ID: 1096530464

View in Genome Browser
Species Human (GRCh38)
Location 12:52239500-52239522
Sequence CCTGAATTCCTGAGTCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 1, 2: 1, 3: 37, 4: 245}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096530464_1096530473 5 Left 1096530464 12:52239500-52239522 CCTTCTGGACTCAGGAATTCAGG 0: 1
1: 1
2: 1
3: 37
4: 245
Right 1096530473 12:52239528-52239550 CTAAGGATTCGGGAGGAGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 135
1096530464_1096530469 -5 Left 1096530464 12:52239500-52239522 CCTTCTGGACTCAGGAATTCAGG 0: 1
1: 1
2: 1
3: 37
4: 245
Right 1096530469 12:52239518-52239540 TCAGGACAGGCTAAGGATTCGGG 0: 1
1: 0
2: 2
3: 15
4: 132
1096530464_1096530474 6 Left 1096530464 12:52239500-52239522 CCTTCTGGACTCAGGAATTCAGG 0: 1
1: 1
2: 1
3: 37
4: 245
Right 1096530474 12:52239529-52239551 TAAGGATTCGGGAGGAGGTGGGG 0: 1
1: 0
2: 2
3: 15
4: 249
1096530464_1096530472 4 Left 1096530464 12:52239500-52239522 CCTTCTGGACTCAGGAATTCAGG 0: 1
1: 1
2: 1
3: 37
4: 245
Right 1096530472 12:52239527-52239549 GCTAAGGATTCGGGAGGAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 205
1096530464_1096530468 -6 Left 1096530464 12:52239500-52239522 CCTTCTGGACTCAGGAATTCAGG 0: 1
1: 1
2: 1
3: 37
4: 245
Right 1096530468 12:52239517-52239539 TTCAGGACAGGCTAAGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 187
1096530464_1096530471 1 Left 1096530464 12:52239500-52239522 CCTTCTGGACTCAGGAATTCAGG 0: 1
1: 1
2: 1
3: 37
4: 245
Right 1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 101
1096530464_1096530476 20 Left 1096530464 12:52239500-52239522 CCTTCTGGACTCAGGAATTCAGG 0: 1
1: 1
2: 1
3: 37
4: 245
Right 1096530476 12:52239543-52239565 GAGGTGGGGGTGAGTCAATCAGG 0: 1
1: 0
2: 0
3: 13
4: 225
1096530464_1096530475 7 Left 1096530464 12:52239500-52239522 CCTTCTGGACTCAGGAATTCAGG 0: 1
1: 1
2: 1
3: 37
4: 245
Right 1096530475 12:52239530-52239552 AAGGATTCGGGAGGAGGTGGGGG 0: 1
1: 0
2: 2
3: 49
4: 504
1096530464_1096530470 -2 Left 1096530464 12:52239500-52239522 CCTTCTGGACTCAGGAATTCAGG 0: 1
1: 1
2: 1
3: 37
4: 245
Right 1096530470 12:52239521-52239543 GGACAGGCTAAGGATTCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096530464 Original CRISPR CCTGAATTCCTGAGTCCAGA AGG (reversed) Intronic
901358251 1:8671549-8671571 CCTTAATTCGTTAGCCCAGAAGG - Intronic
901480469 1:9521475-9521497 CCTTCCTTCTTGAGTCCAGATGG + Intergenic
901826761 1:11867035-11867057 CCTGAATTCCTCAGTGGTGATGG + Intergenic
905590512 1:39159268-39159290 CCTGTATTCTTGAGCTCAGAGGG + Intronic
906202277 1:43967793-43967815 ACTGAAAGCCTGGGTCCAGAAGG + Exonic
906800540 1:48733299-48733321 ACTGAAATCCAGAGCCCAGATGG + Intronic
908913096 1:69095724-69095746 ACTCAATTTTTGAGTCCAGAGGG - Intergenic
909783183 1:79575105-79575127 CATGAAGTCCTGTGTTCAGAAGG + Intergenic
