ID: 1096530471

View in Genome Browser
Species Human (GRCh38)
Location 12:52239524-52239546
Sequence CAGGCTAAGGATTCGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096530460_1096530471 10 Left 1096530460 12:52239491-52239513 CCCTTTATCCCTTCTGGACTCAG 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 101
1096530463_1096530471 2 Left 1096530463 12:52239499-52239521 CCCTTCTGGACTCAGGAATTCAG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 101
1096530464_1096530471 1 Left 1096530464 12:52239500-52239522 CCTTCTGGACTCAGGAATTCAGG 0: 1
1: 1
2: 1
3: 37
4: 245
Right 1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 101
1096530461_1096530471 9 Left 1096530461 12:52239492-52239514 CCTTTATCCCTTCTGGACTCAGG 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 101
1096530459_1096530471 14 Left 1096530459 12:52239487-52239509 CCTGCCCTTTATCCCTTCTGGAC 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096530471 Original CRISPR CAGGCTAAGGATTCGGGAGG AGG Intronic
905363829 1:37438131-37438153 AAGGGTAGGGATTCGGGTGGAGG - Intergenic
905768405 1:40622049-40622071 CAAGCTCAGGGTTCGGGGGGAGG + Exonic
906480583 1:46196940-46196962 TAGGCTAAGGATGGGGTAGGGGG - Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
1062824572 10:558302-558324 CAGGGTCAGGAAGCGGGAGGTGG - Intronic
1063368282 10:5504658-5504680 CAGGGTGAGGACTCGGAAGGTGG + Intergenic
1068198374 10:53748164-53748186 CGGGCTAAGGATACGGGCAGTGG - Intergenic
1069950357 10:72014462-72014484 CAGGTTAAGATTTGGGGAGGGGG - Intergenic
1070797266 10:79223918-79223940 CAGGCCAAGGAATTGGGGGGAGG + Intronic
1071328399 10:84538803-84538825 CAGGCCAGGGATTGGGGTGGGGG + Intergenic
1075419005 10:122287058-122287080 CAGGCTCAGGCTCAGGGAGGGGG - Intronic
1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG + Intergenic
1078534252 11:12160498-12160520 AAGGTTCAGGATTCGTGAGGAGG - Intronic
1079451324 11:20601779-20601801 CAGGTGATGGATGCGGGAGGCGG + Intronic
1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG + Intergenic
1084238926 11:67805690-67805712 CAGGATAAGGGTCCTGGAGGCGG + Intergenic
1084521478 11:69665817-69665839 CAGGTTTAGAGTTCGGGAGGAGG + Exonic
1084647367 11:70466269-70466291 AGGGCTAAGAATTCAGGAGGCGG - Intergenic
1085302088 11:75464680-75464702 CAGGTTTAGGCTTGGGGAGGTGG + Intronic
1089678678 11:120107499-120107521 GAGGCAAAGGAGTGGGGAGGGGG - Intergenic
1091978955 12:4850282-4850304 CAGGCTGAGGGTCCGAGAGGGGG + Intronic
1093053630 12:14532856-14532878 CAGTCTCAGGATGCTGGAGGGGG + Intronic
1095987865 12:48011534-48011556 CTGGCTAAGGATTCCAGAGTCGG - Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096896130 12:54821937-54821959 CAGCCTAAGGATCCTGGAGGTGG - Intergenic
1101046406 12:100810591-100810613 CAGGATAGTGATTCTGGAGGTGG + Intronic
1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG + Intergenic
