ID: 1096536087

View in Genome Browser
Species Human (GRCh38)
Location 12:52275733-52275755
Sequence TGACCACTGGTGACAGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096536080_1096536087 18 Left 1096536080 12:52275692-52275714 CCATTTCACAGATGGAGAAAGGG 0: 1
1: 7
2: 80
3: 622
4: 3225
Right 1096536087 12:52275733-52275755 TGACCACTGGTGACAGCAGGTGG 0: 1
1: 0
2: 0
3: 19
4: 196
1096536083_1096536087 -8 Left 1096536083 12:52275718-52275740 CCCAGAGAAGCTAGGTGACCACT 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1096536087 12:52275733-52275755 TGACCACTGGTGACAGCAGGTGG 0: 1
1: 0
2: 0
3: 19
4: 196
1096536084_1096536087 -9 Left 1096536084 12:52275719-52275741 CCAGAGAAGCTAGGTGACCACTG 0: 1
1: 0
2: 1
3: 21
4: 166
Right 1096536087 12:52275733-52275755 TGACCACTGGTGACAGCAGGTGG 0: 1
1: 0
2: 0
3: 19
4: 196
1096536078_1096536087 19 Left 1096536078 12:52275691-52275713 CCCATTTCACAGATGGAGAAAGG 0: 1
1: 8
2: 83
3: 698
4: 3091
Right 1096536087 12:52275733-52275755 TGACCACTGGTGACAGCAGGTGG 0: 1
1: 0
2: 0
3: 19
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096536087 Original CRISPR TGACCACTGGTGACAGCAGG TGG Intronic
900430201 1:2597770-2597792 TGACCACGGGCCACAGCAGCCGG - Intronic
900924206 1:5692768-5692790 AGACCAGTGGTGGCTGCAGGAGG + Intergenic
902216382 1:14936895-14936917 TCTCCACTGGAGACAGAAGGGGG - Intronic
902951819 1:19890217-19890239 AGACCACGGGGGACAGCATGAGG - Intronic
903456500 1:23490918-23490940 TGACCTCTGGGTTCAGCAGGTGG - Intergenic
903732081 1:25503974-25503996 TGCCCTCTGGTGGCAGCTGGGGG - Intergenic
904616034 1:31750404-31750426 TCACCCCTGGTGCCAGCAGGCGG + Intronic
905028907 1:34868641-34868663 GGAGCACTGGTGCCAGCAGATGG - Exonic
908096309 1:60742666-60742688 TGAGCACAGGTTACACCAGGAGG - Intergenic
908117446 1:60953905-60953927 TGACCAGTGAGGACAGTAGGGGG + Intronic
912109678 1:106325802-106325824 TGTCAAATGGTAACAGCAGGAGG - Intergenic
913107508 1:115628147-115628169 AGACCACCGGTGAGTGCAGGAGG - Intergenic
915521155 1:156444986-156445008 TGTCCACTGAAGACAGCAGGAGG + Intergenic
923196459 1:231673030-231673052 TGACCTCTGGTGAGTGCAGGGGG + Intronic
1064015943 10:11772395-11772417 TCCCCACTGGTGTCAGCAGGAGG - Intergenic
1064429946 10:15262211-15262233 TGCCCAATTCTGACAGCAGGTGG + Intronic
1065377050 10:25053941-25053963 TGACCACTGGTGTAAGAAAGCGG - Intronic
1069092986 10:64224009-64224031 ACACCAGTGGTGTCAGCAGGTGG - Intergenic
1069745458 10:70712212-70712234 TGGCCCCTGGAGCCAGCAGGTGG + Intronic
1069908961 10:71748387-71748409 AGGCCACTGGTGACTGCTGGTGG - Exonic
1072021988 10:91410904-91410926 TGAGCATAGGTGTCAGCAGGCGG + Intronic
1073134245 10:101211229-101211251 TGAGCTCTGGAGACAGAAGGGGG - Intergenic
1075586835 10:123664820-123664842 TCACCACTGGCCACACCAGGAGG + Intergenic
