ID: 1096530463

View in Genome Browser
Species Human (GRCh38)
Location 12:52239499-52239521
Sequence CTGAATTCCTGAGTCCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 249}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096530463_1096530473 6 Left 1096530463 12:52239499-52239521 CCCTTCTGGACTCAGGAATTCAG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1096530473 12:52239528-52239550 CTAAGGATTCGGGAGGAGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 135
1096530463_1096530471 2 Left 1096530463 12:52239499-52239521 CCCTTCTGGACTCAGGAATTCAG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 101
1096530463_1096530470 -1 Left 1096530463 12:52239499-52239521 CCCTTCTGGACTCAGGAATTCAG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1096530470 12:52239521-52239543 GGACAGGCTAAGGATTCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 93
1096530463_1096530474 7 Left 1096530463 12:52239499-52239521 CCCTTCTGGACTCAGGAATTCAG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1096530474 12:52239529-52239551 TAAGGATTCGGGAGGAGGTGGGG 0: 1
1: 0
2: 2
3: 15
4: 249
1096530463_1096530476 21 Left 1096530463 12:52239499-52239521 CCCTTCTGGACTCAGGAATTCAG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1096530476 12:52239543-52239565 GAGGTGGGGGTGAGTCAATCAGG 0: 1
1: 0
2: 0
3: 13
4: 225
1096530463_1096530469 -4 Left 1096530463 12:52239499-52239521 CCCTTCTGGACTCAGGAATTCAG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1096530469 12:52239518-52239540 TCAGGACAGGCTAAGGATTCGGG 0: 1
1: 0
2: 2
3: 15
4: 132
1096530463_1096530472 5 Left 1096530463 12:52239499-52239521 CCCTTCTGGACTCAGGAATTCAG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1096530472 12:52239527-52239549 GCTAAGGATTCGGGAGGAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 205
1096530463_1096530468 -5 Left 1096530463 12:52239499-52239521 CCCTTCTGGACTCAGGAATTCAG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1096530468 12:52239517-52239539 TTCAGGACAGGCTAAGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 187
1096530463_1096530475 8 Left 1096530463 12:52239499-52239521 CCCTTCTGGACTCAGGAATTCAG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1096530475 12:52239530-52239552 AAGGATTCGGGAGGAGGTGGGGG 0: 1
1: 0
2: 2
3: 49
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096530463 Original CRISPR CTGAATTCCTGAGTCCAGAA GGG (reversed) Intronic
903161953 1:21495402-21495424 CTGCATCCCTGAGGGCAGAAAGG - Intergenic
904450342 1:30606929-30606951 CTGCATTTCCGAGTCCAGAGAGG + Intergenic
904696460 1:32334491-32334513 CTGCCTTCCTGTGCCCAGAAAGG - Exonic
905536270 1:38724461-38724483 CTGAATTCCAGAGTGGACAAAGG + Intergenic
