTGG + Intergenic
1121243589 14:92447280-92447302 GTCCAGAAGTGGGGAAGGGCGGG - Intronic
1121904910 14:97730821-97730843 GACCAGAATCCATAAAGGGCCGG - Intergenic
1123709743 15:22979124-22979146 GGCCAGTAGGGATATAGTGCCGG - Intronic
1124155816 15:27224461-27224483 GTGCAGGTGGGAGAAAGGGCAGG - Intronic
1126303855 15:47231687-47231709 CTCCTGAAGGGATAAACTGCTGG - Intronic
1126555610 15:49984488-49984510 AGCCAGAAGGGATGAAGGGAAGG + Intronic
1127335300 15:57978710-57978732 GCCCAGAAGGGGAGAAGGGCTGG + Intronic
1127670355 15:61188709-61188731 GTCCACAATGGAGAGAGGGCAGG + Intronic
1127714937 15:61640750-61640772 TTACAGAAGGGGCAAAGGGCAGG + Intergenic
1129144421 15:73633780-73633802 GTCCAGAAGGAAGAAACAGCAGG - Intronic
1129413910 15:75364286-75364308 GACCAGCAGGGAAAAAGGGTTGG - Intronic
1129676725 15:77635618-77635640 GTCCAGCAGGCACAAAGGCCTGG - Intronic
1133219231 16:4311955-4311977 GTCCAGTAGAGAGAAAGAGCTGG + Intergenic
1133419588 16:5634786-5634808 GTCCAGATGGCATAAATGGTGGG + Intergenic
1135853711 16:25987482-25987504 TTCCAAAACGGATAAATGGCTGG + Intronic
1135961510 16:26998372-26998394 GTCCTGAATGGAGAAAGGCCAGG + Intergenic
1139379888 16:66523956-66523978 CCACAGAAGGGATAAAGGGAAGG - Intronic
1139469610 16:67171027-67171049 CCCCAGACAGGATAAAGGGCAGG + Intronic
1140112519 16:72016145-72016167 GAGCAGAAAGGAAAAAGGGCAGG + Intronic
1141581020 16:84998726-84998748 GTTCAGAAGGGATTGAGAGCTGG - Intronic
1141621139 16:85237027-85237049 TTCCAGAAAGAATAATGGGCTGG + Intergenic
1142715638 17:1745507-1745529 GGCCAGAAGGGAGAGAGGGTGGG + Intronic
1143515549 17:7417701-7417723 GGCCCGAAGGGATGAAGGGAGGG - Exonic
1143788611 17:9275541-9275563 GTCCAGATGGGTTAAATGGCTGG - Intronic
1144034642 17:11354366-11354388 GTGTAGAAGGGAGAAAAGGCAGG - Intronic
1147009978 17:37437750-37437772 GTCCAGCTGGGATCAAGGACAGG - Exonic
1147017260 17:37502256-37502278 GTCCAGAAGGTCAAAGGGGCAGG - Intronic
1151814235 17:76463280-76463302 TTCCAGAAGGGAGAAATGGGTGG - Intronic
1153412527 18:4809898-4809920 CTCCAGAGGGAAGAAAGGGCCGG - Intergenic
1156485564 18:37463592-37463614 GTCCAGGAGGGAACAGGGGCAGG - Intronic
1160861933 19:1240939-1240961 CTCCAGATCGGATAAAGTGCTGG + Intergenic
1161836513 19:6650958-6650980 CTCCAGAAGTGAGAAAAGGCAGG + Intergenic
1162523576 19:11195263-11195285 GCGCAGTAGGGATAGAGGGCCGG + Intronic
1164235820 19:23333011-23333033 TTCCAGAAGTGAAAAAGGGTGGG + Intronic
1164454611 19:28396826-28396848 GCCCAGAAGTGATGCAGGGCAGG - Intergenic
1164739431 19:30565436-30565458 GTCCAGAAGTGCTGAAGGCCTGG - Intronic
1165846401 19:38820690-38820712 GGCCAGAAGGAAGAAACGGCAGG - Intronic