910098733 1:83554259-83554281 CCTGAAGCCCTGAGAACAGAAGG + Intergenic
911100765 1:94094282-94094304 CCTGAATTCCTGAGTCACTGGGG - Intronic
912305341 1:108560741-108560763 CCTGCGCTCCTGACTCCAGATGG + Intronic
914050374 1:144125938-144125960 TTTGAATTCCTGGGTCCAGAGGG - Intergenic
914128808 1:144839507-144839529 TTTGAATTCCTGGGTCCAGAGGG + Intergenic
914743057 1:150481245-150481267 CTTGAATTCCTGGGTTCAAACGG + Intergenic
915217518 1:154349941-154349963 CCTGGATTCCTTAGTCCTGCTGG + Exonic
916744666 1:167675800-167675822 CCAAAATCGCTGAGTCCAGATGG + Intronic
917310172 1:173670294-173670316 CTTGAATTTCTGAATCAAGAGGG - Intergenic
917348114 1:174049810-174049832 ACTGAAGTCCTGACCCCAGAAGG - Intergenic
917360879 1:174174701-174174723 CCTGAAGTTCTGAGGTCAGAGGG + Intronic
917886390 1:179389491-179389513 CATGAATCCCAGATTCCAGAAGG - Intronic
921425017 1:214991480-214991502 CCTGAATTCTAGAGTTCAAACGG + Intergenic
921657478 1:217757829-217757851 CCTGAACTTCTGGGTCAAGAAGG + Intronic
921992094 1:221378012-221378034 CCTGAAATCCTTGGCCCAGAGGG - Intergenic
924409410 1:243787801-243787823 CCTAGGTTCCTCAGTCCAGATGG - Intronic
924669743 1:246111554-246111576 CCAGTCTTCCTGAGGCCAGAGGG - Intronic
924901883 1:248409828-248409850 CCTCAATTCCTGGATCCATATGG - Intergenic
1063849162 10:10164564-10164586 CCTGAGTAGCTGAGTCCACAGGG - Intergenic
1064529093 10:16288880-16288902 CCTGAGTTCCTGAGTTCTGGAGG - Intergenic
1064718755 10:18206360-18206382 CCTGACTTCCTCTCTCCAGATGG + Intronic
1065257816 10:23891461-23891483 CCTGAATGGCTGGGTCCTGAGGG - Intronic
1065561554 10:26969040-26969062 TCTGAATTCCAGAGTCTAAACGG - Intergenic
1065706418 10:28475234-28475256 CTTGAATTCCTGACTTCAGGTGG + Intergenic
1068594545 10:58888516-58888538 CCTGGATTCCTGATTCCAGGAGG - Intergenic
1069151899 10:64972694-64972716 CCTGAATCCCTGAAACCAAAAGG + Intergenic
1070500018 10:77063822-77063844 CATGCATTCCTGAGTCCACCTGG - Intronic
1072672964 10:97445124-97445146 CCTCAATTAGTGGGTCCAGAAGG + Intronic
1073949416 10:108789138-108789160 CATGAATTCCTGATTCTAGATGG + Intergenic
1075167695 10:120084110-120084132 TCTGAATTCCAGAGTGCAGAGGG - Intergenic
1076697851 10:132255757-132255779 CCTGGACTCCTCAGTCCAGAGGG + Intronic
1078898042 11:15615553-15615575 CATGAATTCCTGAGAACAAAGGG + Intergenic
1079033177 11:17000864-17000886 CCTGAATTCCTTTGTCTATAGGG - Intronic
1081806980 11:45896199-45896221 CCTGCCTTCCTGGGTCCTGAAGG + Intronic
1081992448 11:47345213-47345235 CCTGAACTGCTGAGCCCAGAGGG - Intronic
1082054041 11:47798167-47798189 CCCAAATTCCTGATTCCAGCAGG - Exonic
1084483381 11:69434631-69434653 ACTGAATTCCTAAGGCCGGATGG + Intergenic
1085044705 11:73346097-73346119 CCTGAATTACTGAGTCCCCAAGG - Intronic
1085545346 11:77312914-77312936 CCCTAATTCCTAAGTCCAGATGG + Intergenic