905766835 1:40608408-40608430 CTGAGTTCCTTCCTCCAGAAAGG - Intergenic
905801635 1:40847833-40847855 CTGAATTCAAGAGTCCAGCCTGG + Intergenic
906617707 1:47245752-47245774 CTGAATTCCTCAGGCCGGAGAGG + Intergenic
907898979 1:58720103-58720125 CTGCCTTCCTGAGGCCAGGAAGG - Intergenic
909783184 1:79575106-79575128 ATGAAGTCCTGTGTTCAGAAGGG + Intergenic
909920443 1:81374918-81374940 CTGACTTCCTGAGTCCAGGATGG + Intronic
910098734 1:83554260-83554282 CTGAAGCCCTGAGAACAGAAGGG + Intergenic
910702657 1:90092973-90092995 CTGAAGTCCAAAGTCCAGATAGG + Intergenic
910712976 1:90200831-90200853 GTGAATTCCTAAGTGCAGCAAGG - Intergenic
913509381 1:119548204-119548226 TTGAATTCCTGGGTCCAGACAGG + Intergenic
916618753 1:166472903-166472925 CTGTCCTCCTGACTCCAGAATGG - Intergenic
917886389 1:179389490-179389512 ATGAATCCCAGATTCCAGAAGGG - Intronic
919188445 1:194184662-194184684 ATTAATTCCTGAGGCCAGATTGG + Intergenic
919632702 1:199974517-199974539 CAGGATTCCTGAGTGAAGAAAGG + Intergenic
919803199 1:201365702-201365724 CTCAGTCCCTGGGTCCAGAATGG - Intronic
919949807 1:202352578-202352600 GTGAATTTCTGAGTCAAGTATGG - Intronic
920730677 1:208480973-208480995 CTAACTTCCTGCTTCCAGAAAGG + Intergenic
1063879680 10:10518152-10518174 CAGAATTCCAGAATTCAGAATGG - Intergenic
1063882869 10:10549229-10549251 CAGACTTCCTGCCTCCAGAATGG - Intergenic
1063905705 10:10778125-10778147 TTGAATTTATAAGTCCAGAAAGG + Intergenic
1064056263 10:12100165-12100187 CTGAATTTTACAGTCCAGAATGG + Exonic
1065561553 10:26969039-26969061 CTGAATTCCAGAGTCTAAACGGG - Intergenic
1068472008 10:57477203-57477225 CTGAATTCTTGAATCTAGCAGGG - Intergenic
1069849057 10:71393343-71393365 ATGAAATCTTGAGTCCAGAAAGG - Intergenic
1070005414 10:72419727-72419749 CTCAATTCATGAGGCCAGTAAGG + Intronic
1072630982 10:97146384-97146406 CTGCATCCCTGAGTCCAGCCTGG + Intronic
1073390980 10:103176162-103176184 CTGCCTTCCTGTGCCCAGAAAGG + Intronic
1073456614 10:103640667-103640689 GTGAATTCCAGAGTAGAGAAGGG + Intronic
1073466963 10:103699906-103699928 CTGAATTCCTGCGGAGAGAAGGG + Intronic
1075527342 10:123197727-123197749 CTGACTGCCCAAGTCCAGAAAGG - Intergenic
1076697852 10:132255758-132255780 CTGGACTCCTCAGTCCAGAGGGG + Intronic
1078067075 11:8085599-8085621 GTGATTTCCTGGGTCCAGCAGGG + Intronic
1078110338 11:8386961-8386983 GTGAATTCCTGAGGAAAGAACGG + Intergenic
1078352920 11:10609620-10609642 CTTAATTCTTGAACCCAGAAGGG - Intronic
1078427840 11:11265898-11265920 CTCATATCCTGAGTACAGAAGGG + Intergenic
1078581325 11:12541718-12541740 CTGCCTCCCTGAGACCAGAACGG + Intergenic
1079981825 11:27159092-27159114 CAGAATTCATGAGTTCAGGAGGG - Intergenic
1083238266 11:61366417-61366439 CTGAATTCCTGAATCGCTAAAGG + Intronic
