ID: 1096534413

View in Genome Browser
Species Human (GRCh38)
Location 12:52262115-52262137
Sequence GGCTCTGCCACTTACAATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 1, 2: 7, 3: 43, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096534407_1096534413 28 Left 1096534407 12:52262064-52262086 CCTTCTTTATGGTATAGTGATCA 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1096534413 12:52262115-52262137 GGCTCTGCCACTTACAATGTGGG 0: 1
1: 1
2: 7
3: 43
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096534413 Original CRISPR GGCTCTGCCACTTACAATGT GGG Intronic
901503683 1:9670519-9670541 GGCTTTGACACTTAACATGTAGG + Intronic
901535745 1:9882073-9882095 TGCTCTGCCACTTCCTATGCTGG - Intronic
901663194 1:10811821-10811843 GGCTCTACCACTTACTAGCTAGG + Intergenic
901868758 1:12125337-12125359 GGCTCTGCCACTTACTCTCAGGG + Intronic
902170590 1:14607349-14607371 GGCTCTGCCACTTGCTAGCTCGG - Intronic
902229580 1:15019328-15019350 GGCTCTGCCTCTTACCAGCTGGG + Intronic
902412332 1:16218662-16218684 GGCTCCACCACTTACAATTTGGG - Intergenic
902608284 1:17581608-17581630 GACCCTGCCACTTAGACTGTGGG + Intronic
902902624 1:19530017-19530039 GGCTCTGCCAAAAACAACGTTGG + Intergenic
903385864 1:22925973-22925995 GGCAGTGCCACTTAAAATATAGG - Intergenic
903654542 1:24941304-24941326 AGCTCTGCCCCTTCCTATGTAGG - Intronic
904492673 1:30870480-30870502 GGCTCTCCCAGGTGCAATGTGGG - Intronic
905891497 1:41521274-41521296 GGCTCTGCCACGCACCATGCTGG + Intronic
905917319 1:41694868-41694890 GGCCCTACCACTTACTAGGTAGG - Intronic
907571689 1:55489849-55489871 GGCTCTGCCACTAACCAGCTGGG + Intergenic
907675683 1:56515815-56515837 GGCTCTGTCACTTACTAAGTGGG + Intronic
907782325 1:57578525-57578547 GCCTCTGCCACTTATAAACTAGG + Intronic
907927390 1:58967259-58967281 GGCTCTGTCACTCACAAGCTGGG - Intergenic
910128457 1:83872920-83872942 GGCTCTGCCACTTACTAGGTAGG - Intronic
910553814 1:88507460-88507482 GGCTCTGTCACTTACTAGTTTGG - Intergenic
910778180 1:90897289-90897311 GTGTCTGCCAATGACAATGTGGG + Intergenic
910841930 1:91569422-91569444 GGCCCAGCCACTTACTAGGTGGG - Intergenic
913459584 1:119070021-119070043 GGCTTTGCCACCTACAAACTGGG + Intronic
913564495 1:120058543-120058565 AGCTCTGTCACTTATTATGTAGG + Intronic
913633635 1:120735021-120735043 AGCTCTGTCACTTATTATGTAGG - Intergenic
914285082 1:146217892-146217914 AGCTCTGTCACTTATTATGTAGG + Intronic
914546113 1:148668631-148668653 AGCTCTGTCACTTATTATGTAGG + Intronic
914620451 1:149402034-149402056 AGCTCTGTCACTTATTATGTAGG - Intergenic
915679124 1:157563096-157563118 GGCTCTGCCACTCACCAGCTAGG + Intergenic
916003445 1:160637840-160637862 GACTCTGCCACTTACTAGTTAGG - Intronic
916244364 1:162672160-162672182 GGCTCTGTCACTTACCAGCTTGG + Intronic
916578476 1:166087665-166087687 AGCTCTGCCACTTACAAGCTGGG - Intronic
918260616 1:182792279-182792301 GGCTCCACCACTTACCAGGTAGG - Intronic
920227983 1:204451598-204451620 GGTTCTGCCACTCACAATCCTGG + Intronic
920948197 1:210549049-210549071 GGCTCTGCCACTTACTACTTTGG + Intronic
921299328 1:213735566-213735588 TGCTCTGCTACTAGCAATGTAGG - Intergenic
921299370 1:213736013-213736035 GGCTCTGCCACTTTCTTGGTAGG + Intergenic