1102574581 12:113848230-113848252 CAGGCTAAAGAGTGGGGAGAAGG + Intronic
1105014433 12:132777494-132777516 GAGGCTCAGGATTCTGGAGACGG + Intronic
1107437095 13:40389754-40389776 CAGGCTAAGGATGCAGGAACTGG - Intergenic
1120064182 14:80020342-80020364 CAGGCTCAGGATTAGGGATTGGG - Intergenic
1124220537 15:27846758-27846780 CAGGGAAAGGAATGGGGAGGAGG + Intronic
1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG + Intronic
1127975050 15:63990934-63990956 CAGGCAGAGGAGTAGGGAGGGGG - Intronic
1128468307 15:67930919-67930941 CAGACTAAGGAAGCTGGAGGGGG + Intergenic
1133206697 16:4238359-4238381 CAGCCTATGGACTCAGGAGGGGG - Intronic
1141783478 16:86181587-86181609 CAGGCTGAGGGTTGGGGAGCTGG - Intergenic
1144398517 17:14870468-14870490 TAGGCTAAGGAGGAGGGAGGGGG + Intergenic
1144552802 17:16256422-16256444 GAGGCAGAGGAATCGGGAGGTGG - Intronic
1145961186 17:28887351-28887373 CAGGCTAGGGACTAGGGAAGAGG + Intronic
1149536962 17:57440736-57440758 CAGGGTAAGGACTGAGGAGGTGG + Intronic
1159001976 18:62982499-62982521 CAGGGTAAGTATTAGGGAGAAGG + Intergenic
1161828544 19:6586176-6586198 CAGGCTGATGCTACGGGAGGCGG + Exonic
1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG + Intronic
1164650169 19:29885731-29885753 CAGGCTCAGGAGCTGGGAGGGGG - Intergenic
1166228932 19:41414300-41414322 CAGGGTTAGGACTCTGGAGGGGG + Intronic
1166695344 19:44848603-44848625 GAGGCGAAGGATTGGGGTGGGGG - Intronic
1167533746 19:50035764-50035786 CAGGCTGAGCATTAGAGAGGTGG + Intronic
1168288357 19:55345494-55345516 GAGGATGAGGATGCGGGAGGTGG + Intronic
1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG + Intronic
929826559 2:45313451-45313473 AAGGGTTAGGATTTGGGAGGAGG + Intergenic
929954872 2:46449374-46449396 CAGGCTGTGGATTAGGAAGGGGG - Intronic
930561015 2:52959908-52959930 CAGGCTCAGGATGCGGTGGGTGG + Intergenic
933813510 2:86048166-86048188 CAGCCTGAGGAGTGGGGAGGAGG - Intronic
936233849 2:110726365-110726387 CTGGGGAAGGATTCAGGAGGTGG + Intergenic
942231888 2:173867848-173867870 CAGGCTCAGTATTTGGAAGGGGG - Intergenic
943114292 2:183647001-183647023 CATGCTATGGATTCTGGAGGTGG - Intergenic
947869233 2:233423755-233423777 CAGGCCAAGGATCCAGGAAGGGG - Intronic
948604043 2:239123516-239123538 CAGGCTCAGGATTGAGGAGATGG - Intronic
948777867 2:240299239-240299261 CAGGCTGAGGAGCCCGGAGGAGG - Intergenic
1170645121 20:18190958-18190980 CTGGCTAAGCCTTGGGGAGGGGG + Intergenic
1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG + Intronic
1173660429 20:44729465-44729487 CAAACTAAGGTTTCTGGAGGGGG - Intergenic
1175371514 20:58495946-58495968 CAGGCCAAGGATGGGGGATGTGG - Intronic
1178820772 21:35973118-35973140 CAGGCTAAGGATTCAGCACAGGG + Intronic
1182977865 22:34640371-34640393 CAGGCTGAGGACTCGGGGGCAGG + Intergenic
949510813 3:4765177-4765199 AAGGCTAAGCATAGGGGAGGTGG + Intronic
949988176 3:9555605-9555627 CAGGCTAAGCACTGGGGAGAAGG + Intergenic
954263367 3:49455836-49455858 CAGGGTAAGGAATTGGGAGGAGG - Intergenic