1166551370 19:43668364-43668386 GTCAGGAAGAGCTAAAGGGCGGG - Intronic
1167305837 19:48708824-48708846 ATGCAGCAGGGATAAAGGGCAGG + Intergenic
1168628825 19:57940916-57940938 GTTCACAAGGGATAAAGGTTAGG - Exonic
925229449 2:2219998-2220020 GTCAAGAAGGGACACAGGACAGG + Intronic
925246271 2:2386240-2386262 GTTCAGAAGGGTTAAATGCCAGG - Intergenic
925785726 2:7430316-7430338 GTCCTGAAAGGATACAGCGCAGG + Intergenic
926125937 2:10271965-10271987 GTGCAGGAGTGATAAAGGGATGG - Intergenic
926269435 2:11354246-11354268 TTCCAGAAGGGAGAAAGGGAGGG + Intergenic
926821020 2:16851839-16851861 GTCAAAAAGGAATAAAGGGAGGG - Intergenic
928400473 2:30974536-30974558 TTCCAGAGGGGACAAAGAGCAGG - Intronic
929311786 2:40434084-40434106 CTAGGGAAGGGATAAAGGGCAGG - Intronic
929788396 2:45007712-45007734 GTCCTGAGGGGTTATAGGGCAGG + Intronic
932707042 2:74034395-74034417 GTGAAGAAGGGAGATAGGGCTGG - Intronic
933611129 2:84436583-84436605 GTCCATAAGGAAAAAAGGGAAGG + Intronic
935631753 2:105217860-105217882 GGCCCGAAGGGATAATGGGCAGG + Intergenic
935901486 2:107798317-107798339 GTCCAAAAAGGATAACAGGCAGG + Intergenic
937225646 2:120367312-120367334 GTCCTGAAGGTCTGAAGGGCAGG + Intergenic
938729820 2:134138378-134138400 GTCCAGAAGGTCTAAAGTGTAGG + Intronic
940165329 2:150764485-150764507 GTCCAGGAGGGAGCAAGGCCAGG - Intergenic
944236178 2:197443317-197443339 TTCCAGAAGGCACAAAGGGAAGG + Intergenic
948056594 2:235013260-235013282 GCACAGAAGGGAGGAAGGGCTGG - Intronic
948583347 2:239003125-239003147 GCCCAGAAGAGCTGAAGGGCTGG + Intergenic
948678314 2:239612032-239612054 GTCCTGCAGGAATGAAGGGCAGG + Intergenic
1171879300 20:30605122-30605144 GCTCAGCAGGGATAGAGGGCAGG + Intergenic
1172356637 20:34284960-34284982 GAGCTGAAGGGGTAAAGGGCTGG - Intronic
1172413631 20:34745414-34745436 GTCCAGAAGGCATTGAGAGCAGG - Intronic
1172791307 20:37507335-37507357 GTCCAGGAGGGATAAGGGTAGGG - Intronic
1174936571 20:54876821-54876843 ATCCAGAAAGGCTAAAAGGCAGG + Intergenic
1175051212 20:56157272-56157294 GGCCAGGATGGATAAAGGTCAGG - Intergenic
1176235523 20:64051824-64051846 GTCCAGATGGGACAAAGTGGGGG + Intronic
1177425689 21:20920611-20920633 GTCCAGAAGACATAAAGGAAGGG + Intergenic
1178043915 21:28672736-28672758 GTCAAGAAGAGAAAAAGAGCAGG - Intergenic
1180863927 22:19105024-19105046 CTCAAGAAGGGACAGAGGGCCGG + Intronic
1181950604 22:26550936-26550958 GTTCAAGAGGGAAAAAGGGCAGG + Intronic
1184542606 22:45138786-45138808 GTCTATAAGGAATAAAGGCCAGG + Intergenic
949106262 3:203609-203631 GTCCTGAAGGGATAATGGGAAGG + Intronic
953013358 3:39049763-39049785 CTCCAGAAGGGATATAGTGATGG - Intergenic
956698620 3:71939618-71939640 GTCCTGAAGGGCTAAAGGGAAGG + Intergenic