1086507302 11:87519113-87519135 GCTAAATTTCTGAGTCCAAATGG + Intergenic
1088384364 11:109236785-109236807 CCTCAATCCCAGATTCCAGAGGG + Intergenic
1088471992 11:110196662-110196684 CCTGGATTCCTGAGTTGGGAAGG - Intronic
1090893143 11:130945375-130945397 CTGGAAGTCCTGACTCCAGAAGG - Intergenic
1091060731 11:132459204-132459226 CCTGAAGGCCTGAGGCCAGGAGG - Intronic
1092140375 12:6179464-6179486 CCTGCATTCCAGAAACCAGAGGG + Intergenic
1092685042 12:11033527-11033549 CCTGAATTCCTGACACAACAAGG - Intronic
1092686323 12:11051149-11051171 CCTGAATTCCTGACACAACAGGG - Intronic
1092687247 12:11063678-11063700 CCTGAATTCCTGACACAACAAGG - Intronic
1092688555 12:11079637-11079659 CCTGAATTCCTGACACAACAAGG - Intronic
1092689735 12:11094448-11094470 CCTGAATTCCTGACACAACAAGG - Intronic
1092692986 12:11135644-11135666 CCTGAATTCCTGACACAACAAGG - Intronic
1093672003 12:21888097-21888119 CCTAAATTGCTGAGGACAGAGGG + Intronic
1094040956 12:26122048-26122070 CCTGAATCCTTGCGTCCCGAAGG - Exonic
1094170909 12:27490848-27490870 CTTGACCTCCTGAGTCCAGAAGG - Intronic
1095445134 12:42275262-42275284 CTTGAACTCCTGACTCCAGTTGG + Intronic
1096530464 12:52239500-52239522 CCTGAATTCCTGAGTCCAGAAGG - Intronic
1096817738 12:54212269-54212291 CTTGACTTCCAGAGTTCAGAAGG - Intergenic
1098631222 12:72724499-72724521 CACTAGTTCCTGAGTCCAGAGGG - Intergenic
1100731840 12:97479521-97479543 CCTGAATTGCTAAATCCAGTGGG + Intergenic
1101187242 12:102292164-102292186 CCAGTCTTCCTGAGTCCAGCAGG + Intergenic
1101322227 12:103682641-103682663 CCTGAATTCTTTACTCCAGAGGG - Intronic
1102989553 12:117305053-117305075 CCTGCAATCCTGAGTCAGGAAGG - Intronic
1105241778 13:18614936-18614958 CCCCAATTCCTGAGTGGAGAAGG - Intergenic
1106125997 13:26900461-26900483 CCAGAATTCCTGAGAGGAGAAGG - Intergenic
1106449037 13:29863276-29863298 CTTGAATTCCTGGGTCCAAGTGG - Intergenic
1106564501 13:30872770-30872792 CCTGCATTCCTGAGTTTTGAAGG + Intergenic
1106761516 13:32873114-32873136 CCTGAATAACAGAGGCCAGATGG + Intergenic
1119565628 14:75626758-75626780 CATGGAATCCTGAGTCTAGAAGG - Intronic
1121127389 14:91417220-91417242 TCTGAATCCCTGAGACCAGCCGG - Intronic
1121453921 14:94026681-94026703 CCTGAAATACGGAGTCCGGACGG + Intronic
1121611781 14:95285906-95285928 CCTGGAGTGCTGAGTGCAGAAGG - Intronic
1202844247 14_GL000009v2_random:152633-152655 CCCCCATTTCTGAGTCCAGAAGG + Intergenic
1202913645 14_GL000194v1_random:142876-142898 CCCCCATTTCTGAGTCCAGAAGG + Intergenic
1202879018 14_KI270722v1_random:39817-39839 CCCCCATTTCTGAGTCCAGAAGG - Intergenic
1123420246 15:20125247-20125269 TTTGAATTCCTGGGTCCAGAGGG - Intergenic
1123445612 15:20328285-20328307 TTTGAATTCCTGGGTCCAGAGGG + Intergenic
1123529470 15:21131783-21131805 TTTGAATTCCTGGGTCCAGAGGG - Intergenic
1123903601 15:24900413-24900435 CCTGACTTTCTGTTTCCAGATGG - Intronic
