ID: 1096530461

View in Genome Browser
Species Human (GRCh38)
Location 12:52239492-52239514
Sequence CCTGAGTCCAGAAGGGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 238}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096530461_1096530472 12 Left 1096530461 12:52239492-52239514 CCTTTATCCCTTCTGGACTCAGG 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1096530472 12:52239527-52239549 GCTAAGGATTCGGGAGGAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 205
1096530461_1096530474 14 Left 1096530461 12:52239492-52239514 CCTTTATCCCTTCTGGACTCAGG 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1096530474 12:52239529-52239551 TAAGGATTCGGGAGGAGGTGGGG 0: 1
1: 0
2: 2
3: 15
4: 249
1096530461_1096530470 6 Left 1096530461 12:52239492-52239514 CCTTTATCCCTTCTGGACTCAGG 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1096530470 12:52239521-52239543 GGACAGGCTAAGGATTCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 93
1096530461_1096530475 15 Left 1096530461 12:52239492-52239514 CCTTTATCCCTTCTGGACTCAGG 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1096530475 12:52239530-52239552 AAGGATTCGGGAGGAGGTGGGGG 0: 1
1: 0
2: 2
3: 49
4: 504
1096530461_1096530469 3 Left 1096530461 12:52239492-52239514 CCTTTATCCCTTCTGGACTCAGG 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1096530469 12:52239518-52239540 TCAGGACAGGCTAAGGATTCGGG 0: 1
1: 0
2: 2
3: 15
4: 132
1096530461_1096530476 28 Left 1096530461 12:52239492-52239514 CCTTTATCCCTTCTGGACTCAGG 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1096530476 12:52239543-52239565 GAGGTGGGGGTGAGTCAATCAGG 0: 1
1: 0
2: 0
3: 13
4: 225
1096530461_1096530473 13 Left 1096530461 12:52239492-52239514 CCTTTATCCCTTCTGGACTCAGG 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1096530473 12:52239528-52239550 CTAAGGATTCGGGAGGAGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 135
1096530461_1096530471 9 Left 1096530461 12:52239492-52239514 CCTTTATCCCTTCTGGACTCAGG 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 101
1096530461_1096530466 -10 Left 1096530461 12:52239492-52239514 CCTTTATCCCTTCTGGACTCAGG 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1096530466 12:52239505-52239527 TGGACTCAGGAATTCAGGACAGG 0: 1
1: 0
2: 3
3: 58
4: 448
1096530461_1096530467 -4 Left 1096530461 12:52239492-52239514 CCTTTATCCCTTCTGGACTCAGG 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1096530467 12:52239511-52239533 CAGGAATTCAGGACAGGCTAAGG 0: 1
1: 0
2: 3
3: 41
4: 660