961345750 3:126262233-126262255 CTCTAGAAGGGAAAAAGGGAAGG + Intergenic
961827008 3:129604328-129604350 GTCCAGAAGGCAGCAAAGGCTGG + Intronic
963225845 3:142860847-142860869 GTCCAGACTGGATAGAGGGTGGG - Intronic
963503523 3:146158163-146158185 ATCTAGAAGGCAGAAAGGGCAGG + Intronic
964473353 3:157077114-157077136 GTCTACAAGGGAGGAAGGGCTGG + Intergenic
965669286 3:171129923-171129945 GTCCTGAAGAAATAAAGGACAGG - Intronic
965708468 3:171533260-171533282 GTCCAGATGGAATAAAAAGCTGG - Intergenic
967099115 3:186201317-186201339 GGCCAGCAGGGATCATGGGCAGG + Intronic
967933342 3:194706647-194706669 GTCCAGGTGGGATGAAGGCCTGG + Intergenic
968074367 3:195808499-195808521 GTAGAAAAGGCATAAAGGGCCGG - Intronic
968357971 3:198122995-198123017 GTCCAGGAGGGAACAGGGGCTGG + Intergenic
969084470 4:4645663-4645685 GTAAAGAAGTGATAATGGGCTGG - Intergenic
969433051 4:7167196-7167218 GTCCTGAAGGGAGAAGGGCCTGG + Intergenic
970428186 4:15964452-15964474 GTTGAGAAAGGGTAAAGGGCAGG + Intronic
970763921 4:19523803-19523825 AGGCAGAAGGGATAAAGGGGTGG - Intergenic
973721844 4:53731761-53731783 TTCCAGAAGTGAGAAAGGGAAGG + Intronic
975296330 4:72738490-72738512 GTCCAGTAGCTACAAAGGGCTGG - Intergenic
977772312 4:100874207-100874229 GGCCTGAGGGGATAGAGGGCTGG + Intronic
979071405 4:116212594-116212616 GTCTAGAAGTGAGACAGGGCAGG + Intergenic
980285717 4:130776506-130776528 GGCCAGGAGGTTTAAAGGGCAGG - Intergenic
983884306 4:172963231-172963253 GACCAGAAGGAAGTAAGGGCGGG - Intronic
984237699 4:177180811-177180833 GTACAGAATGAACAAAGGGCTGG + Intergenic
984956885 4:185053779-185053801 GCCCAGCAGGGTTAAAGGGGAGG + Intergenic
985648666 5:1097110-1097132 TTCCAGAAGGGATGTAGGCCGGG - Intronic
988715982 5:33828830-33828852 GTGGAGAAGGGGTAAAGGGAGGG + Intronic
990879149 5:60520545-60520567 GTCCAGAAAAGAGAAAGGTCAGG + Intronic
992086215 5:73280690-73280712 GTCCAGAAGAGCTACAGAGCTGG + Intergenic
993025714 5:82643562-82643584 GCCCAGAAAGGAGAAAGGGAAGG + Intergenic
993924000 5:93842973-93842995 GTTTAGAAGGGATGAAGGCCCGG - Intronic
997473140 5:134127800-134127822 GTCCAGAGGAAATCAAGGGCTGG + Intronic
997859571 5:137404272-137404294 CTCCAAAAGGGATCATGGGCTGG + Intronic
998800396 5:145863507-145863529 GACCAGAAATGATAAAAGGCAGG - Intronic
1002036372 5:176473506-176473528 GTACAGAACGGAAACAGGGCAGG - Intronic
1005375038 6:25173296-25173318 GGCCAGAATGGAGAGAGGGCTGG - Intergenic
1006361876 6:33591221-33591243 GTTCAAAAGGGACAATGGGCTGG + Intergenic
1007741537 6:44012802-44012824 GACGAGAAGGCCTAAAGGGCTGG + Intergenic
1008652114 6:53574188-53574210 TTGCAGCAGGGATAAAGGGGGGG + Intronic
1011064898 6:83314813-83314835 GTCCAGAATGGAGCAAGGACAGG - Intronic