1085044704 11:73346096-73346118 CTGAATTACTGAGTCCCCAAGGG - Intronic
1088161559 11:106877695-106877717 GTCCATTCCTGTGTCCAGAATGG - Intronic
1088232914 11:107691250-107691272 CTAAATCCCTGAGTCGATAATGG - Intergenic
1088471991 11:110196661-110196683 CTGGATTCCTGAGTTGGGAAGGG - Intronic
1090931579 11:131302292-131302314 TTGAATTCCTAAAACCAGAAGGG + Intergenic
1091059866 11:132451416-132451438 GTGAATTCCTGAGACCACAGAGG + Intronic
1091060730 11:132459203-132459225 CTGAAGGCCTGAGGCCAGGAGGG - Intronic
1091251895 11:134151050-134151072 CTTCAGTCCTGAGTCCAGCACGG - Exonic
1092015292 12:5153652-5153674 CTGAATGCCTTAGTGCAAAAAGG - Intergenic
1092094553 12:5830628-5830650 TAGAATTACTGAGTCAAGAAGGG - Intronic
1092684257 12:11023949-11023971 CTGAATTCCTGACACAACAATGG - Intronic
1092688554 12:11079636-11079658 CTGAATTCCTGACACAACAAGGG - Intronic
1094635012 12:32217834-32217856 GTGACTTCCTTAATCCAGAATGG - Intronic
1096530463 12:52239499-52239521 CTGAATTCCTGAGTCCAGAAGGG - Intronic
1096719524 12:53510751-53510773 CTGGCTTCCTGTGTCCAGGATGG + Intronic
1096765765 12:53887866-53887888 CTGACTTCCCAAGTGCAGAAGGG - Intergenic
1100412360 12:94333151-94333173 CTGAATGCCAGAGAACAGAATGG - Intronic
1100605030 12:96144728-96144750 CAGAGTTCCTGAGTCTAGGAAGG + Intergenic
1101137964 12:101764974-101764996 CTGAATTCTACAGCCCAGAAGGG - Exonic
1101187243 12:102292165-102292187 CAGTCTTCCTGAGTCCAGCAGGG + Intergenic
1102989552 12:117305052-117305074 CTGCAATCCTGAGTCAGGAAGGG - Intronic
1103097698 12:118145208-118145230 TTGTGATCCTGAGTCCAGAATGG + Exonic
1103368960 12:120403738-120403760 CTCAGCTCCTGAGTCCACAATGG + Intergenic
1105643330 13:22288841-22288863 CTCAGTTCCTGAGCCAAGAAAGG - Intergenic
1105669541 13:22596892-22596914 CTGATGTCCTGAATCCAAAAGGG - Intergenic
1105837359 13:24223278-24223300 CTGAAGTCCTCAGTCCTGAAAGG + Exonic
1107032342 13:35866092-35866114 CTGAGTCCCAGAGTTCAGAATGG - Intronic
1108434348 13:50387061-50387083 CAGATTTCCTGAGTCTTGAAAGG - Intronic
1109806236 13:67447620-67447642 CTAATTTCCTTAATCCAGAAAGG - Intergenic
1111108174 13:83673212-83673234 ATGAATTCCTGACCCCAGAAAGG - Intergenic
1111148952 13:84222949-84222971 CTGACTTCCTGATACCAAAAGGG + Intergenic
1111763361 13:92495102-92495124 CTGAGTTCGTCAGTCTAGAAAGG + Intronic
1111767603 13:92552669-92552691 CTGAGTACGTGAGTCCAGGATGG - Intronic
1112183386 13:97106440-97106462 CTGAATTCCTTATTGAAGAAAGG + Intergenic
1112315996 13:98362414-98362436 CTGAATCACTGAGTCAAGGACGG + Intronic
1113053787 13:106244345-106244367 CTAAAGTCCTCAGCCCAGAAAGG - Intergenic
1113635318 13:111915213-111915235 CTGACTTCCTGAGCCCAGGGCGG - Intergenic
1113772224 13:112917546-112917568 CTGAAATCCTCAGTTCAGCAGGG + Intronic
