ID: 1096530460

View in Genome Browser
Species Human (GRCh38)
Location 12:52239491-52239513
Sequence CTGAGTCCAGAAGGGATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 211}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096530460_1096530476 29 Left 1096530460 12:52239491-52239513 CCCTTTATCCCTTCTGGACTCAG 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1096530476 12:52239543-52239565 GAGGTGGGGGTGAGTCAATCAGG 0: 1
1: 0
2: 0
3: 13
4: 225
1096530460_1096530469 4 Left 1096530460 12:52239491-52239513 CCCTTTATCCCTTCTGGACTCAG 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1096530469 12:52239518-52239540 TCAGGACAGGCTAAGGATTCGGG 0: 1
1: 0
2: 2
3: 15
4: 132
1096530460_1096530470 7 Left 1096530460 12:52239491-52239513 CCCTTTATCCCTTCTGGACTCAG 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1096530470 12:52239521-52239543 GGACAGGCTAAGGATTCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 93
1096530460_1096530475 16 Left 1096530460 12:52239491-52239513 CCCTTTATCCCTTCTGGACTCAG 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1096530475 12:52239530-52239552 AAGGATTCGGGAGGAGGTGGGGG 0: 1
1: 0
2: 2
3: 49
4: 504
1096530460_1096530466 -9 Left 1096530460 12:52239491-52239513 CCCTTTATCCCTTCTGGACTCAG 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1096530466 12:52239505-52239527 TGGACTCAGGAATTCAGGACAGG 0: 1
1: 0
2: 3
3: 58
4: 448
1096530460_1096530472 13 Left 1096530460 12:52239491-52239513 CCCTTTATCCCTTCTGGACTCAG 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1096530472 12:52239527-52239549 GCTAAGGATTCGGGAGGAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 205
1096530460_1096530468 3 Left 1096530460 12:52239491-52239513 CCCTTTATCCCTTCTGGACTCAG 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1096530468 12:52239517-52239539 TTCAGGACAGGCTAAGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 187
1096530460_1096530473 14 Left 1096530460 12:52239491-52239513 CCCTTTATCCCTTCTGGACTCAG 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1096530473 12:52239528-52239550 CTAAGGATTCGGGAGGAGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 135
1096530460_1096530467 -3 Left 1096530460 12:52239491-52239513 CCCTTTATCCCTTCTGGACTCAG 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1096530467 12:52239511-52239533 CAGGAATTCAGGACAGGCTAAGG 0: 1
1: 0
2: 3
3: 41
4: 660
1096530460_1096530471 10 Left 1096530460 12:52239491-52239513 CCCTTTATCCCTTCTGGACTCAG 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 101
1096530460_1096530474 15 Left 1096530460 12:52239491-52239513 CCCTTTATCCCTTCTGGACTCAG 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1096530474 12:52239529-52239551 TAAGGATTCGGGAGGAGGTGGGG 0: 1
1: 0
2: 2
3: 15