921718289 1:218441589-218441611 GTCTCTCTCACTTACAAAGTAGG - Exonic
921840508 1:219823146-219823168 GGTTCTGCCACTTACTAGGAGGG - Intronic
922235007 1:223716035-223716057 GGCTCTGCCACTTATTATGTAGG - Intronic
1065400344 10:25293333-25293355 GACTCTCCCACTTACATAGTAGG + Intronic
1069626627 10:69871948-69871970 GGCTCTGCCACTTACTACTTGGG - Intronic
1069640471 10:69952018-69952040 GACTCTGACACATACAATATAGG + Intronic
1070540952 10:77414843-77414865 AGCTCTGCCACTTACAAGATGGG - Intronic
1070872223 10:79766151-79766173 GGCTGTGCCACTTACCAGGCAGG - Intergenic
1071639143 10:87288322-87288344 GGCTGTGCCACTTACCAGGCAGG - Intergenic
1071656094 10:87449627-87449649 GGCTGTGCCACTTACCAGGCAGG + Intergenic
1073937785 10:108654904-108654926 GGCTCTGCTCCTTACGATCTGGG + Intergenic
1075502154 10:122984931-122984953 GGCTCTGCCACTTCCTACCTGGG - Intronic
1076274574 10:129185852-129185874 TACTCTGCCACTTCCAATCTTGG + Intergenic
1077580087 11:3411685-3411707 TCCTCTGCCTCTTACAGTGTTGG + Intergenic
1077659725 11:4056875-4056897 AGCTCTGCCACTTACCAGCTTGG - Intronic
1078139903 11:8684476-8684498 GGCCCTGCCTCTGACATTGTCGG + Intronic
1079095545 11:17507713-17507735 GGCTGTGCCACTTACTAGCTAGG - Intronic
1079429716 11:20377573-20377595 GGCTCTGCTGCTTAAACTGTGGG - Intronic
1080727252 11:34910792-34910814 GGCTCTGCCTCTTGCTATCTTGG - Intronic
1081437962 11:43048775-43048797 GGCTCTGCCACTTAGGAGCTGGG - Intergenic
1082770319 11:57202800-57202822 GGCCTTACCACTTACTATGTGGG - Intergenic
1084106787 11:66985680-66985702 GGCTCTGCCACTTGCTAGCTGGG + Intergenic
1084835388 11:71798319-71798341 GCCTCAGCCTCTTACAGTGTTGG - Intronic
1085063554 11:73471255-73471277 GGATCTGCCACATACCATGATGG + Intronic
1086878039 11:92121370-92121392 GAATCTGCCACTTACCATCTTGG + Intergenic
1087768078 11:102177993-102178015 CACTCTGCCACTTACTAGGTTGG + Intronic
1089947138 11:122487670-122487692 AGCTCTGCCACTTACTAGCTGGG - Intergenic
1089973120 11:122710516-122710538 GGCTCTGCCACTTTTCAGGTGGG - Intronic
1090640781 11:128727176-128727198 AGCTCTGCCACTTATAAGCTGGG + Intronic
1091035843 11:132232565-132232587 TGCTCTGCCAGTTACTAAGTGGG + Intronic
1091541511 12:1466619-1466641 GGCTCTGCCTGTTAAAAGGTAGG + Intronic
1092050450 12:5465981-5466003 AGCTCTACCACTTACAAGTTGGG - Intronic
1092250918 12:6895931-6895953 GCCTCAGCCTCTTAAAATGTTGG - Intronic
1094117636 12:26934826-26934848 AGTTCTGTCACTCACAATGTGGG + Intronic
1096534413 12:52262115-52262137 GGCTCTGCCACTTACAATGTGGG + Intronic
1096565744 12:52476996-52477018 GGCTCTCCAACTTACCATCTTGG + Intergenic
1098849446 12:75577810-75577832 GGCTCGGCCTCCTAAAATGTTGG + Intergenic
1100562085 12:95757337-95757359 GGCTCTGCCACTTACTAGCTAGG - Intronic
1101177838 12:102174529-102174551 AGCTCTGCCACTTTCAACCTTGG - Intronic
1101759586 12:107647850-107647872 GGCTCTGCCACTTAAAAGCTGGG - Intronic
1101945062 12:109130345-109130367 GGTTCTGCCACTTACAAGCTGGG - Intronic
1102811393 12:115827334-115827356 AGCTCTGCCACTTACCAGCTTGG - Intergenic
1102960154 12:117087338-117087360 GGCTTTCACACTTACAAAGTGGG - Intronic
1103199100 12:119072012-119072034 GCCTCTGCCACTTACCAAATGGG + Intronic