1096530461_1096530468 2 Left 1096530461 12:52239492-52239514 CCTTTATCCCTTCTGGACTCAGG 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1096530468 12:52239517-52239539 TTCAGGACAGGCTAAGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096530461 Original CRISPR CCTGAGTCCAGAAGGGATAA AGG (reversed) Intronic
901686990 1:10948531-10948553 CCTGAGACCAGAAGTGATTCAGG + Exonic
902639567 1:17758169-17758191 CCTGATTTCAGTGGGGATAAGGG + Intronic
903183194 1:21615299-21615321 CCTGACTCCAGGTGGGGTAATGG - Intronic
905324265 1:37139431-37139453 CCTGAGTCAGGAAGGCAGAAAGG + Intergenic
907071001 1:51534825-51534847 CCTGGGTCCAGAGGAGAGAAGGG - Intergenic
907563593 1:55413580-55413602 CTTGGCTCCAGAAGGGTTAATGG - Intergenic
907596823 1:55727778-55727800 CCTTAGGTCAGAAGGGAGAAGGG - Intergenic
907596936 1:55728671-55728693 CCTTAGGTCAGAAGGGAGAAGGG + Intergenic
908646397 1:66282702-66282724 ACTGAGTCTAGAAAGGTTAAAGG - Intronic
912352648 1:109028900-109028922 CCAGAGGCCAGAAGGGAAAGAGG - Intronic
913449297 1:118982129-118982151 CCTGTTTCCAGAAAGGAGAAAGG + Intronic
913943383 1:125130151-125130173 CCTGATTACAGAAGGGAAATGGG + Intergenic
914753194 1:150549454-150549476 CCTGGGCGCAGAAGGGTTAACGG + Exonic
915074268 1:153295918-153295940 CCTGAATCCCTAAGGGAGAAGGG - Intergenic
917015624 1:170528457-170528479 CCTGAGTAAGGAAGGCATAAGGG + Intergenic
919632704 1:199974524-199974546 CCTGAGTGAAGAAAGGAGAAAGG + Intergenic
919907982 1:202091231-202091253 CCCAAATCCAGAAGGAATAATGG - Intergenic
921216261 1:212939139-212939161 TCTGAGTCCAGAAGTGGTAGAGG + Intergenic
1062760009 10:11147-11169 CCAGAGGCCAGACGGGCTAATGG + Intergenic
1064225010 10:13474799-13474821 CCAGAGTCCAAAAGCGATGATGG - Intronic
1065571101 10:27071900-27071922 CCTGACTCCAGGAGGGACAGAGG + Intronic
1067323195 10:45241666-45241688 ACTGAGTCCAGCAGGGGTAGGGG - Intergenic
1067668026 10:48295219-48295241 CCTGAGTTCTCATGGGATAAGGG + Intergenic
1068338855 10:55674759-55674781 CCTGTGTTCACAAGGGATATTGG + Intergenic
1079860537 11:25664703-25664725 CCTGAGACAACAAGGGATTATGG + Intergenic
1080004485 11:27392083-27392105 CCTGACTCTAAAAGGGAAAAAGG - Intronic
1081379098 11:42393158-42393180 AATGATTCCAGAGGGGATAAAGG - Intergenic
1083721523 11:64605988-64606010 CCTCAGCCCAGCAGGGATACAGG + Intergenic
1084399084 11:68933277-68933299 CCTGCGCCCAGGAGGGAGAAAGG - Exonic
1085188150 11:74593527-74593549 CCTGGGTCTAGGAGGGATGAAGG + Intronic
1085532881 11:77202209-77202231 CCAGAGTCCAGAAGGCTTCAGGG + Intronic
1090726292 11:129530259-129530281 GCTGAGTCCAGATGGGATGGTGG - Intergenic
1090938500 11:131366550-131366572 CCTGAGACTAGAATGGAAAATGG + Intergenic
1091703927 12:2681078-2681100 CATGAGGCCAGAGGGGAGAAGGG - Intronic