1125497246 15:40208316-40208338 CTTGAACTCCTGACTTCAGATGG - Intronic
1125641695 15:41236479-41236501 CTTGAACTCCTGAGTTCAGGTGG + Intronic
1125677120 15:41508104-41508126 GCTGAATGCCTGTGCCCAGAAGG - Exonic
1125723799 15:41857734-41857756 CCAGCAGTCCTGAGTCCACAAGG - Intronic
1127619573 15:60720522-60720544 ACTGAGTTCCTGAGGCAAGAGGG - Intronic
1128905602 15:71465298-71465320 CCTGAACTGCTGAGTTCAAAGGG - Intronic
1132812772 16:1809537-1809559 TCTGAACTCCAGGGTCCAGAAGG + Intronic
1133060045 16:3168811-3168833 GGAGAATTCCTGAGTCCAGGAGG - Intergenic
1133654404 16:7846142-7846164 CCCGAATTCATTAGCCCAGAAGG - Intergenic
1134342606 16:13358890-13358912 CCTGTATTCCTCATTCCAGCAGG - Intergenic
1134741023 16:16545341-16545363 CCAGAATGCTTGAGACCAGAAGG - Intergenic
1134926475 16:18166782-18166804 CCAGAATGCTTGAGACCAGAAGG + Intergenic
1135849536 16:25950685-25950707 ACTGCATTCCTGAGCCCAGGAGG + Intronic
1136721132 16:32320321-32320343 TTTGAATTCCTGGGTCCAGAGGG - Intergenic
1136839514 16:33526607-33526629 TTTGAATTCCTGGGTCCAGAGGG - Intergenic
1137338112 16:47571580-47571602 CATGAAAGCCTGAGCCCAGAGGG + Intronic
1138578506 16:57924063-57924085 CCTGAATTTCAGAGACAAGAAGG + Intronic
1138658205 16:58502597-58502619 CCTGAGTTCCTGCCTCCAAATGG - Intronic
1139574634 16:67833312-67833334 CCTGAACTTCTGCGTCCCGAGGG - Intronic
1140231344 16:73119765-73119787 CTTGAATTCCTGAGTTCAAGTGG + Intergenic
1140665841 16:77226437-77226459 CCAAAATTCCTGACTCCAAAGGG - Intergenic
1203005300 16_KI270728v1_random:197449-197471 TTTGAATTCCTGGGTCCAGAGGG + Intergenic
1203136850 16_KI270728v1_random:1733570-1733592 TTTGAATTCCTGGGTCCAGAGGG + Intergenic
1203149680 16_KI270728v1_random:1826892-1826914 TTTGAATTCCTGGGTCCAGAGGG - Intergenic
1142977748 17:3655844-3655866 CCTCAAGTCCTGGCTCCAGAGGG - Intronic
1143606214 17:7987817-7987839 CCTGAATTAGTGACTTCAGAGGG - Intergenic
1143640021 17:8190432-8190454 CTCAAATTCCTGAGTCCCGAGGG + Exonic
1144144495 17:12384138-12384160 CTGGACTTCCTGAGTCCAGTGGG + Intergenic
1144284940 17:13764775-13764797 ACTGAAATCATGAGTCCAGGAGG - Intergenic
1144308615 17:13992199-13992221 CCTGAATTTCTGTGTGGAGATGG + Intergenic
1146918161 17:36691316-36691338 GCAGAGTTCCCGAGTCCAGAGGG - Intergenic
1148017209 17:44530299-44530321 CCTGAACTCCTGAGTTCAAGCGG + Intergenic
1148675192 17:49440796-49440818 CAGGACTTCCTGAGTCCAGATGG - Intronic
1148949593 17:51298911-51298933 CTTGAATTCCTGAAACCAGTGGG + Intergenic
1149651172 17:58277524-58277546 CTTGTCTTCCAGAGTCCAGAAGG + Intronic
1149764223 17:59261579-59261601 CTTGACTTCCTGGGTTCAGATGG + Intronic
1152170835 17:78746857-78746879 CTTGACCTCCTGAGCCCAGATGG - Intronic
1152207284 17:78980900-78980922 CCTGAGCTCCTGGGTCCAGCTGG + Intergenic
1152904664 17:82963629-82963651 CTTGAATTTCTGATTCAAGATGG - Intronic
1154447184 18:14444970-14444992 CCCCAATTCCTGAGTGGAGAAGG + Intergenic