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096530460 Original CRISPR CTGAGTCCAGAAGGGATAAA GGG (reversed) Intronic
902168640 1:14593014-14593036 CTGAGCACTGAAGGGATAAGAGG + Intergenic
903374654 1:22858307-22858329 CTAAGTGCAGTGGGGATAAATGG + Intronic
903594212 1:24481818-24481840 ATGAGTCAAGAAGGACTAAAAGG + Intergenic
905198644 1:36301285-36301307 CTGAGACCAGAAGCCATAAGAGG - Intronic
906348707 1:45038566-45038588 CAGAGTCTGGAAGGGAGAAAAGG + Intronic
906555051 1:46703985-46704007 CTGAGTCCTGAAGGGCAAATAGG - Intronic
907188526 1:52630473-52630495 CCAACTCCAGAAGGGAAAAAAGG - Intergenic
907233526 1:53023640-53023662 CTGGGTCTCGAAGGGAGAAATGG + Intronic
907795349 1:57710693-57710715 CTGAGTGCACAAGAAATAAAGGG - Intronic
908406346 1:63817708-63817730 CTCACTCGAGAAGGGTTAAAGGG + Intronic
908512565 1:64861042-64861064 CTGGGTCCAGATGGGAGAAGAGG + Intronic
908850194 1:68368078-68368100 CAGAGTCCAGAGGTGATACAGGG - Intergenic
912721224 1:112022036-112022058 CTGAGACCTGAAGGGCAAAACGG - Intergenic
915079097 1:153339150-153339172 CTGAGACCTGAATGGAAAAAGGG + Intronic
915740059 1:158112498-158112520 ATGAGTCAGGAAGAGATAAATGG - Intergenic
915842082 1:159221870-159221892 CTCAGGTCAGAAGGTATAAAAGG - Intergenic
916866507 1:168865372-168865394 CTGGGTCATGGAGGGATAAAGGG + Intergenic
918639050 1:186816342-186816364 TTGAGCTCAGAATGGATAAAAGG + Intergenic
919632705 1:199974525-199974547 CTGAGTGAAGAAAGGAGAAAGGG + Intergenic
920283992 1:204866503-204866525 CTGAGTCCAGAAAGGGTAAAAGG + Intronic
920348528 1:205322180-205322202 TTGAGTCCATAAAGGAGAAAGGG + Intergenic
921669912 1:217913857-217913879 ATGAGTCCTGAAGGTAAAAATGG + Intergenic
1064579623 10:16780727-16780749 CTCAGTTCAGAAGGGATTCATGG - Intronic
1065571102 10:27071901-27071923 CTGACTCCAGGAGGGACAGAGGG + Intronic
1067314169 10:45145702-45145724 CTGAGTACAAAAGGGATTAGAGG + Intergenic
1068860671 10:61844861-61844883 CTGAGTCCTGACCTGATAAAAGG - Intergenic
1069960478 10:72076131-72076153 CAGAGACCAGAAGGGATACGAGG + Intronic
1072970942 10:100016962-100016984 CTGATTCCAGAAAGGATTTAAGG + Intergenic
1073722257 10:106185756-106185778 CTGGATCAAGAAGGAATAAAAGG + Intergenic
1074901000 10:117816507-117816529 CCCAGTTCAGAAGGGAAAAAAGG - Intergenic
1078588556 11:12617370-12617392 CTTAGTCCAGTGGAGATAAAGGG - Intergenic
1078996027 11:16700759-16700781 CTCAGGCCTGAAGGGATAAGAGG - Intronic
1080310130 11:30880365-30880387 TTTAGCCCAGAAGGGACAAAAGG - Intronic
1081379097 11:42393157-42393179 ATGATTCCAGAGGGGATAAAGGG - Intergenic
1083937969 11:65880274-65880296 CTGAGCCCAGAAGGTATCACAGG + Exonic
1084399083 11:68933276-68933298 CTGCGCCCAGGAGGGAGAAAGGG - Intronic
1085163673 11:74374745-74374767 CTGAGTCCCCAAAGGAGAAAGGG + Intronic
1086411980 11:86552631-86552653 CTGACTCCAGTAAGGACAAATGG - Intronic