1091710606 12:2737554-2737576 CATGAGGCCAGAGGGGAGAAGGG - Intergenic
1091713452 12:2759616-2759638 CATGAGGCCAGAGGGGAGAAGGG - Intergenic
1096219577 12:49820661-49820683 CTTGAGTGCAGAAGGCATATTGG - Intronic
1096530461 12:52239492-52239514 CCTGAGTCCAGAAGGGATAAAGG - Intronic
1096847431 12:54415379-54415401 CCTGAGGCCACATGGCATAAAGG + Intronic
1099119986 12:78677223-78677245 CCTAAGTTCAGAATGTATAAAGG - Intergenic
1100826750 12:98481972-98481994 GCGGACTCTAGAAGGGATAATGG + Intergenic
1101212073 12:102544601-102544623 TATGGATCCAGAAGGGATAAGGG + Intergenic
1102625639 12:114233271-114233293 CCTGAGTTTGGAAGGGAGAAGGG - Intergenic
1104320434 12:127745724-127745746 CCTGAGCCCAGGATGGTTAATGG + Intergenic
1104351803 12:128050472-128050494 CCAGAGGCCAGGAAGGATAAGGG + Intergenic
1104523558 12:129497446-129497468 CCTGAGGCCTGGAGGGATAAAGG - Intronic
1104758080 12:131281261-131281283 TCTGAGTCCAGGAGGGTTGAGGG - Intergenic
1106634131 13:31508925-31508947 GCTCAGGCCAGAAGGGAAAATGG - Intergenic
1108872396 13:55003537-55003559 CCTGAATTCAAAAGGGACAAGGG - Intergenic
1111636806 13:90915523-90915545 CCTGAATCAAGAAGTGATACTGG + Intergenic
1113496683 13:110735904-110735926 ACTGAGTCAAGAAGAGATAGAGG - Intergenic
1113719881 13:112547165-112547187 CCTGACTGCAGAAGGACTAAAGG + Intronic
1114049231 14:18907374-18907396 CCTCTCTCCAGAAGGGAAAAGGG - Intergenic
1114113333 14:19494557-19494579 CCTCTCTCCAGAAGGGAAAAGGG + Intergenic
1114115036 14:19612311-19612333 CCTCTCTCCAGAAGGGAAAAGGG + Intergenic
1125099614 15:35896068-35896090 CCTGTGTTCATGAGGGATAATGG + Intergenic
1125716134 15:41821004-41821026 CCTGGGACCAGATGGGATGATGG - Exonic
1126119004 15:45234514-45234536 CCCGAGTCCAGCAGAGACAAAGG + Intergenic
1127008286 15:54594836-54594858 CCCGAGTCCAGAAGAGACAAAGG + Intronic
1127076367 15:55330366-55330388 CCTGCGTGCAGACTGGATAAAGG + Intronic
1129799920 15:78406010-78406032 CCAAAGTCCAGAGGGGAAAAAGG - Intergenic
1130326059 15:82881043-82881065 CCAAAGCCCAGAAGGGAGAAGGG + Intronic
1131879702 15:96849801-96849823 CAGGAGTTTAGAAGGGATAATGG + Intergenic
1132324399 15:100955915-100955937 CCTAAGTTCAGCAGGGATATTGG + Intronic
1133196082 16:4171537-4171559 CCTAAAACCAGAAGGGAGAAGGG - Intergenic
1136044152 16:27602232-27602254 CCTGAGTTGAGAAGGGCTGAGGG - Intronic
1136770568 16:32836225-32836247 CCTGATTACAGAAGGGAAACGGG - Intergenic
1137083137 16:36090837-36090859 CCTGATTACAGAAGGGAAAGGGG - Intergenic
1137531173 16:49280057-49280079 GCTGGGTCCAGGAGGGATCAGGG - Intronic
1137815338 16:51392885-51392907 CCTGAGTCAAGATGAGGTAACGG - Intergenic
1137895265 16:52205330-52205352 CCTCAGTTCAGGAAGGATAAGGG + Intergenic
1138432178 16:56975969-56975991 CCTGAGTTCAGAAGGGAAGAGGG - Intronic