1155323159 18:24638737-24638759 ACTTAGTTTCTGAGTCCAGAGGG + Intergenic
1155908656 18:31483505-31483527 CTTGAATTCCTGTGTTCAGGTGG + Intergenic
1158418431 18:57271160-57271182 CATGAATTCCTGGGTCCTGGGGG - Intergenic
1159880898 18:73857626-73857648 CCTCAATGCCTGAACCCAGAGGG + Intergenic
1160048545 18:75409794-75409816 CCTGAGGACCTGAGTGCAGATGG - Exonic
1160542298 18:79630766-79630788 CCTGAGATCCTGACTCCCGACGG + Intergenic
1160765784 19:807047-807069 CCTGAAATGCTGATTCCAGGAGG - Intronic
1161043879 19:2124162-2124184 CCGGGATTCCAGACTCCAGAGGG - Intronic
1162987178 19:14278060-14278082 GCTGGACTCCTGAGTCCAGTGGG + Intergenic
1163304465 19:16469173-16469195 CCTGCCTTCTAGAGTCCAGAAGG - Intronic
1164765016 19:30757981-30758003 CCTGGATGCCTGACTGCAGATGG + Intergenic
1165450228 19:35878146-35878168 ACTGAATCCCTGAACCCAGAAGG + Intronic
1167337880 19:48897688-48897710 CCTGGACTCCTGTGTCCTGAAGG - Intronic
1167632158 19:50632038-50632060 CCTGAATTCCTGGGTCCAGAGGG - Intronic
1167760845 19:51447897-51447919 CCGGACTTCCTGGGTCCAGTAGG - Intergenic
1202654637 1_KI270708v1_random:8825-8847 CCCCCATTTCTGAGTCCAGAAGG - Intergenic
1202689781 1_KI270712v1_random:78576-78598 TTTGAATTCCTGGGTCCAGAGGG - Intergenic
925247354 2:2395778-2395800 CCTGAGTTCCTGAGCCCTGCTGG - Intergenic
925550457 2:5068422-5068444 CCCAAATGCCTGTGTCCAGACGG + Intergenic
926697674 2:15782190-15782212 GATGAATTCCTGTGTGCAGAGGG - Intergenic
927650755 2:24912241-24912263 CCTGAACTCCTGAGCTCAGGCGG - Intronic
929056089 2:37877264-37877286 TCTGACTTCCAGAGTCCTGAAGG - Intergenic
931749217 2:65316342-65316364 CCTGCATTCCTCTGTCCAAAGGG - Intronic
932562945 2:72888408-72888430 CCTGACTTCCAGCGTCCTGAAGG + Exonic
933956640 2:87377446-87377468 TTTGAATTCCTGGGTCCAGAGGG + Intergenic
934240782 2:90269473-90269495 TTTGAATTCCTGGGTCCAGAGGG + Intergenic
934272410 2:91547286-91547308 TTTGAATTCCTGGGTCCAGAGGG - Intergenic
934914409 2:98288833-98288855 CTTCAATTCCTGAGTTCACATGG + Intronic
935428638 2:102948974-102948996 CCTGAATTACTGAGTCCTCCAGG + Intergenic
936148452 2:109997197-109997219 TTTGAATTCCTGGGTCCAGAGGG - Intergenic
936196225 2:110374171-110374193 TTTGAATTCCTGGGTCCAGAGGG + Intergenic
936259809 2:110949083-110949105 CATGAATAGCTGAGTCCAGCTGG + Intronic
938119140 2:128621593-128621615 ACTCACTTTCTGAGTCCAGAAGG - Intergenic
942359420 2:175156485-175156507 GCTGAATCTCTGACTCCAGATGG - Intronic
942752407 2:179302817-179302839 CCGGGTTTCCTGAGTACAGAGGG + Intergenic
942887373 2:180942911-180942933 CATGAAATCCTGAATCCATATGG - Intergenic
943028253 2:182654993-182655015 CCAGAATTTCTGAGGCCAAATGG - Intergenic
943828955 2:192433878-192433900 CCCAAATTCCAGAGTCAAGAAGG - Intergenic
947032686 2:225815886-225815908 CCTGAATACCTGAAGTCAGATGG + Intergenic
947161219 2:227216930-227216952 CCTCAAATCCTGTGTCCAAATGG + Intronic