1088426411 11:109709663-109709685 ATGGGTTCAGAAGAGATAAAAGG + Intergenic
1096530460 12:52239491-52239513 CTGAGTCCAGAAGGGATAAAGGG - Intronic
1097417947 12:59336947-59336969 CAGAGTCTAGAGGGGAAAAAGGG - Intergenic
1098723680 12:73934410-73934432 TTCAGTCCAGAAAGGAAAAATGG + Intergenic
1099263807 12:80418274-80418296 CTGTGTCAAGAGGGGAAAAAAGG - Intronic
1100123383 12:91395004-91395026 CAGAGGCCAGGAGGGAAAAATGG + Intergenic
1101187246 12:102292173-102292195 CTGAGTCCAGCAGGGGAAACAGG + Intergenic
1101212074 12:102544602-102544624 ATGGATCCAGAAGGGATAAGGGG + Intergenic
1101846738 12:108368868-108368890 CTGAGACAAGAAGGGAGAAGTGG + Intergenic
1102597584 12:114004690-114004712 CTTAGACCAGAAGGGACCAAGGG - Intergenic
1102989549 12:117305044-117305066 CTGAGTCAGGAAGGGATAGGTGG - Intronic
1103126077 12:118423628-118423650 CTGTTTCCAGAAGCGAAAAATGG - Intergenic
1104523557 12:129497445-129497467 CTGAGGCCTGGAGGGATAAAGGG - Intronic
1104554767 12:129789697-129789719 CAGAGTCCAGATGGGACCAAGGG + Intronic
1106064593 13:26333048-26333070 CTGCGTCCTCAAGGGAGAAAAGG + Intronic
1106634130 13:31508924-31508946 CTCAGGCCAGAAGGGAAAATGGG - Intergenic
1107884751 13:44866040-44866062 CTGAATCCCTAAGGGCTAAAGGG - Intergenic
1108720952 13:53131610-53131632 CTGGGTACAGAAGGGAGAGAAGG - Intergenic
1110270801 13:73587776-73587798 CTGAGCCCAGAAGGGCTTGATGG - Intergenic
1110470555 13:75854960-75854982 CTGAGTACAGATGTGATCAAAGG + Intronic
1112001078 13:95210617-95210639 CTGCCTCCAGAAAGAATAAAAGG + Intronic
1112063946 13:95771419-95771441 CTGACTCCAGCAAGGACAAATGG + Intronic
1112454964 13:99551535-99551557 CAGAGTGCACAAAGGATAAAAGG + Intronic
1112543449 13:100340446-100340468 TTAAGTTCAGAAAGGATAAAAGG + Intronic
1113412509 13:110102560-110102582 CTAAGTGCAGAAATGATAAAAGG + Intergenic
1114598006 14:23930763-23930785 CTGGGTCCAGCAGGGAAGAAAGG + Intergenic
1115864814 14:37733185-37733207 GTAAGTCAAGAAGGGGTAAATGG - Intronic
1117081163 14:52153471-52153493 CTGAGTGATGAATGGATAAAGGG + Intergenic
1117169198 14:53074274-53074296 CTGACACCAAAAGGGAGAAAAGG - Intronic
1117467567 14:56008495-56008517 CAGTGCCCAGAAGGGAAAAATGG + Intergenic
1117748551 14:58897035-58897057 CTGAGTAAATAAGGGATAACTGG - Intergenic
1118166748 14:63344221-63344243 CTTAGTCCAAAAGGAAAAAATGG + Intergenic
1118995270 14:70829965-70829987 CCAAGTCCAGAAGGCAGAAAGGG - Intergenic
1120016482 14:79480036-79480058 CTGACTCCAGTAGGAATAAATGG - Intronic
1123445615 15:20328294-20328316 CTGGGTCCAGAGGGGAAAACTGG + Intergenic
1127541979 15:59949310-59949332 CTGACTACAAAAGGGATATAAGG + Intergenic
1129081358 15:73043920-73043942 CTGAGTCCAGAGCAGTTAAAAGG + Intergenic
1133345096 16:5064625-5064647 CTGTGCCCAGAAGGGAGCAAAGG - Intronic
1134246027 16:12540865-12540887 CTGGGTCCAGAAGTGGAAAAGGG - Intronic