1103400374 12:120639884-120639906 AGCTCTGCCACCTACCATCTGGG - Intergenic
1104282935 12:127394473-127394495 GCCTCAGCCTCTTAAAATGTTGG - Intergenic
1104584979 12:130041099-130041121 GGCTCTGCCTCTTATTATATTGG - Intergenic
1106166689 13:27253166-27253188 GGCTCTGCCACTTACTAGCTGGG - Intronic
1106429289 13:29664835-29664857 AGCTGTGCCACTTATAATGCAGG - Intergenic
1106506853 13:30378040-30378062 TGCTCTGCCACTTACCAGATAGG - Intergenic
1108041685 13:46345260-46345282 GGCTCTGCCACTTACCAGCAGGG + Intronic
1110124770 13:71929063-71929085 AGCTCTACCACTAAAAATGTAGG + Intergenic
1112100832 13:96187473-96187495 GGCTCTGCCACTGACTAACTGGG - Intronic
1112585306 13:100713734-100713756 GGCTCAGTCACTTATAATTTGGG + Intergenic
1116437744 14:44913127-44913149 GGCTCTAACACTTACCATGAAGG + Intergenic
1116700407 14:48234401-48234423 GACTCTGCCACTTACTAACTGGG + Intergenic
1117090749 14:52247668-52247690 GGCTCAGCCACTTCCTATTTGGG - Intergenic
1117987375 14:61400869-61400891 GGCTCTGGCACTTACTATCCAGG - Intronic
1118126912 14:62915903-62915925 GGCTAAGCCACTTACTATGCAGG - Intronic
1118136772 14:63037243-63037265 GGCTCTGACACTTACTAGCTCGG - Intronic
1118370378 14:65132668-65132690 GGCTCTGACACTTACTAGCTGGG - Intergenic
1118681139 14:68242837-68242859 GGCTCTACCACTAACTAGGTGGG - Intronic
1119267379 14:73271096-73271118 GGCTCTGCCACTTGCCAGCTGGG - Intronic
1119531744 14:75366415-75366437 GGCTCTGCCATCTTCAATGCAGG - Intergenic
1119590181 14:75879677-75879699 GGCCTTGTCACTTACAAAGTGGG - Intronic
1119925773 14:78491983-78492005 GCCTCTGCTGCTTACCATGTGGG + Intronic
1120684655 14:87524351-87524373 GACTCTGCCACTTAAAAGTTAGG - Intergenic
1132898770 16:2242105-2242127 GCCTCGGCCTCTTAAAATGTTGG + Intronic
1133113958 16:3565304-3565326 GGCCCTGCCACTTACCAGATAGG + Intronic
1133348615 16:5086928-5086950 GCCTCAGCCTCTTACAGTGTTGG + Intronic
1133934487 16:10257518-10257540 GGCTCTGCCACTTCCCAAGTAGG + Intergenic
1134675103 16:16084868-16084890 GCCTCTGCCTCTCACAATGCTGG + Intronic
1134819423 16:17234201-17234223 GGCTCTGTCACTCACAAGCTAGG - Intronic
1135611627 16:23872597-23872619 GGCTCTGCCACTTCCTAGTTGGG + Intronic
1136090437 16:27915886-27915908 GGTTCTGCCACTTACCGGGTGGG + Intronic
1137920119 16:52478696-52478718 AGCTCTACCACTTACAAGCTGGG + Intronic
1138036648 16:53613903-53613925 GGCTCTGCCACATTCTAAGTAGG - Intronic
1139373325 16:66481507-66481529 CACCCTGCCACTTACAAGGTGGG + Exonic
1139444239 16:66987080-66987102 GCCTCTGCCACTTATCCTGTGGG - Intergenic
1139463887 16:67143486-67143508 GGCTCTGCTGCTTACCATCTGGG + Intronic
1139820976 16:69721138-69721160 GCCTCAGCCTCCTACAATGTTGG + Intronic
1140708378 16:77652824-77652846 AGCTTTTCCACTTACTATGTGGG + Intergenic
1141519044 16:84565345-84565367 AGCTCTGCCACTTTCTATCTGGG + Intergenic
1142481612 17:222270-222292 GGCTCTTCTACTTACAACTTGGG - Intronic
1143799933 17:9370408-9370430 GGATCTGCCACTTACAGCCTGGG - Intronic
1144378131 17:14665790-14665812 AACTCTGCCACTTAGAATCTGGG + Intergenic
1144864682 17:18327535-18327557 GGGGCTGCCACCTACAAGGTGGG + Intergenic
1146225618 17:31063585-31063607 GCCTCTGCCACTTACTAGCTGGG + Intergenic
