ID: 1096533933

View in Genome Browser
Species Human (GRCh38)
Location 12:52258786-52258808
Sequence GCCCCGCTGCCCGTGCGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 229}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096533931_1096533933 -5 Left 1096533931 12:52258768-52258790 CCGGGAAGCGCCTGGTCAGCCCC 0: 1
1: 0
2: 0
3: 20
4: 186
Right 1096533933 12:52258786-52258808 GCCCCGCTGCCCGTGCGCTGCGG 0: 1
1: 0
2: 3
3: 15
4: 229
1096533925_1096533933 14 Left 1096533925 12:52258749-52258771 CCGCCCGAGTTTTATGGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1096533933 12:52258786-52258808 GCCCCGCTGCCCGTGCGCTGCGG 0: 1
1: 0
2: 3
3: 15
4: 229
1096533922_1096533933 18 Left 1096533922 12:52258745-52258767 CCTCCCGCCCGAGTTTTATGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1096533933 12:52258786-52258808 GCCCCGCTGCCCGTGCGCTGCGG 0: 1
1: 0
2: 3
3: 15
4: 229
1096533929_1096533933 10 Left 1096533929 12:52258753-52258775 CCGAGTTTTATGGGGCCGGGAAG 0: 1
1: 0
2: 2
3: 12
4: 95
Right 1096533933 12:52258786-52258808 GCCCCGCTGCCCGTGCGCTGCGG 0: 1
1: 0
2: 3
3: 15
4: 229
1096533924_1096533933 15 Left 1096533924 12:52258748-52258770 CCCGCCCGAGTTTTATGGGGCCG 0: 1
1: 0
2: 0
3: 3
4: 21
Right 1096533933 12:52258786-52258808 GCCCCGCTGCCCGTGCGCTGCGG 0: 1
1: 0
2: 3
3: 15
4: 229
1096533928_1096533933 11 Left 1096533928 12:52258752-52258774 CCCGAGTTTTATGGGGCCGGGAA 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1096533933 12:52258786-52258808 GCCCCGCTGCCCGTGCGCTGCGG 0: 1
1: 0
2: 3
3: 15
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096533933 Original CRISPR GCCCCGCTGCCCGTGCGCTG CGG Intronic