957281860 3:78161258-78161280 CAGGCTGAAGATTTTGGAGGAGG - Intergenic
962169241 3:133083185-133083207 CAGGCTGAGGAGTGGGGCGGCGG - Intronic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
970195133 4:13544633-13544655 CTGGCTCTGGATTCGGGGGGAGG - Exonic
982317733 4:154048305-154048327 CAGCCAAAGGATACAGGAGGAGG + Intergenic
989110378 5:37901745-37901767 CTGGCAAAGGAGTGGGGAGGAGG + Intergenic
990304112 5:54478149-54478171 CAGGCTAAGGAATCTGGGAGTGG - Intergenic
992869298 5:80990425-80990447 CAGTGAAAGGAGTCGGGAGGGGG + Intronic
998892247 5:146758624-146758646 GATGCTAAGGATTCAGGATGGGG - Intronic
1002104906 5:176875229-176875251 CAGGCTAAGGATGGGGGAGTGGG - Intronic
1003760357 6:9172729-9172751 CAGGCTAAGGACTCTGGGAGTGG + Intergenic
1004797526 6:19104007-19104029 CTGGCTAGAGATTCTGGAGGAGG - Intergenic
1005877400 6:30022264-30022286 GAGGTTATGGATTCGGGGGGAGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG + Intronic
1007495512 6:42257771-42257793 CTGGCCAAGAATTGGGGAGGAGG + Intronic
1011651814 6:89513362-89513384 CAGGTTAAGGATTGGGAGGGGGG - Intronic
1013130813 6:107230909-107230931 TAGGTTAAGAATTCAGGAGGCGG + Intronic
1013296767 6:108764631-108764653 CAGTCATAGGATTCTGGAGGAGG + Intergenic
1013491543 6:110651087-110651109 CAGGCAAAGGGTTGGGAAGGGGG + Intronic
1015106479 6:129542587-129542609 CAGGGAAAGGATTGGGGAGATGG - Intergenic
1016778568 6:147933488-147933510 CAGGCTAGGGAATAGGGAAGTGG + Intergenic
1019559463 7:1648745-1648767 CGGGCTGAGGATTCAGGAGAAGG - Intergenic
1022020789 7:26398172-26398194 AAGGCCCAGGGTTCGGGAGGCGG + Intergenic
1022028358 7:26469123-26469145 CAGTCAAAGGATTGGGAAGGGGG - Intergenic
1028401039 7:90425710-90425732 CAGGCTAGGGATGGGGGAGAGGG + Intronic
1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG + Exonic
1031923663 7:127619362-127619384 CAGTCTGAGGATGCTGGAGGAGG - Intergenic
1032532936 7:132636897-132636919 CATGCAAAGGATGCAGGAGGTGG + Intronic
1034289035 7:149913383-149913405 CAGACTGAGGATAGGGGAGGCGG + Intergenic
1034662036 7:152779466-152779488 CAGACTGAGGATAGGGGAGGCGG - Intronic
1039458070 8:37721065-37721087 CAGTATGAGGATTTGGGAGGTGG - Intergenic
1043226983 8:77745678-77745700 CAGCCTGAGGTTTGGGGAGGGGG - Intergenic
1049487231 8:142872749-142872771 CAGCCTATGAATTCTGGAGGCGG - Intronic
1049948057 9:617344-617366 TAGGAGAAGGATTGGGGAGGAGG + Intronic
1052022146 9:23537892-23537914 CATGCTAAGGGTAAGGGAGGGGG + Intergenic
1057180654 9:93028140-93028162 CAGGCTGAGGTTTCTGGAGCTGG - Intronic
1060384901 9:123216162-123216184 CAGGCAAAGGATTAGGAAGGGGG - Intronic
1061408055 9:130403489-130403511 CAGGAGAAGGGTTGGGGAGGGGG - Intronic
1062280753 9:135750648-135750670 CAGGATAGGGATTGGGGAGCAGG - Intronic
1062634736 9:137484861-137484883 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062634748 9:137484894-137484916 CAGCCTCAGGACTGGGGAGGCGG - Intronic