1134864993 16:17598342-17598364 CTGAGTCCAGAATTTACAAAAGG + Intergenic
1136741094 16:32527739-32527761 CTGAGGCCAAAAGTGAAAAATGG - Intergenic
1137033887 16:35552437-35552459 TTGTGTCCATCAGGGATAAATGG + Intergenic
1137531172 16:49280056-49280078 CTGGGTCCAGGAGGGATCAGGGG - Intronic
1137957371 16:52845624-52845646 CTGTGTCCACAATGGACAAATGG - Intergenic
1138774919 16:59709364-59709386 CAGCGTCCCCAAGGGATAAAAGG - Intergenic
1140691799 16:77491837-77491859 CATAGTCCAGAAGGGTTAGAGGG - Intergenic
1141348388 16:83269825-83269847 CAAAGTGCAGAAGGGATTAACGG - Intronic
1142715636 17:1745503-1745525 CAGAGGCCAGAAGGGAGAGAGGG + Intronic
1143747476 17:9004479-9004501 CCGGATCCAGAAGGGATCAAAGG - Intergenic
1147493720 17:40895848-40895870 CTGAGTAGAGAAGGGAGGAAAGG + Intergenic
1149238356 17:54618908-54618930 CTCAGGCCAGCAGGGATAAAGGG - Intergenic
1149444000 17:56699577-56699599 CCGAGGACAGGAGGGATAAAGGG + Intergenic
1149651175 17:58277533-58277555 CAGAGTCCAGAAGGGAAAAAAGG + Intronic
1151279817 17:73064972-73064994 CTGAGAGCAGGAGGGAGAAAGGG - Intronic
1157852580 18:51070077-51070099 CTGAGTCAAGATGGGTTAAGTGG - Intronic
1159634098 18:70784404-70784426 CTCAGTCTAGAAGGGAGAAGTGG + Intergenic
1160134589 18:76261721-76261743 CTGAGTCAAGGAAGGAGAAAAGG + Intergenic
1160881815 19:1324431-1324453 CTGAGTTCAGAAGGGCGAGAAGG + Intergenic
1167736959 19:51300680-51300702 CTGAGTCCTGGAGGAACAAAGGG + Intergenic
926821022 2:16851843-16851865 CTCAGTCAAAAAGGAATAAAGGG - Intergenic
927086347 2:19677131-19677153 GTGTGTCCAGGAGAGATAAAAGG - Intergenic
927335730 2:21921999-21922021 CTGAGTGGAGTAGTGATAAAAGG + Intergenic
932020931 2:68085751-68085773 CTGAATCCAGAAGGAAGAAAAGG - Intronic
932824865 2:74930055-74930077 CTGAGTCCTAAAGTGATCAAAGG + Intergenic
938823962 2:134986308-134986330 CTGTCTTCTGAAGGGATAAATGG + Exonic
938837077 2:135115846-135115868 CTGAGAGCAGCAGGGCTAAATGG + Intronic
939207358 2:139124247-139124269 CTGACTTCAAAATGGATAAAAGG - Intergenic
942965600 2:181889815-181889837 CTGATCCCACAAGGGATAATGGG - Intergenic
943708236 2:191059350-191059372 CTGACACCAGAAGGAATTAAAGG - Intronic
945293787 2:208150647-208150669 CTGACTCCAAAAAGGATGAATGG + Intergenic
945802208 2:214447944-214447966 CTGAGACAAGCAGGGAAAAAGGG - Intronic
946189822 2:218002327-218002349 CTGGGTGTAGAAGGAATAAAAGG + Intronic
947757003 2:232573732-232573754 CTGAGTGTAGAAGGGTTAGAAGG + Intronic
948231221 2:236350948-236350970 CTTCGTCCAGGAGGGATGAAAGG + Intronic
948573766 2:238936671-238936693 CAGAGTCCAGCAGGGAATAAAGG - Intergenic
948773268 2:240263396-240263418 CCTATTCCAAAAGGGATAAATGG - Intergenic
1170734987 20:19006701-19006723 CTGAATCCATAAGGCAGAAAAGG + Intergenic
1170895181 20:20406453-20406475 CTGTGTCCAGAAGGGATTATGGG + Intronic
1172573005 20:35984938-35984960 CTGAGACCCGAAGGGATAGTAGG - Intronic