1146451661 17:32979380-32979402 GGCTCTGTCACTTACAGAATTGG - Intronic
1146939255 17:36832874-36832896 GGCTGTGCCACTTACTCTGGTGG - Intergenic
1147245426 17:39117102-39117124 TTCTCTGCCACTTTCAGTGTGGG + Intronic
1147456073 17:40538953-40538975 GGCTCTGCCACTTATTAACTAGG + Intergenic
1147497154 17:40927751-40927773 GGATCTGCCACCTACCATGTTGG + Intronic
1147887201 17:43692099-43692121 GGCTCTGCTACTTACTAACTGGG - Intergenic
1148120603 17:45208003-45208025 GGCTCTGCCACTTTATAAGTGGG + Intergenic
1148139622 17:45318821-45318843 GGCTCTGCCACTGACTAGCTGGG + Intergenic
1151434686 17:74087605-74087627 GGCTCTGCCACTTACTGACTGGG + Intergenic
1151445376 17:74160210-74160232 GCCTCAGCCTCTTACAGTGTTGG - Intergenic
1151563261 17:74882342-74882364 GGCTCTGCCGCTTACTAGCTGGG - Intronic
1153415679 18:4843513-4843535 GGCTCTGCCCCTTAATATCTTGG + Intergenic
1153555152 18:6304574-6304596 GGCTTTGCCACTCACAGTGAGGG - Intronic
1153665741 18:7366643-7366665 GGCTCTGCCACTTATTAACTAGG - Intergenic
1154404462 18:14076092-14076114 GACTCTGCCTCTTACAAGGAAGG - Intronic
1157975169 18:52319051-52319073 GGTTCTGCCACCTATAAAGTAGG + Intergenic
1157984316 18:52419999-52420021 GGCTCTGCCTCTTCCAAGGAGGG - Intronic
1158642469 18:59215256-59215278 GGCTCTGTCAATTACCATCTGGG + Intergenic
1158888531 18:61851600-61851622 GGCTCTGAAACTTACTGTGTGGG - Intronic
1159687208 18:71437443-71437465 TAGTCTGCCACTTACAATTTTGG - Intergenic
1162031078 19:7917498-7917520 GGCGCTGCCACTGCCAGTGTCGG - Exonic
1162575654 19:11497400-11497422 GGCTCTGCCCCTTCCAAGCTGGG + Intronic
1162730095 19:12713258-12713280 GGCTCTGTCACTTACAACTCTGG - Intronic
1162902779 19:13805298-13805320 GGATCTGCCACTCACCAGGTGGG - Intronic
1163350763 19:16775434-16775456 CGCTCTGCCATTTTCAGTGTAGG + Intronic
1164926962 19:32138454-32138476 GGCTCTGCCACTTACTAACTGGG - Intergenic
1165308405 19:35016110-35016132 AGCTCTGCCACTTACTAGCTGGG + Intronic
1167022798 19:46891078-46891100 AGCTCTGCCACTTTCCATCTGGG + Intergenic
925666186 2:6258781-6258803 AGCTCTGCCACTTGCCCTGTCGG - Intergenic
926209070 2:10855640-10855662 GGCTGTGCCACTTACTAGGTGGG + Intergenic
930044036 2:47153357-47153379 AGCTCTGCCACTTACCAGCTAGG + Intronic
930174548 2:48288494-48288516 AGCTCTACCACTTACAAGCTTGG - Intergenic
930232072 2:48853398-48853420 GTCTCTGCCACTGAGAATGAGGG - Intergenic
930540476 2:52699783-52699805 AGCTCTGCCATTTACAAGCTGGG + Intergenic
932253141 2:70261741-70261763 AGCTATACCACTTACTATGTGGG - Intronic
932789606 2:74642965-74642987 GGCTCTGCCACCCAAAATGCTGG + Intronic
933208740 2:79540252-79540274 GGCTCTGCCACTTACTAGCTTGG + Intronic
933800573 2:85957185-85957207 GGCTCTGCCAGTTACATTTTGGG + Intergenic
935188154 2:100753070-100753092 GGTTCTGCCACTTACCACCTGGG - Intergenic
937290815 2:120780708-120780730 GGCTCTGCCACTTACCAGCTGGG - Intronic
938295750 2:130178344-130178366 GGTTCTGCCACTTACTAGCTGGG - Intronic
938460869 2:131495475-131495497 GGTTCTGCCACTTACTAGCTGGG + Intergenic
938468007 2:131535525-131535547 GGCTCTGCCTCTGACAACCTTGG + Intergenic
938570026 2:132554380-132554402 AGCTCTGCCACTTATTATTTGGG + Intronic