1075863672 10:125698819-125698841 TGGCCCCTGCTGCCAGCAGGAGG - Intergenic
1076547547 10:131255476-131255498 TGACCTCTGGGGTGAGCAGGAGG + Intronic
1076617828 10:131768488-131768510 TGACTCCTGGTGATAGGAGGGGG + Intergenic
1078090139 11:8259964-8259986 TGACCACAGGAAGCAGCAGGCGG - Intronic
1079120916 11:17684277-17684299 TGACACCCGGTGACAGCAGTAGG - Intergenic
1080019805 11:27548694-27548716 GGGCCTCTGGTGACAGCTGGAGG + Intergenic
1080753874 11:35176757-35176779 CGACCACTGGGGAAAGCTGGCGG + Intronic
1081929379 11:46858195-46858217 TGGCCAGTGGTGGCACCAGGAGG + Exonic
1082242451 11:49887250-49887272 TTGTCACTGCTGACAGCAGGGGG + Intergenic
1086403895 11:86483903-86483925 GGAAAACTCGTGACAGCAGGAGG + Intronic
1091302501 11:134516343-134516365 TGAACACTGATAACAGGAGGAGG + Intergenic
1091830982 12:3551131-3551153 AGACCTCTGGAGGCAGCAGGTGG - Intronic
1092047769 12:5444470-5444492 TAATCACTGGTGAAAGTAGGAGG + Intronic
1092973658 12:13723373-13723395 TGAGCATTGCTGACAGCAAGTGG - Intronic
1095633164 12:44401379-44401401 TGACCTCTGGAAAAAGCAGGTGG + Intergenic
1096344025 12:50829200-50829222 TGACCTCAGGTGACACCAGCTGG - Intergenic
1096536087 12:52275733-52275755 TGACCACTGGTGACAGCAGGTGG + Intronic
1096685847 12:53287902-53287924 AGACACCTTGTGACAGCAGGTGG - Intronic
1096982660 12:55737375-55737397 TGGCCAATGCTGCCAGCAGGAGG - Intergenic
1100378458 12:94039602-94039624 TGACCCCTGCTGACACCATGTGG + Intergenic
1100889456 12:99108348-99108370 TGACTACTGGGGACATTAGGTGG - Intronic
1101246211 12:102886178-102886200 TGACCACTGCTGTCTCCAGGAGG - Intronic
1102655812 12:114481389-114481411 TGGCCACTGGGGACAGCTGCCGG - Intergenic
1103578080 12:121893607-121893629 TGGCCTCTGGTGACTGCTGGCGG + Intronic
1103699893 12:122843622-122843644 TGCCCAGTGCTGGCAGCAGGAGG - Intronic
1106833562 13:33610888-33610910 TGCACACTAGTCACAGCAGGAGG - Intergenic
1110746688 13:79062207-79062229 TAACCACTGGTGACATTTGGTGG - Intergenic
1111884855 13:94007336-94007358 TGAACAGTGAAGACAGCAGGAGG + Intronic
1114759760 14:25300451-25300473 TAACCAGTGATGAAAGCAGGTGG - Intergenic
1118300425 14:64610556-64610578 TGACCACGGGTGGTAGCAGCAGG + Intergenic
1119615393 14:76095635-76095657 TGACCACTGGTCAAAGGAGATGG + Intergenic
1119922086 14:78455766-78455788 TGCCCACTGGTGATAGAAGGTGG - Intronic
1121000224 14:90446578-90446600 AGCCCACTGGTCCCAGCAGGAGG + Intergenic
1122503840 14:102219256-102219278 TGAACACTGGAGGCAACAGGAGG - Intronic
1122874976 14:104659765-104659787 TGACCACTGGTGAGAAAGGGAGG + Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128038281 15:64546460-64546482 TCACCACTGGTGACAGAACAAGG - Intronic
1128469137 15:67937402-67937424 TGTCCCCTGTTGGCAGCAGGGGG + Intergenic
1129935331 15:79443394-79443416 TGACACCTGGTGAAACCAGGAGG - Intronic
1132532867 16:462169-462191 TCAGCAATGGTGCCAGCAGGAGG - Intronic