1172625098 20:36342303-36342325 CGGCCTCCAGAAGGGATAACGGG + Intronic
1172867442 20:38111103-38111125 CTAATTCCAGAAGGGGTAACAGG - Intronic
1174470521 20:50756986-50757008 CTAAGTCTAAAGGGGATAAAAGG - Intergenic
1175598298 20:60253071-60253093 CTGAGTCCAGAATGGGTAATGGG - Intergenic
1177327144 21:19605966-19605988 CTGAGTCTAGGAAGGAAAAATGG - Intergenic
1178898308 21:36578770-36578792 CTGAATCCAGGAAGTATAAAAGG + Intergenic
1179521435 21:41948190-41948212 CTGAGTCCAGATGGGGGAATGGG + Intronic
1181912401 22:26249570-26249592 CTAAGTCCATAATGGATGAATGG - Intronic
1183483302 22:38076390-38076412 CTGAGTCCAGGATGGAAAAAGGG + Intergenic
949264150 3:2137733-2137755 TTGAGTCCAGAAGGGAGATAGGG + Intronic
950277286 3:11673409-11673431 ACGAGTCCGGAAGGGAGAAAGGG + Intronic
953042295 3:39266243-39266265 GTGAGTCCAGAAGGGCAAAGTGG + Exonic
954463699 3:50642174-50642196 CTGTGTCCAGGAGGGATGATAGG + Intronic
956317677 3:67956812-67956834 CTGAGACCCCAAGGTATAAAAGG - Intergenic
958816544 3:98922836-98922858 ATAAGTGCAGAAGGGAGAAAAGG + Intergenic
959961470 3:112303238-112303260 CTGAGCCTTGAAGGGAGAAAGGG + Intergenic
960381874 3:116972583-116972605 GTGAGACCAAAAGGGACAAATGG + Intronic
961531927 3:127545219-127545241 CTGAGGCCTGAATGGAAAAATGG + Intergenic
961573340 3:127816185-127816207 GTGAGTTCAGAAGGGCTACAGGG + Intronic
962865949 3:139448135-139448157 CTGATGCCACAAGGGATAAGGGG - Intergenic
963209029 3:142668210-142668232 CTGAGTCAAGAAGTGATACCCGG + Intronic
964821814 3:160779269-160779291 CTGACTCCAGAAGGCAGAGAAGG + Intronic
966205277 3:177399833-177399855 CAGATTCGAGAAGGGTTAAAGGG - Intergenic
967669233 3:192212651-192212673 TTGAGTCCAGGCAGGATAAAAGG - Intronic
968649373 4:1754346-1754368 CTGAGACCTGAAGGGAGACAGGG + Intergenic
968927866 4:3559377-3559399 CACAGTCCAGAAGGGAGAGAAGG - Intergenic
968938698 4:3626753-3626775 CTGGGTCCTGGAGGGAGAAACGG - Intergenic
969777602 4:9369458-9369480 CAGAGTCCTGAAGAGACAAAGGG - Intergenic
969947597 4:10800341-10800363 CTGAAGCCAGAAGAGAGAAAGGG + Intergenic
970178370 4:13362315-13362337 CTGAGCCCAGAGAGGTTAAATGG + Intronic
975522787 4:75318187-75318209 CTGTGTCCACTAGGGTTAAATGG + Intergenic
976857578 4:89623187-89623209 CTGAGTCCTGAAGGGCAAATGGG - Intergenic
976980972 4:91228690-91228712 CTGATTACAGATGGAATAAATGG + Intronic
978298718 4:107240083-107240105 CTGAGTAAAGTAGGCATAAAAGG + Intronic
978532178 4:109726564-109726586 CTGAGAACAGAAGGGGTCAAGGG - Intronic
979999230 4:127469121-127469143 ATGAGTCTAGAATGAATAAATGG - Intergenic
982107757 4:152025537-152025559 CTTAGGCCTGAAGGGACAAAGGG - Intergenic
983182235 4:164662033-164662055 TTGAGTCTGGAAGAGATAAAAGG - Intergenic
985333581 4:188868242-188868264 CTGAGTCCAGGAGAGAGAAAGGG - Intergenic
986437685 5:7750506-7750528 CTGAGTCCAGAAAGGTGGAATGG - Intronic