938901324 2:135800770-135800792 GGCACTGCCCCCTACATTGTTGG - Exonic
940070042 2:149676711-149676733 AGCTCTGCCACTTACCAGCTGGG - Intergenic
940896342 2:159084908-159084930 GGATCTGCCACTTTCAGGGTAGG + Intronic
942158656 2:173158827-173158849 GGCTCTGCCACTTACCAGTGAGG - Intronic
943952683 2:194150573-194150595 TGCCCTGCCACTGACAATGCTGG - Intergenic
944655669 2:201874512-201874534 GGCTCTACCACTTACTTAGTTGG - Intronic
946054643 2:216889995-216890017 AGCTCTGCCTCTTACAAATTGGG - Intergenic
946526944 2:220530877-220530899 GACTCTGCCACTTACTAGCTTGG + Intergenic
947082471 2:226413782-226413804 GGCTTTGCCACTTATGAAGTGGG + Intergenic
947393315 2:229662497-229662519 GGCTCTGCCACTTACTCTCTGGG - Intronic
947750831 2:232531155-232531177 AGCTCTGCCACTTACTAGCTGGG - Intronic
948378771 2:237539124-237539146 GGCTCTGCCTTTTACTATGGGGG + Intronic
1168820218 20:767980-768002 GGCTCTGCTGCTTACAATCTGGG + Intronic
1169276407 20:4236180-4236202 GGCTCTGACACTTATAAACTGGG + Intronic
1170131063 20:13020782-13020804 GGTTCTGCCACTTACTAATTGGG + Intronic
1170838620 20:19906046-19906068 GGCTCTGCCACTTACTCTCTGGG - Intronic
1170895356 20:20407907-20407929 GAGTCTGCCACTTTTAATGTAGG - Intronic
1173476571 20:43364048-43364070 GGCTCTGCCACTGACCAGCTGGG - Intergenic
1173687304 20:44932516-44932538 GGCTCTGCCACTTCCCAAGGTGG + Intronic
1175262176 20:57681491-57681513 GGCGCTGCCTCTTACAAGGGTGG + Intronic
1175764847 20:61585124-61585146 AGCTCTGCCACTTACCGTGTTGG - Intronic
1176701431 21:10056303-10056325 GGTTCTGCCACTCACAGTGTAGG - Intergenic
1177048673 21:16203682-16203704 GTCTCTGCCTCCTACAATGCTGG + Intergenic
1177165751 21:17601224-17601246 GGCTCTGCCACTGACTAGCTTGG + Intronic
1181108076 22:20586345-20586367 GGCTCTGCCTCTAACAACCTTGG - Intronic
1181663192 22:24368975-24368997 GTCTTTGCCACTTTCCATGTGGG + Intronic
1181782512 22:25203266-25203288 GGCTCTGGCACTAACCATCTGGG + Intronic
1182322068 22:29484241-29484263 AGCTCTGCCACTCACTAGGTTGG + Intronic
1182882402 22:33744860-33744882 GGCTCTGCCACTCACAGGTTGGG + Intronic
1183046507 22:35224784-35224806 GGCCCTGCCACTTACTCGGTTGG - Intergenic
1183247785 22:36707206-36707228 AGCTCTGCCACTTACTGTCTGGG - Intergenic
1183396174 22:37572068-37572090 GGCTCTGCCACTTTCCAGCTTGG - Intronic
1183590058 22:38774765-38774787 GGCTCTGCCACTTAGGTTGTGGG + Intronic
1184275208 22:43405938-43405960 GGCTCTGCAACTTACTCTCTGGG + Intergenic
1184889040 22:47368399-47368421 GGCTCTGCCACGTACCAGCTGGG - Intergenic
949782311 3:7703501-7703523 GGCTCTGCCACTTCCAATCCGGG + Intronic
950134046 3:10568133-10568155 GGCTGTGCCCCTGACACTGTAGG + Intronic
950159149 3:10746411-10746433 GGTTCTGCCACTTCCTATCTGGG - Intergenic
950812272 3:15660189-15660211 GGCTCTGCCACTTCCTAGCTGGG - Intergenic
954929478 3:54268771-54268793 GGCTCTGCCACTTACTAGCTGGG - Intronic
955062626 3:55506293-55506315 GGCTCCACCACTTACTATCTGGG + Intergenic
955529752 3:59860901-59860923 GGCTCTGCCATTTACTAGCTGGG - Intronic
956241254 3:67133212-67133234 GGGTCTGCCAAGTACAATTTAGG + Intergenic
956478684 3:69651148-69651170 GGCTCTTCCACTTACTAGCTGGG - Intergenic
956617135 3:71183666-71183688 GGCTCTGCCACTTGCTAGTTGGG - Intronic