1133196881 16:4177331-4177353 TCCCCAGTGGTGAAAGCAGGAGG + Intergenic
1135402384 16:22174937-22174959 TGACCCCAGGTGACTGCAGCGGG - Intronic
1135976785 16:27113684-27113706 TGGCCATGGGTGACAGCAGCTGG + Intergenic
1138460207 16:57143477-57143499 AGACCACTGGTGCCAGTGGGCGG + Intronic
1138712776 16:58987345-58987367 GAACCAGTGGTGGCAGCAGGAGG - Intergenic
1140353954 16:74288295-74288317 GGACCACAGGTGGCAGGAGGAGG - Intergenic
1140412788 16:74751449-74751471 TGACAACTGGTGACGCCTGGTGG + Intronic
1140969910 16:80002931-80002953 TGACCAGAGGTGAGGGCAGGAGG - Intergenic
1142067818 16:88072794-88072816 TGAACACTGGAGGCAGAAGGTGG + Intronic
1142590139 17:1000966-1000988 TGACCTGTGGTGACAGCTGCTGG - Intronic
1144769037 17:17748981-17749003 TGACCTCAGGAGACAGCAGCAGG + Intronic
1145063974 17:19749619-19749641 TGTCCACTGTTGCCAGCAGGAGG + Intergenic
1146643812 17:34563054-34563076 AGACACCTGATGACAGCAGGAGG - Intergenic
1147522405 17:41187092-41187114 ACACCTCTGGTGACAGCAGAAGG + Intergenic
1149876653 17:60240833-60240855 TTACCCCAGGTGACTGCAGGTGG + Intronic
1149902141 17:60490292-60490314 TGACCACTGGGGGAAGCTGGAGG + Intronic
1150334286 17:64319281-64319303 TCACCACTGGTAACAGAAGTTGG - Intergenic
1152662793 17:81550770-81550792 GGACCACAGGTGACTGCAGGAGG + Exonic
1154082704 18:11273956-11273978 TGATCACAAGTGACAGCAAGAGG - Intergenic
1155966713 18:32042626-32042648 TGAGCAGTGGTGACAGAAGATGG - Intronic
1158118449 18:54023031-54023053 TAGCCACTGATGACAGCAGGTGG + Intergenic
1158931637 18:62329144-62329166 AGACCACTGGATACAGCATGTGG - Intronic
1160103512 18:75946398-75946420 AGACCCCTGGGGACATCAGGGGG - Intergenic
1160674602 19:383227-383249 TGACCACTGGGAACAGGAGAAGG - Intergenic
1162554505 19:11378430-11378452 TGCCCACTGGCTCCAGCAGGGGG + Exonic
1162725390 19:12687483-12687505 TGAGCAGTGGCGACAACAGGAGG + Intergenic
1162881811 19:13665427-13665449 TGACAGCTGGTGAAACCAGGAGG - Intergenic
1162936041 19:13982070-13982092 TGACCTCGGGAGACAGCAGGGGG + Intronic
1163749550 19:19067844-19067866 TCACCACTGGTGCCAGATGGAGG + Intronic
1164697388 19:30256000-30256022 AGACCACTGGGGGCAGCTGGCGG + Intronic
1166465371 19:43026782-43026804 AGAGCAATGGGGACAGCAGGAGG - Intronic
1168682954 19:58329198-58329220 TGACCGCTGGTGACCTCTGGTGG - Intronic
925306686 2:2851662-2851684 TGACCCCTGGTTCAAGCAGGTGG - Intergenic
925904209 2:8529594-8529616 TGACGACTGGTGGTGGCAGGTGG - Intergenic
927474038 2:23398593-23398615 TGACCACGGCTGACAGTATGGGG - Intronic
930024252 2:47020790-47020812 TGACCACTGGACACAGGAAGAGG - Intronic
931673069 2:64666344-64666366 TTACCTCTGGTAACAGGAGGAGG + Intronic
931712094 2:64997071-64997093 TTGCCCTTGGTGACAGCAGGAGG + Intronic
932660953 2:73651637-73651659 TGACCACTGGCAACAGGATGGGG - Intergenic
933228110 2:79774271-79774293 TTAGCACTGCTGTCAGCAGGGGG - Intronic