1139184964 16:64795064-64795086 GCTGAGTCCAGAAGAAAGAAAGG - Intergenic
1139431953 16:66915474-66915496 CCGGAGTCCTGATGTGATAATGG - Intronic
1139716516 16:68817831-68817853 CCTGAATCCAGAAGGGTGCAAGG + Intronic
1140691800 16:77491838-77491860 CCATAGTCCAGAAGGGTTAGAGG - Intergenic
1141518716 16:84563435-84563457 GCTGAGTCTAGCAGGGATGATGG - Intergenic
1142259737 16:89037120-89037142 CCTGGGTCCAGAAGGGTCAGCGG - Intergenic
1203072989 16_KI270728v1_random:1098329-1098351 CCTGATTACAGAAGGGAAACGGG - Intergenic
1142650290 17:1345659-1345681 CCTAAGCCAAGAAGGGATTATGG + Intronic
1142686765 17:1581587-1581609 CCTGAGTCCAGATGGCATCTTGG - Intronic
1142715635 17:1745502-1745524 CCAGAGGCCAGAAGGGAGAGAGG + Intronic
1143265879 17:5637102-5637124 CTTGAGTCCAGAAAGGATGCTGG - Intergenic
1145691303 17:26742923-26742945 CCTGATTACAGAAGGGAAAGGGG + Intergenic
1145903729 17:28505311-28505333 CCTGAGTCCAGCTGGGACCAGGG + Intronic
1146722931 17:35136074-35136096 GCTGGGTCTAGAAGGGAGAAGGG + Intronic
1146768210 17:35543232-35543254 CCTGATTAAAGCAGGGATAAGGG + Intergenic
1146971220 17:37073960-37073982 CCTGTGTTCACAAGGGATACTGG + Intergenic
1147017262 17:37502261-37502283 CTTGAGTCCAGAAGGTCAAAGGG - Intronic
1147646837 17:42039396-42039418 CCCGAGTCCAGAAGGGAAAAGGG + Intronic
1148132046 17:45267834-45267856 CCTGAGTGCAGAAGGGCTAGAGG + Intronic
1148556118 17:48579551-48579573 CCTGAGCCCAGAATAGAAAATGG + Exonic
1149238357 17:54618909-54618931 GCTCAGGCCAGCAGGGATAAAGG - Intergenic
1151280242 17:73068563-73068585 CCTCAGTCCATAAGGCAGAACGG + Intronic
1151889968 17:76946169-76946191 CCTGAGTCCCGGAGGGCTACTGG + Intronic
1152952917 18:11500-11522 CCAGAGGCCAGACGGGCTAATGG + Intergenic
1154520837 18:15228024-15228046 CCTGATTACAGAAGGGAAAGGGG - Intergenic
1155018765 18:21874626-21874648 TCTATGTCCATAAGGGATAATGG - Intergenic
1155847393 18:30726188-30726210 TCTGAATCTATAAGGGATAAGGG + Intergenic
1156012454 18:32511071-32511093 CCACAGTCCAGCAGGGATGAAGG - Intergenic
1156749803 18:40438189-40438211 CCTGACTTCAGAAGGTATATGGG + Intergenic
1157108429 18:44796937-44796959 CGGAAGTCCAGAAGGGAAAAGGG - Intronic
1157210890 18:45741015-45741037 CCTGAGGCCAGAGAGGCTAAGGG + Intronic
1157977875 18:52346270-52346292 CCTGAGTCCTGCAATGATAAAGG - Intronic
1159074737 18:63667503-63667525 CCCTAGTCCAGAAGGGCAAATGG - Intronic
1163380039 19:16959988-16960010 CCTGGATGCAGAAGGGATAAAGG + Intronic
1168401247 19:56087328-56087350 CTTGAGTCCGGGAGGGAGAAGGG - Intergenic
928734017 2:34264707-34264729 CCTGTGTCCATCAGGGATATGGG - Intergenic
929432376 2:41898037-41898059 CCTGAGGCCAGTATAGATAAGGG - Intergenic