1172055148 20:32149717-32149739 GCTGAATGCCTGAGCCCAGCAGG - Exonic
1172470205 20:35187840-35187862 TCTACATTCCTAAGTCCAGATGG + Intergenic
1172604668 20:36206580-36206602 GCTGAATTCCTTAGACCTGAGGG + Intronic
1173547741 20:43912024-43912046 CCTGATTTCCTGATCTCAGAAGG - Intergenic
1174092774 20:48062694-48062716 CCTGGATGGCTGAGTCCACATGG - Intergenic
1176640323 21:9297273-9297295 CCCCCATTTCTGAGTCCAGAAGG - Intergenic
1177538883 21:22465628-22465650 CCTGCATGCCTGAGGCCAGCTGG - Intergenic
1179521429 21:41948181-41948203 ACAGAAGGCCTGAGTCCAGATGG + Intronic
1179911836 21:44455044-44455066 CCAGAAGTCCTGATGCCAGAGGG + Intergenic
1180319636 22:11308319-11308341 CCAGAATGCCTGAGTCCCGCAGG + Intergenic
1180373630 22:12070110-12070132 CCCCCATTTCTGAGTCCAGAAGG - Intergenic
1180388865 22:12205571-12205593 CCCCCATTTCTGAGTCCAGAAGG + Intergenic
1180424366 22:12904736-12904758 CCCCCATTTCTGAGTCCAGAAGG - Intergenic
1180551639 22:16545987-16546009 TTTGAATTCCTGGGTCCAGAGGG + Intergenic
1181352363 22:22267936-22267958 TTTGAATTCCTGGGTCCAGAGGG - Intergenic
951338028 3:21447977-21447999 ACAAAATGCCTGAGTCCAGATGG - Intronic
952076386 3:29701993-29702015 GCTGGGTTCCTGAGTCCAGTGGG + Intronic
953213770 3:40898675-40898697 CCTGAGACCCTGAGTCCAGGAGG - Intergenic
953566644 3:44037706-44037728 TCTGAATTACTGGGTGCAGACGG - Intergenic
956311705 3:67888120-67888142 CCTGACTTCCTGGGTCGAGTGGG + Intergenic
959416561 3:106082844-106082866 ACTGAATTCCTGAATCTGGAAGG + Intergenic
959800368 3:110487117-110487139 CCTGCATTCCTGGGTCAAGCTGG - Intergenic
961432152 3:126890932-126890954 CCTGAATTTCTCAGTGAAGAAGG + Intronic
962203730 3:133418572-133418594 CCTGAATTCCTGGGTGCAGTTGG + Intronic
962315589 3:134357553-134357575 CCTGAGCTCCTGGGACCAGATGG + Exonic
964704325 3:159602056-159602078 CATGAATCCCTGATACCAGATGG - Intronic
967434096 3:189424618-189424640 CCAGAATTTCTGAGTCCAGTAGG - Intergenic
967679568 3:192344950-192344972 ACTGAATTCTTCAGACCAGACGG - Intronic
971223096 4:24726942-24726964 CTTGGAGTCATGAGTCCAGATGG + Intergenic
973555798 4:52081425-52081447 CCTGAAGCCCTGAGGCCAGAAGG - Intronic
975626209 4:76350141-76350163 TCTGAATTTCAGTGTCCAGAGGG + Intronic
977577616 4:98691561-98691583 TCTGAATTCCTGAGAACAGATGG + Intergenic
979559638 4:122087731-122087753 CCGGAATGCCTGGGTTCAGATGG + Intergenic
980822537 4:138036282-138036304 ACTGAACTCCTGAGGCAAGATGG + Intergenic
981591355 4:146366214-146366236 CCAAAAATCCTGAGGCCAGATGG + Intronic
984451881 4:179913044-179913066 CTTGAATTCCTGACTTCAGGTGG + Intergenic
985127946 4:186714010-186714032 CCTTTATCCATGAGTCCAGACGG - Intronic
1202755204 4_GL000008v2_random:55549-55571 CCCCCATTTCTGAGTCCAGAAGG - Intergenic
988599722 5:32628436-32628458 CCTGAAGATCTAAGTCCAGAGGG - Intergenic