934535668 2:95131199-95131221 TGACATCTGGTGAAATCAGGAGG + Intronic
937238385 2:120444213-120444235 TGCCCACTGGTGAAAGCACATGG + Intergenic
940321030 2:152376648-152376670 TCACCACTGGTGTCTGGAGGAGG - Intronic
940860254 2:158763904-158763926 TGACCACTCTAGACAGCACGTGG - Intergenic
945823813 2:214696766-214696788 TGTGCACTGGTGGCAGCAGCAGG - Intergenic
946149303 2:217753409-217753431 TGACCCCAGGTGGCAGCACGCGG + Intronic
948424961 2:237881457-237881479 GGACCAAAGGTGAGAGCAGGAGG + Intronic
948595879 2:239078977-239078999 TGAACACTGGTGCCACCCGGGGG - Intronic
1169380315 20:5100926-5100948 TGCCCCCTGGTGGCAGAAGGAGG + Exonic
1170026751 20:11897170-11897192 TGACTATTTGTGACAACAGGCGG - Intronic
1170417771 20:16162723-16162745 TTACAGCTGATGACAGCAGGTGG + Intergenic
1173025415 20:39303172-39303194 TGCCCAATGGTCAGAGCAGGTGG - Intergenic
1174604512 20:51751131-51751153 TGAGCACTGGAGCCAGAAGGAGG - Intronic
1174751602 20:53116665-53116687 AGACCACTGGAGAAATCAGGAGG - Intronic
1175516591 20:59574278-59574300 TGGCCACTGGAGAGACCAGGAGG - Intergenic
1175853002 20:62103934-62103956 TGTCCTCAGGGGACAGCAGGGGG + Intergenic
1176418569 21:6495629-6495651 TGTCCACTGGTGCCTGGAGGAGG + Intergenic
1178301554 21:31457794-31457816 TGACCCCTGGAGGCAGGAGGTGG - Intronic
1178420813 21:32441931-32441953 TGTCCACTTGTGACAGCAGACGG + Intronic
1179579555 21:42332437-42332459 TGACATCTGCTAACAGCAGGTGG - Intergenic
1179694063 21:43103951-43103973 TGTCCACTGGTGCCTGGAGGAGG + Intronic
1180995587 22:19963657-19963679 TCGCCCCTGGTGACAGCAGGCGG - Exonic
1181165103 22:20979149-20979171 TGACCTCTGGGGAGACCAGGAGG + Intronic
1181819234 22:25462701-25462723 TGACACCTGGTGGCTGCAGGGGG - Intergenic
1182718566 22:32378884-32378906 TTCCCACTGGAGCCAGCAGGAGG + Intronic
1183445003 22:37847806-37847828 TCACCTCTGGTGACAGCACAAGG + Intronic
1184902498 22:47456578-47456600 TGACCACTGGAGAGAGCTTGGGG - Intergenic
1185101306 22:48842388-48842410 TGCCCGCAGGTGACAGCAGAGGG - Intronic
950045460 3:9946391-9946413 TGTCCACTGATGACAGCCCGTGG + Exonic
950173203 3:10853366-10853388 TGCCCGCAGGTGACAGCAAGCGG - Intronic
950483585 3:13259744-13259766 TGACCAGAGGTGGAAGCAGGTGG - Intergenic
953460218 3:43076148-43076170 AGACCAATGGTGGCAGCAGGAGG + Intergenic
954194411 3:48987994-48988016 TTCCCACAGCTGACAGCAGGTGG + Intergenic
956634057 3:71345721-71345743 TCAGCACTGCTGAGAGCAGGCGG + Intronic
960338953 3:116451698-116451720 TGATCACTTGTGATAGCAGATGG - Intronic
964901922 3:161670617-161670639 TTCCCAGTGGTGGCAGCAGGGGG + Intergenic
966715691 3:183011151-183011173 TGACAACTGATGGCAGCAGGTGG + Intergenic
969440527 4:7214131-7214153 TCCCCACTGGGGACAGCTGGTGG + Intronic
971785216 4:31093316-31093338 TGACTACTGCTTACAGCAAGAGG - Intronic
973330257 4:48905587-48905609 TGGCCACTGGGGGCAGGAGGAGG - Intronic