933992423 2:87643261-87643283 CCTGAGCCCAGAAGGCCCAATGG - Intergenic
934250470 2:90349248-90349270 CCTGATTACAGAAGGGAAAGGGG - Intergenic
934259095 2:91454168-91454190 CCTGATTACAGAAGGGAAAGGGG + Intergenic
934302403 2:91786061-91786083 CCTGATTACAGAAGGGAAAGGGG + Intergenic
934892542 2:98083304-98083326 TCTGAGTGTAGAAGGGAGAAAGG + Intergenic
935103525 2:100019085-100019107 CCTGAAGTCAGAAGGGAGAAGGG + Intronic
935207151 2:100905929-100905951 CCTGAGTCTGCAAGGCATAAGGG + Intronic
936301429 2:111307580-111307602 CCTGAGCCCAGAAGGCCCAATGG + Intergenic
937580243 2:123476578-123476600 CCTGAGTCCTGTTGGGATGAAGG - Intergenic
938426572 2:131195701-131195723 CCTCTCTCCAGAAGGGAAAAGGG - Intronic
938520191 2:132061793-132061815 CCTGATTACAGAAGGGAAAGGGG - Intergenic
939377299 2:141385026-141385048 CCCGAGTCCAGCAGAGACAAAGG - Intronic
942965601 2:181889816-181889838 GCTGATCCCACAAGGGATAATGG - Intergenic
943029264 2:182667378-182667400 CCTGATTCCAATAGGGATGATGG - Intergenic
943841178 2:192582790-192582812 ACTGACTCCATAAGGCATAATGG + Intergenic
944183973 2:196927109-196927131 CCAGAGTCCAGAGGCGATTAAGG + Intronic
946305987 2:218857364-218857386 ACTGAGTGCAGGAGGGACAAGGG + Intergenic
947912510 2:233810772-233810794 CCTGAGCCCAGAAGGGGAAAAGG - Exonic
948425299 2:237883471-237883493 CCTGAGTAAAGCAGGGATCACGG - Intronic
1169209823 20:3759689-3759711 TCAGAGTCCAGAAGGGATAAGGG - Intronic
1169284659 20:4297885-4297907 CCTGAGTCCTGAAGGCAGCAAGG - Intergenic
1170039710 20:12026940-12026962 CCCCAGTGCAGAAGGGATAGTGG - Intergenic
1170895180 20:20406452-20406474 GCTGTGTCCAGAAGGGATTATGG + Intronic
1172625097 20:36342302-36342324 ACGGCCTCCAGAAGGGATAACGG + Intronic
1172767450 20:37358427-37358449 ACTGAGTCCAGAAGGGCTCGTGG + Intronic
1174056752 20:47803428-47803450 CCACAGTCAAGAAGGGATGATGG + Intergenic
1174087748 20:48020931-48020953 CCTGTGTCTCCAAGGGATAAAGG + Intergenic
1175598299 20:60253072-60253094 TCTGAGTCCAGAATGGGTAATGG - Intergenic
1176776453 21:13138971-13138993 CCTGATTACAGAAGGGAAAGGGG + Intergenic
1179521434 21:41948189-41948211 CCTGAGTCCAGATGGGGGAATGG + Intronic
1180467710 22:15629748-15629770 CCTCTCTCCAGAAGGGAAAAGGG - Intergenic
1180524456 22:16242252-16242274 CCTGATTACAGAAGGGAAAGGGG + Intergenic
1181904355 22:26182024-26182046 CCTCAGTCTAGAGGGGAGAAAGG - Intronic
1181966707 22:26661374-26661396 CCTGGCACCACAAGGGATAAGGG - Intergenic
1182154131 22:28053217-28053239 CCTGCATCCTGAAGGGATGATGG - Intronic
1183483301 22:38076389-38076411 GCTGAGTCCAGGATGGAAAAAGG + Intergenic
1184507490 22:44913334-44913356 CCTGAGTCTAGGAGGGAAAGGGG - Intronic