1114431577 14:22666186-22666208 CTGTCTTCCAGACTCCAGAATGG - Intergenic
1114636804 14:24192122-24192144 CTTCATTCCTAAGTCCAGAAAGG + Intronic
1116365952 14:44063372-44063394 CTGAACTGCAGAGTCCTGAATGG + Intergenic
1116636523 14:47403322-47403344 CTTATTTCCAGATTCCAGAATGG - Intronic
1119565627 14:75626757-75626779 ATGGAATCCTGAGTCTAGAAGGG - Intronic
1121060076 14:90898963-90898985 CAAAATTCCTGAGTCCTGAGAGG + Intronic
1122589306 14:102834818-102834840 GTCAGTTCCTGTGTCCAGAATGG - Intronic
1123445613 15:20328286-20328308 TTGAATTCCTGGGTCCAGAGGGG + Intergenic
1127187719 15:56496945-56496967 CAGAATGCCTGGATCCAGAAGGG + Intergenic
1128608451 15:69055604-69055626 GTTAAGTCCAGAGTCCAGAAGGG + Intronic
1128968107 15:72081614-72081636 GCCCATTCCTGAGTCCAGAATGG + Intronic
1129191749 15:73941641-73941663 CAGAATCCCTGAGGCCAGAGAGG + Intronic
1129923077 15:79337163-79337185 CTGACTTCCTGCCTCCAGAACGG - Intronic
1130285324 15:82549858-82549880 CTGAGTCCATGTGTCCAGAATGG + Intronic
1131942612 15:97584173-97584195 CTGAATGCCTTACTCCAGTAAGG + Intergenic
1132253532 15:100353232-100353254 TTAAATTCCAGATTCCAGAATGG + Intergenic
1134367004 16:13588727-13588749 CAGAAGTCCTGAGTCCAGCTTGG - Intergenic
1135961509 16:26998367-26998389 CTGAAGTCCTGAATGGAGAAAGG + Intergenic
1136895967 16:33996200-33996222 CTGTTTTCCTGATTCCAGACTGG - Intergenic
1137375994 16:47952335-47952357 CTGACTTCCCCAGCCCAGAAAGG + Intergenic
1138552876 16:57756933-57756955 CTGCTTTCCTCAGTCCAGACTGG - Exonic
1141536505 16:84684814-84684836 CTGAAATCCTGAATCCAGGCTGG - Intergenic
1142715633 17:1745495-1745517 CTGGAGTCCAGAGGCCAGAAGGG + Intronic
1143265880 17:5637109-5637131 GGGATTTCTTGAGTCCAGAAAGG - Intergenic
1144255541 17:13463665-13463687 CTGTATTCCTGAAGCCAGCATGG + Intergenic
1145104426 17:20103525-20103547 CTGAATTACAGTGTTCAGAATGG + Intronic
1146365665 17:32224945-32224967 CTAAATTCCAGAGGCCAAAAGGG + Exonic
1146476306 17:33165236-33165258 CTAGATGCCTGAGTCCACAAAGG - Intronic
1147020041 17:37523978-37524000 CGAACTTCCTGAGTCCAGATTGG - Intronic
1148675191 17:49440795-49440817 AGGACTTCCTGAGTCCAGATGGG - Intronic
1148752019 17:49950841-49950863 CTAATTTCCTGAGTCCATACCGG + Intergenic
1149133561 17:53337969-53337991 CTGAGTTCCTTACTCAAGAAAGG - Intergenic
1149651173 17:58277525-58277547 TTGTCTTCCAGAGTCCAGAAGGG + Intronic
1152233654 17:79127232-79127254 CTTGATACCTGAGTGCAGAAAGG + Intronic
1153247699 18:3089550-3089572 CTGAATTCCAGCGGCAAGAATGG - Exonic
1153637264 18:7123323-7123345 CGGAATTCCAAAGTCCAAAATGG - Intergenic
1153652342 18:7252267-7252289 CGGAATTCCTCCCTCCAGAAAGG + Intergenic
1154503463 18:15008711-15008733 CAGAAGTCCTGCTTCCAGAATGG - Intergenic