1011220653 6:85051353-85051375 GGCCAGGAGGGAGAAAGGGCAGG + Intergenic
1011864861 6:91812997-91813019 GTTCAGAAGAGATCAATGGCAGG - Intergenic
1014517838 6:122400613-122400635 GGCCAGACAAGATAAAGGGCTGG - Intronic
1016389058 6:143557131-143557153 TTCCTGAAGGGTTAAAGGCCAGG + Intronic
1018340655 6:162847621-162847643 GTCCCCAAGGTAAAAAGGGCAGG + Intronic
1019267525 7:126873-126895 GTACAGAAGGGATACAGGTAAGG - Intergenic
1024531634 7:50398420-50398442 GTTCTGAAGGGAGAAGGGGCTGG - Intronic
1026930775 7:74221847-74221869 GCCAAGAAGGGATAGGGGGCGGG + Intronic
1027730729 7:81869271-81869293 GACCAGAAGGGAGAGAGGTCTGG + Intergenic
1028603490 7:92629040-92629062 GTCCAGAAAGGGAGAAGGGCTGG + Intronic
1030445280 7:109641809-109641831 TTAGAGAAGGGATATAGGGCTGG + Intergenic
1031323852 7:120366928-120366950 GTAAAGAAGGGAGAAAGGGAGGG - Intronic
1031761507 7:125718100-125718122 GTCCAAAAGGGAAAAAGAGATGG + Intergenic
1033479475 7:141725323-141725345 GTCCAGAAAAAATAAGGGGCGGG + Intronic
1033529387 7:142247244-142247266 GCCCAGAGAGGATACAGGGCAGG + Intergenic
1035262589 7:157671376-157671398 CGGCAGAAGGGATAAAGGGGAGG + Intronic
1036008279 8:4692145-4692167 TTCCAGAAGGGACAGGGGGCAGG - Intronic
1036422975 8:8614959-8614981 GCCCAGATGGCATAAAGGGGTGG - Intergenic
1039401299 8:37271892-37271914 GTTCAGAAGAGAAAGAGGGCTGG + Intergenic
1039602307 8:38850493-38850515 TTACAGAAGAGAAAAAGGGCCGG + Exonic
1040946895 8:52893722-52893744 CTCAAGAAAGGATAAGGGGCAGG + Intergenic
1045155943 8:99471218-99471240 CAACAGAAGGGATAAATGGCTGG + Intronic
1046110742 8:109721060-109721082 GAGTAGAATGGATAAAGGGCTGG - Intergenic
1046679460 8:117152397-117152419 GAGCAGAAAGGAGAAAGGGCAGG - Intronic
1047514944 8:125545851-125545873 GACAAGAGTGGATAAAGGGCTGG + Intergenic
1047714751 8:127585252-127585274 GACCAGAAAGGACAAAGGCCTGG - Intergenic
1048288476 8:133161619-133161641 GGCCAGAAGGGAAGAAAGGCAGG + Intergenic
1051914099 9:22186781-22186803 GGCCAGAAGAGAGAAAGGCCAGG + Intergenic
1057074750 9:92132600-92132622 CTCCTGCAGGGATCAAGGGCAGG - Intergenic
1062454621 9:136629684-136629706 GCCAAGAAGGGAGAAGGGGCTGG - Intergenic
1185843172 X:3412329-3412351 GGCTTGAAGGGAAAAAGGGCAGG - Intergenic
1189377878 X:40479966-40479988 GGCCAGAAAGGTTAAAAGGCTGG + Intergenic
1190810828 X:53881735-53881757 GTTCAGAAAGAATAATGGGCAGG - Intergenic
1196168150 X:112557216-112557238 AGCCAGAAGAGATAAGGGGCCGG + Intergenic
1199942876 X:152641726-152641748 ATCCCCAAGGGATAAAGGTCTGG + Intronic
1201271034 Y:12253887-12253909 GTTAACAAGTGATAAAGGGCTGG - Intergenic
1201943691 Y:19486827-19486849 GTGCAGAATGGAAAAAGGACAGG + Intergenic