1184899010 22:47432629-47432651 CCTGAAGTCAGAAGGGAAAAAGG + Intergenic
1185209077 22:49556813-49556835 TCTGAGTTCATAAGGGATATTGG + Intronic
1203236657 22_KI270732v1_random:8942-8964 CCTGATTACAGAAGGGAAAGGGG + Intergenic
1203323951 22_KI270737v1_random:98790-98812 CCTGATTACAGAAGGGAAAGGGG - Intergenic
949106259 3:203604-203626 CCCTTGTCCTGAAGGGATAATGG + Intronic
949256773 3:2057662-2057684 CTGGAGGCTAGAAGGGATAAAGG - Intergenic
949264149 3:2137732-2137754 TTTGAGTCCAGAAGGGAGATAGG + Intronic
950877869 3:16294006-16294028 CCTAAATTCAGAAGGGATACTGG + Intronic
953559147 3:43971443-43971465 GCTGGGGCCAGAAGGGAAAAGGG + Intergenic
953621276 3:44535006-44535028 CCTGAGTCCAGCGGAGACAAAGG - Intergenic
955346098 3:58163083-58163105 CCTGAGTTCAGTGAGGATAAAGG - Intronic
955489646 3:59469529-59469551 CCTGAGTCCAGCGGAGACAAAGG + Intergenic
957021540 3:75133853-75133875 CCTGAGTGCAAAGGGGAGAATGG + Intergenic
959395223 3:105828831-105828853 CCTGAGTCCAGAAAGGTCAAAGG + Intronic
959919627 3:111856613-111856635 CCTTAGACCTGAAGGGAGAAAGG + Intronic
961409441 3:126707967-126707989 CCTCAGCCCAGTAGGGAGAATGG + Intronic
961573339 3:127816184-127816206 CGTGAGTTCAGAAGGGCTACAGG + Intronic
962865950 3:139448136-139448158 GCTGATGCCACAAGGGATAAGGG - Intergenic
963770579 3:149382473-149382495 GGTGATTCCAGAAGGGATGAGGG - Intergenic
963901688 3:150739042-150739064 CCTGAATCCAGAAGACTTAAAGG - Intergenic
964237156 3:154545144-154545166 CCTTAGGCCAGAAAGGACAAGGG + Intergenic
967012885 3:185453122-185453144 CCTGGGTCTGGAAGGGATAAGGG - Intronic
968000399 3:195201736-195201758 CCTGAGTGCCCAAGGGATAAAGG + Intronic
968649372 4:1754345-1754367 CCTGAGACCTGAAGGGAGACAGG + Intergenic
972548305 4:40103772-40103794 CTTAACTACAGAAGGGATAAAGG - Intronic
972871641 4:43307630-43307652 TCAGAGTCCAGAAGTGAGAACGG - Intergenic
974501637 4:62712379-62712401 CCTGATTCCAGATGGGATCTCGG + Intergenic
976546474 4:86341441-86341463 CATGAGTCCAAAAAGGAAAATGG + Intronic
976646142 4:87389546-87389568 CCTCAGTCTAGTAGGGAAAATGG - Intronic
976857579 4:89623188-89623210 GCTGAGTCCTGAAGGGCAAATGG - Intergenic
977230701 4:94449052-94449074 TCTGAGTCCAGAGGGGATCCAGG + Intergenic
980671093 4:136008451-136008473 CCAGAGTCCAGAGGGGGTCAAGG - Intergenic
982107758 4:152025538-152025560 CCTTAGGCCTGAAGGGACAAAGG - Intergenic
982605488 4:157511522-157511544 CCTGAGTACAGAAGGCAGGAGGG + Intergenic
983772684 4:171570839-171570861 CGGGAGTCCAGAAGGTAAAAAGG + Intergenic
984434571 4:179692415-179692437 CCTCATTGCAGAAAGGATAAAGG + Intergenic
985333582 4:188868243-188868265 ACTGAGTCCAGGAGAGAGAAAGG - Intergenic
989308720 5:39987893-39987915 ACAGAGTCCAGAAGAGAGAATGG + Intergenic