1155070900 18:22315049-22315071 AGGATTGCCTGAGTCCAGAATGG + Intergenic
1155332940 18:24736481-24736503 CTTAATTCCTGTGTCAATAAGGG + Intergenic
1158592639 18:58790437-58790459 CTGAATCCCAGAGTCCTGACTGG - Intergenic
1158688691 18:59640550-59640572 CCCAGTTCCTGTGTCCAGAATGG - Intronic
1161664276 19:5565462-5565484 CTGAATTTCAGTGTCCAGCATGG + Intergenic
1162868185 19:13564937-13564959 CTGAATAGCTGAGACCACAAAGG - Intronic
1164760495 19:30724911-30724933 CTGACTTCCAGCCTCCAGAAGGG + Intergenic
1167337879 19:48897687-48897709 CTGGACTCCTGTGTCCTGAAGGG - Intronic
1167760844 19:51447896-51447918 CGGACTTCCTGGGTCCAGTAGGG - Intergenic
1168092554 19:54095568-54095590 CTGGAGTCCTGGGTCCAGGAAGG + Exonic
927956132 2:27208486-27208508 CTGAAACCCTGACTCCAGCATGG - Intronic
929210613 2:39353050-39353072 CTGTATTGCTTAGCCCAGAAAGG - Intronic
930337310 2:50065507-50065529 CTGATTTCATGTGTCCATAAGGG - Intronic
933167039 2:79087734-79087756 CTGAATTCCTGTGAGCCGAAAGG + Intronic
933170589 2:79120717-79120739 CAGAATTTCTGAGACCAGGAAGG - Intronic
933172362 2:79138150-79138172 CTGAATTCCTGACAGCAGGAAGG + Intergenic
933712915 2:85340858-85340880 TTGTGATCCTGAGTCCAGAATGG - Intergenic
935428639 2:102948975-102948997 CTGAATTACTGAGTCCTCCAGGG + Intergenic
935687120 2:105694116-105694138 GTGAATTCCTGAGTCAGGGATGG - Intergenic
938014829 2:127858351-127858373 CTGACCTCCTCCGTCCAGAAAGG - Intergenic
938502636 2:131838841-131838863 CAGAAGTCCTGCTTCCAGAATGG - Intergenic
938507562 2:131902407-131902429 GCCAATTCCTGTGTCCAGAATGG - Intergenic
941051690 2:160741709-160741731 CTGAGCTCCTGAGGCTAGAATGG + Intergenic
941269477 2:163407763-163407785 CAGAATACCTGAGGGCAGAAAGG + Intergenic
942090637 2:172486967-172486989 ATGCCTTCCTGAGTCCTGAATGG + Intronic
942170174 2:173282498-173282520 CTGGACTCCTGAGTCTAGTAGGG - Intergenic
946657959 2:221969381-221969403 CTTATGTCCTGAATCCAGAAAGG + Intergenic
946804512 2:223457868-223457890 GTGAATTTCAGAGTCAAGAAGGG + Intergenic
947020853 2:225674012-225674034 CTGACTTCCTCAGCCCCGAATGG - Intergenic
947912513 2:233810779-233810801 CAGATGTCCTGAGCCCAGAAGGG - Exonic
948394715 2:237636487-237636509 CTGCATTAGTGAGTCAAGAAAGG - Intronic
1168797376 20:620586-620608 AGGAATTCCTCAGTCCAGCATGG - Intergenic
1171382646 20:24745242-24745264 CTGACTTCCTGAGTCCAGGGAGG - Intergenic
1172055147 20:32149716-32149738 CTGAATGCCTGAGCCCAGCAGGG - Exonic
1175055818 20:56196977-56196999 CTGGATTCTTGTTTCCAGAATGG - Intergenic
1175760680 20:61560650-61560672 CTGAGTGCCTGAGTCCACAGAGG + Intronic
1177268148 21:18810398-18810420 CTGAATTCCTCTCCCCAGAAAGG + Intergenic
1177984672 21:27959945-27959967 GCCAATTCCTGTGTCCAGAATGG + Intergenic