988278599 5:29114686-29114708 CAGAATCCAGAAGGGTGAAAAGG - Intergenic
989308721 5:39987894-39987916 CAGAGTCCAGAAGAGAGAATGGG + Intergenic
989710655 5:44392856-44392878 CTGTGTCCAAAAGGGAAAAATGG - Intergenic
989775497 5:45201900-45201922 CTGAGTCCTGAAGAGATCACAGG + Intergenic
990565753 5:57026907-57026929 CTGAATCCAATAGAGATAAAGGG + Intergenic
990738379 5:58888351-58888373 CTGAGCCCAAAAGGAAAAAAGGG - Intergenic
990763426 5:59155802-59155824 CTGAGACCAGAAGGGAGGAAGGG + Intronic
990787597 5:59439811-59439833 CTGACTCAAAAAGGGATAAAAGG + Intronic
992103424 5:73429420-73429442 GGGAGTGCAGAAGGGAGAAAAGG + Intergenic
992750053 5:79853383-79853405 CTGAGACCAGAAGGGGCAATGGG + Intergenic
992865301 5:80951801-80951823 CTGTGGCCAGAAGGGGAAAAAGG + Intergenic
994371965 5:98977755-98977777 CGGAGTCCAGAAAGCATAAATGG - Intergenic
996530996 5:124526780-124526802 GTGAGGCCAGGAGGCATAAAAGG - Intergenic
998782090 5:145669059-145669081 CTGAGTCCAGAAGACATGAAGGG - Intronic
999120734 5:149207362-149207384 CCGAGACCAGAAGGGAGAGAAGG - Intronic
999590139 5:153135986-153136008 CTGAGTCCAGAAGGGCAGACAGG - Intergenic
1001855661 5:175008286-175008308 TTCAGTTCAGCAGGGATAAAGGG - Intergenic
1002461079 5:179374160-179374182 ATGAGGCCAGCAGGGACAAAGGG + Intergenic
1005245016 6:23873493-23873515 CTGAGTCTTGAAGAGAAAAAGGG - Intergenic
1005894723 6:30168283-30168305 CTGAGTCTTCAAGGGATAAAAGG - Exonic
1009342057 6:62568192-62568214 TTGAGGTCAGAAGTGATAAAAGG + Intergenic
1012334623 6:98039899-98039921 CTGATTCCAGAATGCATAATGGG - Intergenic
1012509177 6:99982848-99982870 TTGAGTCCAAAAGGGAGAAAGGG - Intronic
1013859769 6:114621815-114621837 CCGAGATCAGAAGGGATAATTGG - Intergenic
1016172343 6:141033909-141033931 CTGAGTCTTGAAGTTATAAAAGG + Intergenic
1016751777 6:147638076-147638098 CTCAGTCAAGCAGGTATAAATGG - Intronic
1017388991 6:153917637-153917659 CTAATTCAAGAAGAGATAAAGGG - Intergenic
1018534143 6:164801531-164801553 CTCAGGACAGAAGGAATAAAAGG - Intergenic
1019099947 6:169622106-169622128 CTGGGTACATAAGGGACAAATGG - Intronic
1019361543 7:607343-607365 CAAAGTCCAGAGGGGAAAAATGG - Intronic
1022255271 7:28650165-28650187 CTGTGTCCAGAATAGAGAAATGG + Intronic
1022844209 7:34193588-34193610 CTGAAAACAGAAGGGCTAAAGGG - Intergenic
1023613126 7:41991765-41991787 CTGAATTCAGAAGGAAGAAAGGG + Intronic
1023766891 7:43520269-43520291 CTGAGTAAAGGGGGGATAAATGG - Intronic
1026318832 7:69251274-69251296 CAGAGTCCAGAATGAAGAAATGG - Intergenic
1029576428 7:101406558-101406580 CTGAGCCCAGTGGGGGTAAATGG - Intronic
1033766554 7:144498925-144498947 TTAAGTCAAGAAGGCATAAATGG - Intronic
1035065389 7:156100605-156100627 CTGGGTCCAGAAGGGAGAACAGG + Intergenic
1035767731 8:2120303-2120325 GTGAGGCCAGGCGGGATAAATGG + Intronic
1035908031 8:3535355-3535377 CTGAGTCCAGAGGACAGAAATGG + Intronic