989748874 5:44866967-44866989 CCAGAGGCCAGAAAGGATAGTGG + Intergenic
990763425 5:59155801-59155823 GCTGAGACCAGAAGGGAGGAAGG + Intronic
991988888 5:72318434-72318456 CCTGACTCCAGAATGTAGAAAGG - Intronic
992087921 5:73294636-73294658 CCTGAGTCTGGAACGGATATTGG - Intergenic
992344235 5:75860050-75860072 CCCGAGTCCAGCAGAGACAAAGG - Intergenic
992750052 5:79853382-79853404 ACTGAGACCAGAAGGGGCAATGG + Intergenic
994917463 5:105999000-105999022 CCTGAGTCCAGCCGAGATAAAGG + Intergenic
995760557 5:115557269-115557291 CCTCAGTCTGGAAGGGTTAATGG - Intergenic
996557184 5:124790583-124790605 TGTGAGTACAGAAGGGAGAATGG - Intergenic
997873076 5:137522379-137522401 CCTGAGCCCAGACGGGATCCAGG + Intronic
998782091 5:145669060-145669082 TCTGAGTCCAGAAGACATGAAGG - Intronic
998971295 5:147595324-147595346 CATGAGTGCAGAATGGATGAGGG + Intronic
999719923 5:154392035-154392057 GCTGTGCCCAGAAGGGAGAATGG + Intronic
1001855662 5:175008287-175008309 CTTCAGTTCAGCAGGGATAAAGG - Intergenic
1003196347 6:3918620-3918642 CCTGAATCCCAAAGGGAGAAAGG + Intergenic
1005434914 6:25798689-25798711 CCTCAGACGAGAAGGAATAACGG - Intronic
1006956432 6:37877421-37877443 CAGGAGTCCAGACGAGATAATGG + Intronic
1010937268 6:81877061-81877083 GCTGAGTGAAGAAGGGATCAGGG + Intergenic
1012334624 6:98039900-98039922 CCTGATTCCAGAATGCATAATGG - Intergenic
1012509178 6:99982849-99982871 CTTGAGTCCAAAAGGGAGAAAGG - Intronic
1013429093 6:110040095-110040117 CATGAGACCAGCAGGGAGAAGGG + Intergenic
1016548401 6:145249388-145249410 GCTGATTGCAGAAGAGATAAAGG - Intergenic
1017769888 6:157636766-157636788 CCTGCTTCCAGAAAGGATTAAGG - Intronic
1018064901 6:160118038-160118060 CCTGCGTCCAGGAAGAATAAGGG + Intergenic
1018202065 6:161404181-161404203 CTTGAGTCTAGTAGGGATGATGG - Intronic
1019425465 7:974338-974360 CCTGAGTCCAGAAAGGAAGGAGG + Intronic
1019578202 7:1747684-1747706 CCTGAGTCCAGCAGGGCTCCAGG - Exonic
1020481168 7:8663351-8663373 CGTGAGACCAGAAAGGATGATGG - Intronic
1022429870 7:30307016-30307038 ACTGGTTCCAGAAGGGATAGAGG - Intronic
1024691835 7:51810953-51810975 AATAAGTCCAGAAGGGCTAAGGG + Intergenic
1025236256 7:57236750-57236772 CCACAGTCAAGAAGGGATGATGG - Intergenic
1025479763 7:60967682-60967704 CCTGATTACAGAAGGGAAAGGGG + Intergenic
1025552200 7:62264653-62264675 CCTGATTACAGAAGGGAAAGGGG - Intergenic
1025558005 7:62333781-62333803 CCTGATTACAGAAGGGAAAGGGG - Intergenic
1025886206 7:65595819-65595841 CCTGATTACAGAAGGGAAAGGGG - Intergenic
1031115113 7:117658937-117658959 ACTTAGTCCAGAAGGCATTAAGG - Intronic
1032336930 7:131033883-131033905 CCTGAGTGCAGAACGGAAAAAGG + Intergenic
1032494769 7:132352595-132352617 CCTGAATACAGGAGGGATATGGG + Intronic