1179521430 21:41948182-41948204 CAGAAGGCCTGAGTCCAGATGGG + Intronic
1180319637 22:11308320-11308342 CAGAATGCCTGAGTCCCGCAGGG + Intergenic
1180645405 22:17334516-17334538 CTGCATTGCTGCGTCTAGAAAGG - Intergenic
1182112370 22:27732726-27732748 CTGAGATCCTGGGCCCAGAAAGG - Intergenic
1183672184 22:39279543-39279565 CCGAATTCCAGATTCCAGGAAGG + Intergenic
1183983538 22:41556622-41556644 CTGATTTACTGAGTCCAGGTTGG + Intergenic
1184307128 22:43612246-43612268 CTCAGTTCCTATGTCCAGAATGG - Intronic
1184410858 22:44325495-44325517 ATGAATTCCAAAGTCTAGAAAGG - Intergenic
949237757 3:1831082-1831104 CTTAATTGCAGCGTCCAGAAAGG + Intergenic
949768428 3:7552374-7552396 CTGTCTTCCAGAGCCCAGAATGG - Intronic
950925573 3:16737671-16737693 TTGAACTCCTGTGTCCAGCATGG + Intergenic
951338027 3:21447976-21447998 CAAAATGCCTGAGTCCAGATGGG - Intronic
952076387 3:29701994-29702016 CTGGGTTCCTGAGTCCAGTGGGG + Intronic
952387205 3:32850691-32850713 CTGAAATACTGAGTGCAGGATGG + Intronic
953213769 3:40898674-40898696 CTGAGACCCTGAGTCCAGGAGGG - Intergenic
955219755 3:57013321-57013343 CTGGGCTCCTGAGTCCAGTAGGG + Intronic
956454586 3:69408270-69408292 CTGAAGTCATGAGGCCTGAAAGG + Intronic
956942044 3:74174463-74174485 TTGAATCCCTGGGTACAGAATGG + Intergenic
958481400 3:94649553-94649575 CTGCATTCCTAAGTACAGAAAGG - Intergenic
958777268 3:98501127-98501149 CTGGTTTCCTGAGTCCAGCTAGG + Intronic
959284532 3:104391018-104391040 CTGTATTCCAGACCCCAGAATGG - Intergenic
959819352 3:110713951-110713973 TTGGATTCCTGATTTCAGAAAGG - Intergenic
962718635 3:138151243-138151265 CTGACTTACTGAGTCCAAAGTGG - Intergenic
963711225 3:148749932-148749954 CTAAATTCCTGGCTGCAGAAAGG - Intergenic
964102555 3:153004823-153004845 CTGACTTACTGAGTCCAAAGTGG + Intergenic
965232501 3:166071721-166071743 CTGCATTCCAGACTCCAGAATGG + Intergenic
966365900 3:179187201-179187223 CTAAATGCATGTGTCCAGAAAGG - Intronic
967679567 3:192344949-192344971 CTGAATTCTTCAGACCAGACGGG - Intronic
969097864 4:4747664-4747686 CTGCATTCTTGGCTCCAGAAAGG + Intergenic
969249772 4:5959459-5959481 CTGAGCTCCTGAGCCCAGCAAGG - Exonic
969831067 4:9797409-9797431 CTAAATACTTGAGTCCAGAGTGG - Intronic
969888659 4:10239488-10239510 CTGATTTACTGAGTCCAAGAGGG - Intergenic
971328851 4:25665778-25665800 CTGGGTTCCTGAGCACAGAAGGG + Intronic
972083765 4:35186716-35186738 GTCAATTCCTATGTCCAGAATGG - Intergenic
972717909 4:41666803-41666825 CTGAATTTATGACTTCAGAATGG + Intronic
974640723 4:64626352-64626374 CTGAAGTCCAATGTCCAGAATGG - Intergenic
975893073 4:79052178-79052200 CTGAGTTCCTGTCTCCACAAGGG - Intergenic
976674249 4:87686688-87686710 CTGAATTAATGAGTTCAGATTGG - Intergenic
978887575 4:113783390-113783412 AGGAATGCTTGAGTCCAGAAAGG + Intergenic