989737622 5:44727936-44727958 CCTTAATAAATGAGTCCAGATGG + Intergenic
991492875 5:67200401-67200423 CCTGCTTTCCTGCCTCCAGATGG + Intergenic
993704193 5:91150928-91150950 CCTGAATTCCTTTGGCCAGGAGG + Intronic
997211493 5:132079634-132079656 CCTGAAATCTTGAGTTCTGATGG - Intergenic
997975858 5:138440886-138440908 CCTGAGTTCATCAGTCCAGCGGG + Intronic
998020816 5:138768658-138768680 CCTGAACTCCTGGGTACAGGTGG + Intronic
998241568 5:140450662-140450684 CCTGAGTACCTGAGACTAGAGGG + Intronic
999006224 5:147982449-147982471 TCTGACTTCCTGAGTTCAAAAGG + Intergenic
1001681954 5:173564445-173564467 CTTTAATTCCTGGGTCCAGAAGG + Intergenic
1002443448 5:179275932-179275954 CCAGGATGCCTGAGCCCAGAGGG - Intronic
1002793286 6:450423-450445 CCTGGACTCCTGAGTCTAGGGGG + Intergenic
1002841762 6:912600-912622 TCTGAAGTCCTGAGTTTAGAAGG + Intergenic
1003736734 6:8886223-8886245 CTGGAATTCCTGGGTTCAGAAGG - Intergenic
1004455357 6:15786869-15786891 CCTGAAGTCCTGAGCAAAGAAGG + Intergenic
1004571969 6:16855047-16855069 CCTGATTGCCTGAATCCAAAGGG - Intergenic
1006451343 6:34107428-34107450 CTCGTATTGCTGAGTCCAGAAGG + Intronic
1006583914 6:35092991-35093013 CCTGACTTCCTGAACCCAGAGGG + Intergenic
1006949880 6:37812939-37812961 TCCCAATTCCTGTGTCCAGAAGG + Intergenic
1007097173 6:39220486-39220508 GGAGAATTCCTGCGTCCAGATGG - Intronic
1007829321 6:44626554-44626576 ACTAAATTCCTGAGTTCACAGGG - Intergenic
1007926843 6:45656440-45656462 CCAGAAATCCTGGCTCCAGAAGG - Intronic
1008072473 6:47111817-47111839 CCTGCATTCCTGAGCCAGGATGG + Intergenic
1009584759 6:65585410-65585432 CCTCAATTCATGAATCTAGATGG + Intronic
1010625511 6:78133058-78133080 CTGGACTTCCTGAGTCCAGTGGG + Intergenic
1013288606 6:108700678-108700700 CCAGAAACCCTGAGGCCAGATGG - Intergenic
1013512216 6:110855550-110855572 CCTGAATTCCTGCATCTAGAAGG + Intronic
1014672031 6:124316865-124316887 CCTGAATCTTTGAATCCAGAAGG - Intronic
1016139431 6:140589693-140589715 CCAAAATTCCTTAGTCCAAATGG + Intergenic
1016223469 6:141705059-141705081 CCTGAAGGCCTGAATTCAGAAGG + Intergenic
1017514504 6:155143854-155143876 CCCCAATTCCTGATGCCAGAAGG + Intronic
1018880941 6:167879552-167879574 CCTGAAATCTGAAGTCCAGATGG - Intronic
1018997205 6:168719075-168719097 CCTGAATGCCTGAGAGCACAGGG - Intergenic
1020021153 7:4869909-4869931 CTTGAACTCCTGAGTTCAGGTGG - Intronic
1021201520 7:17733090-17733112 CTGGAATTCCTGGGTCCAGTGGG + Intergenic
1022798832 7:33755682-33755704 ACTGATTTCATGAGTACAGAAGG - Intergenic
1023883317 7:44333968-44333990 CCTGAATAACTGAGCCCACAGGG - Intronic
1024005953 7:45224933-45224955 CCTGAAATCCTCTGTCCTGAGGG + Intergenic
1024988082 7:55213219-55213241 CCTGAAGTCCTGCTTCCACAAGG - Intronic
1029425179 7:100490136-100490158 TCCCAATTCCTGAGCCCAGAAGG - Intronic
1029692256 7:102190266-102190288 ACAGAGTTCCTGAGTCCAGGAGG - Intronic
1029728384 7:102423759-102423781 CTTGAACTCCTGGGCCCAGAAGG + Intronic