957052962 3:75424279-75424301 GCCTCAGCCTCTTACAGTGTTGG + Intergenic
957266788 3:77977274-77977296 GGCTCTGCTATTCACATTGTTGG + Intergenic
958569354 3:95860206-95860228 TGCTCTGGCACTTACCATGTAGG - Intergenic
960131224 3:114058020-114058042 TGCTCTGCCACTTACCAGCTGGG + Intronic
960773643 3:121224120-121224142 AGCTCTGCCACTTACTAGCTAGG + Intronic
960848350 3:122025435-122025457 AGCTCTGCTACTTACAAGCTGGG - Intergenic
961301882 3:125927258-125927280 GCCTCAGCCTCTTACAGTGTTGG - Intergenic
961671618 3:128536165-128536187 GGCTCTGCCACTTACTAGTTGGG - Intergenic
961772213 3:129258276-129258298 GGCTCTGCCCCTTACCAACTGGG + Intronic
961886591 3:130100580-130100602 GCCTCAGCCTCTTACAGTGTTGG + Intronic
962223201 3:133581625-133581647 GGCTCTGCCACTTACCAGCCAGG - Intronic
965879523 3:173371808-173371830 GGCTCAGCCACTTACTACCTGGG - Intergenic
966595598 3:181722507-181722529 GGCTCTGCGGATTTCAATGTTGG - Intergenic
967000897 3:185333642-185333664 GGCTCAGCCTCTCAAAATGTTGG - Intronic
967314035 3:188133948-188133970 AGCTCTGCCACTTACAATTTAGG - Intergenic
967368776 3:188718933-188718955 GGCTCTGTCACTAACAAATTTGG - Intronic
969207378 4:5656981-5657003 AGTTCTGCCACTTACCGTGTTGG - Intronic
969226110 4:5799481-5799503 GGCGCTGCCACTCACTAGGTTGG - Intronic
969758220 4:9164128-9164150 GCCTCAGCCTCTTACAGTGTTGG - Intergenic
969818189 4:9701650-9701672 GCCTCAGCCTCTTACAGTGTTGG - Intergenic
969974045 4:11079661-11079683 GGTTCTGCCACTTACTAGCTGGG - Intergenic
970060961 4:12033930-12033952 GGCTCTGTCACTTACCAGTTCGG + Intergenic
972064873 4:34929011-34929033 GTTTCTTCAACTTACAATGTAGG - Intergenic
972611467 4:40659462-40659484 ACCTCAGCCACTTACATTGTTGG + Intergenic
973570096 4:52229905-52229927 GGCCCTGACACTTACAACTTTGG + Intergenic
973647174 4:52961363-52961385 GGCTCTGCCTCTCTCAGTGTTGG - Intronic
976194088 4:82516422-82516444 GGCTCTGCCACTTAGTAGCTGGG + Intronic
977857463 4:101911121-101911143 AGCTCTGCCACTTACCATCTGGG - Intronic
978815821 4:112903800-112903822 GGCTCTGGCATTTACAATGCTGG + Intronic
979674874 4:123399066-123399088 GGCACTGCCACTTTAAAAGTGGG + Intronic
980373590 4:131912570-131912592 GGTTCTGCCACTCACAGTGTAGG - Intergenic
980488796 4:133497469-133497491 GACACTGATACTTACAATGTTGG - Intergenic
982713447 4:158781845-158781867 GACTCTCCCACTTACAATGTGGG + Intronic
986206170 5:5627388-5627410 GCCTCTGCTACCTACAAGGTGGG + Intergenic
987614295 5:20252686-20252708 GCCTCTGCCTCTTAAAGTGTTGG - Intronic
988779873 5:34510670-34510692 GGCTCTGCCACTTGCTAACTGGG - Intergenic
990339566 5:54808937-54808959 GGCTCTGTCACTTCAAATTTGGG + Intergenic
990990303 5:61677534-61677556 GGCTCTGCCACGGACAGTGGGGG - Intronic
991447300 5:66714057-66714079 GGCTCCTCCACTTACCATCTGGG - Intronic
993039824 5:82801521-82801543 GGCTCTGCCACTTGCTATCTGGG - Intergenic
993133635 5:83929814-83929836 GCCTCAGCCACTTTCACTGTAGG - Intergenic
993387052 5:87272448-87272470 GACTCTGCCACTTACTAGCTGGG + Intronic
994619620 5:102147542-102147564 GGCTCTCACACTTACTAGGTGGG - Intergenic
995420144 5:111955792-111955814 TGCTCTGCCTCTTACACCGTGGG - Intronic
996660012 5:125991002-125991024 GACTCTGCCACTTATAAACTGGG + Intergenic