1033751859 7:144366255-144366277 CAGGGGTCCAGAAGGGAAAATGG - Intronic
1034469226 7:151246763-151246785 CCAGACTCCAGAAGGGAGATGGG + Intronic
1034940672 7:155228310-155228332 CCTGAGTCCGGAGGGAAGAAGGG + Intergenic
1036841633 8:12127693-12127715 GCAGAGTCCTGAAGAGATAAAGG + Intergenic
1037584111 8:20264758-20264780 CCTGAGGCCAGAGCGGAAAAGGG + Intronic
1038869566 8:31479609-31479631 CCTGAGCCCAGGAGTGATGAAGG - Intergenic
1044265944 8:90181291-90181313 CCTGACTGCAGAAGAGATAAGGG - Intergenic
1048969945 8:139639862-139639884 CCTGAGCCCAGAGAGGTTAAGGG - Intronic
1053699476 9:40674632-40674654 CCTGATTACAGAAGGGAAAGGGG - Intergenic
1054310765 9:63474033-63474055 CCTGATTACAGAAGGGAAAGGGG - Intergenic
1054409555 9:64798184-64798206 CCTGATTACAGAAGGGAAAGGGG - Intergenic
1055358252 9:75460440-75460462 CCAGAGTCCAGCAGGGAAATCGG + Intergenic
1056900245 9:90592405-90592427 CCTGTGGTCAGAAGGGATGAAGG - Intergenic
1059776076 9:117476450-117476472 GAAGAGTCCAGAAGGCATAATGG - Intergenic
1059966290 9:119617733-119617755 CCAGAGTCCAAGAGAGATAAAGG + Intergenic
1060214450 9:121730244-121730266 CCCGAGGCCAGAAGGGACATGGG + Intronic
1060449010 9:123719604-123719626 CCTGGGACCAGAAGTGTTAAAGG + Intronic
1188381599 X:29500429-29500451 CCTGAGGCCAGGAGGGGTAAGGG - Intronic
1189874695 X:45423580-45423602 CCTCAGTCCCGAAGGGACCATGG + Intergenic
1191721026 X:64228932-64228954 ACTGAGTCCAGAGAGGGTAAGGG + Intronic
1192325945 X:70132247-70132269 CTTGAGACCAGAAAGGTTAAGGG - Intergenic
1196002912 X:110805847-110805869 TTTGAGTCCAGCAGGGAAAATGG + Intergenic
1196158273 X:112454710-112454732 CCTGATTCCAGGAGACATAATGG + Exonic
1197647540 X:129034166-129034188 CTTTAGTCTAGAAGGAATAAGGG + Intergenic
1198313406 X:135442538-135442560 CCTGATTCCAAAATGGATGAAGG + Intergenic
1198331962 X:135630450-135630472 CCTGAGCCCTGAAGGGGAAAGGG - Intergenic
1198334293 X:135651878-135651900 CCTCAGTCCTGAAGGGGAAAGGG + Intergenic
1198557618 X:137812080-137812102 CCCTAGTCCTGAAGGGACAAGGG + Intergenic
1199034015 X:143030887-143030909 CCTGAGGCCAGCTGGGTTAAGGG + Intronic
1200080229 X:153572588-153572610 CCTGAGTCCAGAAGCAGCAAAGG - Intronic
1200862375 Y:8006656-8006678 CCTGAGTCCAGCGGAGACAAAGG + Intergenic
1200872832 Y:8121861-8121883 CTTGAGTCCAGCAGAGACAAAGG + Intergenic
1200873337 Y:8126221-8126243 CCGGAGTCCAGAGGAGACAAAGG + Intergenic
1201062075 Y:10055177-10055199 CCTGAGTCCAGTGGAGACAAAGG - Intergenic
1201867022 Y:18666993-18667015 CCTGAGTCTAGAGGAGACAAAGG - Intergenic
1201914484 Y:19167722-19167744 CCTGTGTCCAGCAGAGACAAAGG - Intergenic
1202127425 Y:21580879-21580901 CCTGTGTCCAGCAGAGACAATGG - Intergenic