980822538 4:138036283-138036305 CTGAACTCCTGAGGCAAGATGGG + Intergenic
980951721 4:139385704-139385726 CTGAATTCAGGATTCCACAAAGG - Intronic
981062885 4:140445600-140445622 ATCAGTTCCTGTGTCCAGAATGG + Intronic
983041768 4:162936706-162936728 CTGAAGTCATGAGCCCACAAGGG + Intergenic
985679338 5:1247752-1247774 GTGAACTCCTGGGTCCAGTAGGG - Intergenic
985931103 5:3058470-3058492 CAGAAGGCCTGAGTCCTGAACGG + Intergenic
988272304 5:29032697-29032719 CTGTCTTCCAGATTCCAGAATGG - Intergenic
988786288 5:34568313-34568335 CCGAATTCCTGTCTCCAGTATGG + Intergenic
990313194 5:54559635-54559657 CCTCATTCCTGTGTCCAGAATGG - Intergenic
991206606 5:64057187-64057209 CTGAAGTCATGAGTCTATAAGGG - Intergenic
994174206 5:96693173-96693195 CTGGATTACTTAGTCCACAAAGG - Intronic
995058290 5:107786704-107786726 CTGACTTCCAGCCTCCAGAATGG + Intergenic
995128046 5:108599681-108599703 TTGAATTCTTGGGGCCAGAATGG + Intergenic
995438836 5:112167446-112167468 ATGAATGCCTCAGTCTAGAATGG - Intronic
999006225 5:147982450-147982472 CTGACTTCCTGAGTTCAAAAGGG + Intergenic
1000823646 5:166016613-166016635 CTGAGCTCATGGGTCCAGAACGG + Intergenic
1001751736 5:174136641-174136663 CTGGAATCCTGAGTCTTGAATGG - Intronic
1001752778 5:174144317-174144339 CTGAAGACCTGTGTCCAGGATGG + Intronic
1002841763 6:912601-912623 CTGAAGTCCTGAGTTTAGAAGGG + Intergenic
1005545660 6:26867296-26867318 GTGAACTCCAGAGTCCTGAAGGG + Intergenic
1007829320 6:44626553-44626575 CTAAATTCCTGAGTTCACAGGGG - Intergenic
1007926842 6:45656439-45656461 CAGAAATCCTGGCTCCAGAAGGG - Intronic
1008958610 6:57243304-57243326 TTGAAAGCCTGAGTTCAGAATGG + Intergenic
1016287819 6:142492709-142492731 GTGAATTCCTATGTTCAGAACGG - Intergenic
1018502163 6:164422745-164422767 CTGTATTCCAGACCCCAGAATGG + Intergenic
1019219855 6:170464677-170464699 ATGAATCCCTGAGTTCACAAAGG - Intergenic
1020042714 7:5016305-5016327 CTGCATTCCTTCATCCAGAAGGG - Intronic
1022462200 7:30620306-30620328 CTCAATTCCAGCCTCCAGAACGG - Intronic
1022798831 7:33755681-33755703 CTGATTTCATGAGTACAGAAGGG - Intergenic
1022984828 7:35641884-35641906 CCCCATTCCTGTGTCCAGAATGG - Intronic
1026129454 7:67608058-67608080 ATGAATTCCTGAAACAAGAAAGG + Intergenic
1029425177 7:100490135-100490157 CCCAATTCCTGAGCCCAGAAGGG - Intronic
1031663940 7:124461793-124461815 CCCAATTCCTATGTCCAGAATGG + Intergenic
1032336928 7:131033876-131033898 GTGATATCCTGAGTGCAGAACGG + Intergenic
1033618639 7:143041585-143041607 CTTAATTCATAAGTCCAGCATGG - Intergenic
1033905828 7:146201002-146201024 CTGAATTACTGAATCCAAAAGGG + Intronic
1034192926 7:149224981-149225003 CTGATTTCCTGATCTCAGAAGGG - Exonic
1035325574 7:158063812-158063834 CTGACCTGCTGTGTCCAGAATGG - Intronic