996704135 5:126479610-126479632 GGCTCTTACACTTACTAAGTGGG - Intronic
997399270 5:133589856-133589878 GGCTCCACCACTTACTATATGGG + Intronic
999455922 5:151716012-151716034 GGCTCTGCCACATTCAACATGGG - Intergenic
999642550 5:153686465-153686487 GGCTCTGCCACTAACCAGCTGGG + Intronic
999992078 5:157058932-157058954 GGCTCTGTCACTCACAATGCTGG + Intronic
1000138940 5:158382430-158382452 AGCTCTGCCATTTACTAGGTAGG + Intergenic
1000979289 5:167799185-167799207 GGCTCTGCCATTTACCCTGCTGG - Intronic
1001121095 5:168980498-168980520 TGCTCTGCCACTTACCAAGCTGG - Intronic
1001156201 5:169274319-169274341 GGCTCTGACACTTACATTTCGGG + Intronic
1001381106 5:171307318-171307340 GGCTCTGCCACTGGCAGTGTGGG - Exonic
1001561770 5:172674466-172674488 GGCTCTGCCACTGACCGTCTTGG - Intronic
1001596905 5:172904459-172904481 GGCTCTGCCACTTAGGAGCTGGG - Intronic
1001626824 5:173143157-173143179 GGCTTTGCCACTTTCAAGATAGG + Intergenic
1001753538 5:174149256-174149278 GGTTCTGCCTCTTACCAGGTGGG - Intronic
1001864081 5:175087942-175087964 GGCTCTGCAAATTACATAGTTGG + Intergenic
1002194338 5:177494220-177494242 GGCTCTGCCTCTTACTAGCTGGG - Intronic
1002884125 6:1278831-1278853 AGCTCTGCCACTTGCAAGCTGGG - Intergenic
1003399403 6:5779251-5779273 GGCTCTGCCACTGACCAGCTGGG + Intergenic
1004178363 6:13360155-13360177 GGCTCTACCACTAAAGATGTGGG + Exonic
1004881192 6:20010141-20010163 AGTTCTGCCACTTACTAAGTGGG + Intergenic
1005653287 6:27904960-27904982 GGCTCTGTCAACTACAATATAGG - Intergenic
1007427479 6:41756849-41756871 GCCTCTGCCACTTCCAATTCTGG + Intergenic
1009290770 6:61878782-61878804 GGCTCTGCCACTTACTGGCTAGG + Intronic
1009786178 6:68342599-68342621 TACTCTGACACTTACTATGTGGG + Intergenic
1009818838 6:68773250-68773272 GGCTCTGCCACTTACAAATTGGG - Intronic
1013599265 6:111689227-111689249 AGCTCTGTCACTTACAAGCTTGG - Intronic
1015617819 6:135096967-135096989 TGCTCTGCAACTTACAAGCTGGG + Intronic
1015857674 6:137642411-137642433 GGCTCTGCCACTCACTAATTAGG + Intergenic
1019820384 7:3238597-3238619 GGCTCTGCCATTTACTAGCTGGG - Intergenic
1020776055 7:12455257-12455279 GGCTCTGCCACTTACCAACTAGG + Intergenic
1021263275 7:18485814-18485836 GTCTCTGCCACTTATTATGCAGG - Intronic
1022017654 7:26365835-26365857 CGCTCTGCCACTTACTAGCTGGG + Intronic
1022195218 7:28058870-28058892 TGCTCTGCCACTTCAAATGTTGG + Intronic
1022221782 7:28320989-28321011 GGCTCTGCCACTGACTACCTGGG + Intronic
1022343370 7:29488804-29488826 GGGTCTGCCTCGTACATTGTGGG - Intronic
1023120233 7:36901633-36901655 GGTTCTGTCACTTACAAGCTGGG + Intronic
1023162237 7:37308752-37308774 GGCTCTGCCACTCATCATCTGGG - Intronic
1023732107 7:43202174-43202196 GGCTCTGCCACTGACTAGCTAGG - Intronic
1026419935 7:70224063-70224085 GCCTCAGCCTCTTAAAATGTTGG - Intronic
1028912478 7:96224155-96224177 AGCTCTTCCACTCACAAAGTGGG + Intronic
1030645961 7:112062045-112062067 TGCTCTGCCACTTACTAGCTGGG - Intronic
1031805607 7:126303213-126303235 GGCCATGCCACTTACTGTGTGGG + Intergenic
1032473531 7:132196194-132196216 GGCTCTGCCACTTACTTACTGGG - Intronic
1033973773 7:147074130-147074152 GGGGCTGCCACTGAAAATGTTGG - Intronic