1030171539 7:106607755-106607777 GCTGGATTTCTGAGTGCAGATGG - Intergenic
1032176020 7:129626758-129626780 CCTGATTTCCTGATCACAGAAGG - Intronic
1033161334 7:138999882-138999904 CTTGAACTCCTGTGTCCAGTTGG + Intergenic
1033905827 7:146201001-146201023 CCTGAATTACTGAATCCAAAAGG + Intronic
1034192927 7:149224982-149225004 CCTGATTTCCTGATCTCAGAAGG - Exonic
1034452634 7:151145415-151145437 ACTGAATCCCTTAGTCCAGAAGG + Intergenic
1035289536 7:157828889-157828911 CCTGAATTGGTGACTCCAAACGG - Intronic
1036632058 8:10522912-10522934 CCTGAATTCCTGACCTCAGGTGG - Intergenic
1040739636 8:50557501-50557523 TCTGCATTACAGAGTCCAGAGGG - Intronic
1040782309 8:51124144-51124166 CCAGAATTACTGAGTCCAGAAGG + Intergenic
1044741913 8:95336289-95336311 TCTCTATTCCTGACTCCAGACGG + Intergenic
1045154939 8:99457249-99457271 CTTGAACTCCTGACTACAGATGG + Intronic
1047195415 8:122716662-122716684 ACTGAAATCCTGAGTTGAGAAGG - Intergenic
1048705327 8:137147137-137147159 GGTGAATGACTGAGTCCAGAGGG - Intergenic
1049716814 8:144096811-144096833 CCTGTGTTCCTGGGTCCAGGAGG + Intronic
1051844742 9:21438741-21438763 CCTGAAGTCCTGTGTCCTCAGGG + Intronic
1052971307 9:34378794-34378816 CCTGAATCCCAGAGCCCAAACGG - Intergenic
1055644667 9:78351672-78351694 CATTAAATCCTAAGTCCAGAAGG + Intergenic
1057304700 9:93905296-93905318 CCTGAGGTCCTGAGGTCAGAGGG + Intergenic
1058470022 9:105268235-105268257 CATGAATTCCTGAGTTTTGAGGG + Intronic
1058508930 9:105694929-105694951 TCTGACTTACTGAGTGCAGATGG + Intronic
1060256341 9:122034497-122034519 CCTGAATGCCTGTCTCCAGGAGG + Intronic
1061303134 9:129717940-129717962 CCTGATCACCTGAGTCCACATGG - Intronic
1062188146 9:135229535-135229557 CTGGCATTCCTGACTCCAGATGG + Intergenic
1203755833 Un_GL000218v1:125174-125196 CCCCCATTTCTGAGTCCAGAAGG + Intergenic
1203715208 Un_KI270742v1:137842-137864 CCCCCATTTCTGAGTCCAGAAGG + Intergenic
1203536011 Un_KI270743v1:40384-40406 CCCCCATTTCTGAGTCCAGAAGG - Intergenic
1187952625 X:24485762-24485784 CCTGAATTCCTGATTACACTGGG - Intronic
1188476416 X:30597580-30597602 TCTTACTTCCTGAGTCCTGATGG + Intergenic
1192443309 X:71191228-71191250 TATAAATTCATGAGTCCAGAGGG - Intergenic
1192472730 X:71413202-71413224 GCCGAATTGCTGAGTCCACATGG + Intronic
1196920580 X:120581311-120581333 CCTGAATCCCTGAGTCCTAGCGG - Intergenic
1197032594 X:121835541-121835563 GATGAATTTCTAAGTCCAGATGG + Intergenic
1199505199 X:148553633-148553655 CCTGAATCCCTGTGGTCAGAAGG + Intronic
1199986647 X:152957436-152957458 CCTTAACTACTGAGCCCAGAAGG + Intronic
1200280718 X:154774814-154774836 CATGTACTCCTGCGTCCAGATGG - Intronic
1200989013 Y:9332814-9332836 CCTGAAATCCAGAATACAGATGG - Intergenic
1202117761 Y:21488547-21488569 CCTGAAATCCAGAATACAGATGG + Intergenic
1202200993 Y:22347713-22347735 CCTGAAATCCAGAATACAGAAGG + Intronic