1037565153 8:20111915-20111937 ATGATTTCCTTAGGCCAGAAAGG + Intergenic
1039607559 8:38894819-38894841 CTGAATCCCTGGGTTCTGAATGG - Intergenic
1041451339 8:58009698-58009720 ATGAATTACAGAGTCTAGAATGG - Intronic
1042371871 8:68001019-68001041 GTGAGTTCCTATGTCCAGAATGG - Intronic
1042976262 8:74473367-74473389 GTCCATTCCTGTGTCCAGAATGG + Intronic
1043658787 8:82708310-82708332 CTGAATTCCTGAAAACAGTAAGG + Intergenic
1045592837 8:103617430-103617452 CCCCATTCCTGTGTCCAGAATGG - Intronic
1047169051 8:122472503-122472525 GTGGATTCCTGTGTCCAGAATGG - Intergenic
1048076081 8:131072893-131072915 GTGAATGCCTCAGTCCTGAAGGG + Intergenic
1048078421 8:131098367-131098389 CTGACTTCCTGAGTTGAAAATGG + Intergenic
1048545536 8:135383510-135383532 CAGAGTTCCTATGTCCAGAATGG + Intergenic
1050904495 9:10986846-10986868 CTGTATTCCAGATCCCAGAATGG - Intergenic
1051520841 9:17986144-17986166 CTGAGTTCATAAGTACAGAATGG + Intergenic
1051714598 9:19969119-19969141 CTGAATTCCTGAGGCCAGGGAGG + Intergenic
1052142220 9:25001313-25001335 AAGAATTCTAGAGTCCAGAAAGG + Intergenic
1055644668 9:78351673-78351695 ATTAAATCCTAAGTCCAGAAGGG + Intergenic
1058508931 9:105694930-105694952 CTGACTTACTGAGTGCAGATGGG + Intronic
1060256342 9:122034498-122034520 CTGAATGCCTGTCTCCAGGAGGG + Intronic
1060839920 9:126785195-126785217 CTGAACTTCTGTTTCCAGAAGGG - Intergenic
1061619112 9:131799461-131799483 CAGGAATTCTGAGTCCAGAAAGG + Intergenic
1185563022 X:1075153-1075175 CTGAAGTCCTGAGACCCGGAAGG - Intergenic
1185563043 X:1075293-1075315 CTGAAGTCCTGAGACCTGGAAGG - Intergenic
1185950996 X:4434124-4434146 CAGAGTTCCTGTGTCCAGCAAGG - Intergenic
1189602152 X:42638635-42638657 CTGAAGTCCTGTATCGAGAAAGG + Intergenic
1189874693 X:45423573-45423595 TTGACTTCCTCAGTCCCGAAGGG + Intergenic
1190099387 X:47509505-47509527 CTGAATTCCAGAATACTGAAAGG + Intergenic
1191861954 X:65672986-65673008 CTTAAGTGCTGAGTTCAGAATGG + Intronic
1194238376 X:91412887-91412909 GTGAGTTCCTGTGTCCAGAATGG - Intergenic
1194267869 X:91778103-91778125 CTAAATTCCTCTCTCCAGAAAGG - Intergenic
1194905981 X:99576632-99576654 CTGTCTTCCAGACTCCAGAAAGG + Intergenic
1195402846 X:104480160-104480182 CTGAATTCCTGGGTACTGATAGG - Intergenic
1195936238 X:110127990-110128012 CTGAATTCTTAAGACCATAATGG - Intronic
1199423664 X:147676412-147676434 CTGCCTTCCAGATTCCAGAATGG + Intergenic
1199528060 X:148814403-148814425 CTGCATTTTTGATTCCAGAAAGG - Intronic
1200105297 X:153708741-153708763 CTGTTTTCCTGATTCCAGACTGG - Intronic
1200122344 X:153797151-153797173 GTGATTTCCTGAGTCTACAAGGG - Intronic
1200585077 Y:4999028-4999050 CTAAATTCCTCTCTCCAGAAAGG - Intergenic
1201906366 Y:19089741-19089763 CTGGATTCCACACTCCAGAATGG - Intergenic