1036275042 8:7343412-7343434 CAGAGTCCTGGAGAGATAAAGGG - Intergenic
1036346312 8:7966936-7966958 CAGAGTCCTGGAGAGATAAAGGG + Intergenic
1036422977 8:8614963-8614985 CAGAGCCCAGATGGCATAAAGGG - Intergenic
1036841634 8:12127694-12127716 CAGAGTCCTGAAGAGATAAAGGG + Intergenic
1036863443 8:12373940-12373962 CAGAGTCCTGAAGAGACAAAGGG + Intergenic
1036914603 8:12793206-12793228 CTCATTCCAAAAGGGAGAAATGG + Intergenic
1038646824 8:29369032-29369054 CTGAGTCCAGGAGGGAGAGAAGG + Intergenic
1038869565 8:31479608-31479630 CTGAGCCCAGGAGTGATGAAGGG - Intergenic
1041866729 8:62582573-62582595 GTGAGTCCACAAGGGAACAAGGG + Intronic
1044265943 8:90181290-90181312 CTGACTGCAGAAGAGATAAGGGG - Intergenic
1046343420 8:112889286-112889308 CTGAGTCCAGAGGCAATGAATGG - Intronic
1052067167 9:24036271-24036293 GTGAGTTCTGAAGGGATATATGG + Intergenic
1053802720 9:41774458-41774480 CACAGTCCAGAAGGGAGAGAAGG - Intergenic
1054191025 9:61985804-61985826 CACAGTCCAGAAGGGAGAGAAGG - Intergenic
1054452043 9:65408582-65408604 CTGGGTCCTGGAGGGAGAAACGG + Intergenic
1054462266 9:65471762-65471784 CACAGTCCAGAAGGGAGAGAAGG + Intergenic
1054647343 9:67601913-67601935 CACAGTCCAGAAGGGAGAGAAGG + Intergenic
1054868972 9:70031677-70031699 CTGAAGCCAGAAGGAATAGAAGG - Intergenic
1055756566 9:79564698-79564720 ATGAGACCAGAAAGGTTAAAGGG + Intergenic
1056441614 9:86627597-86627619 CTGGGTCCAGAAGGACAAAATGG + Intergenic
1056508722 9:87282594-87282616 CTAAGTCCAGAAAGAAAAAAAGG - Intergenic
1057764702 9:97906491-97906513 CTGAGTCTAGAAGAGGTTAAAGG - Intronic
1057851529 9:98570393-98570415 CAGATTCCTAAAGGGATAAAGGG - Intronic
1059008085 9:110426091-110426113 GTGAGTCCACAGGGGATAGATGG + Intronic
1060869915 9:127031145-127031167 CTGATTCTAGAAGGGAGACAAGG - Intronic
1062105967 9:134755018-134755040 CTGAGTCAACAAGGCAAAAATGG + Intronic
1186135527 X:6516268-6516290 CAGAGTACACAATGGATAAAGGG + Intergenic
1186482035 X:9903467-9903489 CTCACCCCAGAAGGGATAAACGG + Intronic
1186578631 X:10793348-10793370 CTGAGATCAGAAGGGATGCATGG - Intronic
1187521704 X:20019995-20020017 CTGTGTCCATAAGGGATCCAGGG - Intronic
1187599736 X:20814878-20814900 CTGAGTCCAGAAGGGTAAAGAGG + Intergenic
1191721027 X:64228933-64228955 CTGAGTCCAGAGAGGGTAAGGGG + Intronic
1192123940 X:68483603-68483625 CAAAGACCAGAAGGGAGAAATGG + Intergenic
1193162897 X:78247723-78247745 CTGCTTCCAGAAGGGGAAAATGG + Intergenic
1193470304 X:81893005-81893027 CTGAATCAAGAAGAAATAAATGG + Intergenic
1195336482 X:103859787-103859809 CTGATTCCAAGGGGGATAAAAGG + Intergenic
1196758611 X:119179622-119179644 CTGAGGCCTGAATGGATAGAAGG + Intergenic
1198946142 X:142016622-142016644 CTGATTCTAGAAGGAATACATGG + Intergenic
1199867811 X:151869845-151869867 CTGAGTCTAGAAGTGATAGGAGG - Intergenic
1200363801 X:155639034-155639056 CTTAGTCCAGTAGGGACAAAAGG - Intronic