1036715017 8:11113965-11113987 GGCTTTGCCATTTACCATGCGGG + Intronic
1037126057 8:15351250-15351272 GACTCTCCCACTAACAGTGTTGG - Intergenic
1039618226 8:38974136-38974158 GGCTCTGCCCCTTAAAGTTTGGG + Intergenic
1040683871 8:49847016-49847038 TGCTCTGCCACTGAAAATGCTGG - Intergenic
1041188713 8:55330264-55330286 AGCTGTGCCACTTACTAGGTAGG + Intronic
1041504370 8:58578541-58578563 GGCTCTGACCCTCACAATGAGGG - Intronic
1043174352 8:77005317-77005339 GGCTCTGCCACTTACAAGCTTGG + Intergenic
1046777706 8:118181274-118181296 GGCTCTGCCACTTGCTATTTTGG + Intergenic
1047677445 8:127218810-127218832 AGCCCTGCCACTTACCAGGTTGG - Intergenic
1048292888 8:133193929-133193951 GGCTCTGCCACTGGCTGTGTCGG + Intronic
1048440039 8:134453041-134453063 GGCCCTGCCTCTTGCAGTGTGGG - Intergenic
1048706577 8:137160402-137160424 TGTTCTGCCACATACAAAGTGGG + Intergenic
1049573549 8:143380412-143380434 GGCTCTGCCACGTGCAAAGCAGG - Intronic
1052504397 9:29333599-29333621 GACTGTGCCACTTACAAGCTAGG - Intergenic
1052832744 9:33229247-33229269 GGCTCTGCCACTTACAATGCTGG + Intronic
1053638579 9:40042849-40042871 GGTTCTGCCACTCACAGTGTAGG - Intergenic
1053767507 9:41422343-41422365 GGTTCTGCCACTCACAGTGTAGG + Intergenic
1054319372 9:63639391-63639413 GGTTCTGCCACTCACAATGTAGG - Intergenic
1054546172 9:66333859-66333881 GGTTCTGCCACTCACAGTGTAGG + Intergenic
1055475277 9:76657241-76657263 AGTTCTACCACTTACTATGTTGG + Intronic
1056817964 9:89815459-89815481 GGCCCTGCCACTTACCCTGTTGG - Intergenic
1057602914 9:96473907-96473929 AGCTCTGCCACTTACTAGTTGGG + Intronic
1057859385 9:98627562-98627584 TGTTCTACCACTTACACTGTTGG - Intronic
1058645699 9:107129896-107129918 GGCTCTGCCACTTAATAGTTGGG - Intergenic
1058697721 9:107573941-107573963 GCCTCCGCCTCTTAAAATGTTGG + Intergenic
1059396018 9:114034627-114034649 GGCTCCACCACTTATAATCTGGG - Intronic
1060545941 9:124458992-124459014 AGCTCTGCCACTTACAAGCTGGG - Intronic
1060718830 9:125960123-125960145 AGCTCTGCCAGTTAACATGTGGG - Intronic
1060990687 9:127846999-127847021 AGCTCTGCCTCTTAAAATGCTGG + Intronic
1061048409 9:128179993-128180015 GGCTCTACCACTTACAGGCTGGG + Intronic
1061161604 9:128898731-128898753 GGCTCTGCTACTTGTGATGTTGG - Intronic
1061930740 9:133831856-133831878 GGCTCTGCCACTTACTAGCTGGG + Intronic
1202786448 9_KI270719v1_random:26389-26411 GGTTCTGCCACTCACAGTGTAGG - Intergenic
1186958739 X:14711759-14711781 GGCTCTGCCACTAACCATTGTGG - Intronic
1187361924 X:18636479-18636501 GGCCCTGCCACTTCCAAACTGGG - Intronic
1187368960 X:18688051-18688073 AGCTCTGCCACTTTCAACCTGGG - Intronic
1187562324 X:20414380-20414402 GGCTCTGCCACTTCCTAGCTGGG + Intergenic
1188655943 X:32695250-32695272 GGTTCTGCCACTTACTAATTAGG + Intronic
1189912134 X:45821080-45821102 GGCTATGCCACTTCCTAAGTAGG + Intergenic
1192330201 X:70169337-70169359 GGCTCTGCCACTCCCAAGCTGGG + Intergenic
1193558542 X:82987243-82987265 GGCTCTGCTATTTACTATCTGGG + Intergenic
1195738186 X:108034790-108034812 GGCTCTGCCACTTACTGGCTGGG - Intergenic
1198271738 X:135061889-135061911 GGCCATGCCATTTATAATGTGGG + Intergenic
1198729708 X:139716378-139716400 GACTCTGCCACTTACAAGTAGGG - Intergenic