976574876 4:86657673-86657695 TGACCACTTTAGTCAGCAGGTGG + Intronic
976691333 4:87870509-87870531 TGTCCCCTGGTGACATCCGGAGG + Intergenic
984672815 4:182511172-182511194 TCACCATTTATGACAGCAGGAGG + Intronic
985042201 4:185902810-185902832 TCACCTCTGCTGACAGCAGTTGG + Intronic
986202373 5:5590058-5590080 TGACCAGGGGTGACAGCGTGAGG + Intergenic
986842467 5:11713918-11713940 AGGACACTGGGGACAGCAGGGGG + Intronic
989235084 5:39137939-39137961 TGACAACTTGTGCCAGCAAGTGG + Intronic
989553161 5:42759518-42759540 GGACCACTGTTGACCTCAGGTGG - Intronic
992231502 5:74668670-74668692 TGTCCACTGCTTATAGCAGGAGG - Intronic
993022374 5:82606313-82606335 TGCCCAGTGGTGGCAGCAGCAGG - Intergenic
995247439 5:109950475-109950497 TGACCACAGGCAACAGCAGATGG + Intergenic
996779848 5:127173032-127173054 AGACCAATAGTGGCAGCAGGTGG - Intergenic
997398504 5:133583120-133583142 TGGCCGCTGGAGACAGCAGCAGG - Intronic
1000539659 5:162524997-162525019 GGACCAGTGGTGGCAGCAGCAGG + Intergenic
1002353264 5:178600665-178600687 TGACTCCTGCTGACAGCAAGGGG - Intergenic
1004148563 6:13092506-13092528 TGTGGACTGGGGACAGCAGGTGG + Intronic
1004295227 6:14404019-14404041 TGTCCACGGCTGACATCAGGAGG - Intergenic
1006466129 6:34196015-34196037 TGACCACTGCAGACAGATGGCGG - Intergenic
1006892657 6:37442552-37442574 TGTCCAATGGGGACAGCAAGTGG + Intronic
1007477584 6:42129218-42129240 TGGCCACTGCGGACAGCAGGTGG - Intronic
1008113565 6:47520497-47520519 TGGCCTCCGCTGACAGCAGGGGG + Intronic
1011981312 6:93382482-93382504 TGACCACTACTGTCTGCAGGTGG + Intronic
1013033247 6:106356656-106356678 TGAACAGTGGTGACTGCTGGAGG - Intergenic
1013990921 6:116253204-116253226 TGATCATAGGTGACAGCTGGGGG + Exonic
1014342875 6:120230199-120230221 GGACCAGTGGTGGCAGCAGAGGG - Intergenic
1016684967 6:146870853-146870875 TGACCACTGATGACAGTTGGAGG - Intergenic
1017065906 6:150528833-150528855 GGGCCGCTGGTGAGAGCAGGCGG - Intergenic
1019288666 7:236444-236466 GGTCTACTGGTGACAGCAGGAGG - Intronic
1023909407 7:44542625-44542647 TGACCCCAGATGACAGCAGTCGG + Intergenic
1024131506 7:46357367-46357389 TCACCACTGATGAAAGCAAGGGG - Intergenic
1024173989 7:46819475-46819497 TGACCTCTGTTGACACCAGTGGG - Intergenic
1024597809 7:50954832-50954854 TGTCCAATGGTCACAGGAGGAGG + Intergenic
1025016073 7:55440071-55440093 TCACCGCTGGTGAGAGCGGGTGG + Intronic
1026933435 7:74238017-74238039 TGACCTCTGGAGCCATCAGGAGG - Intronic
1029507142 7:100969261-100969283 ACACCACTGGTGACAAGAGGTGG - Intergenic
1031059583 7:117035651-117035673 TAACCACTGCTGCCAGCAGGAGG + Intronic
1031423033 7:121572185-121572207 TAACATCTGGTGAAAGCAGGAGG + Intergenic
1032401758 7:131629075-131629097 TGAGCTCTGGTGACATAAGGTGG + Intergenic
1032801031 7:135317444-135317466 TGACCACAGGTGACACTAAGGGG + Intergenic
1033507425 7:142019421-142019443 TAACCACATGTGACAGAAGGTGG + Intronic
1033558633 7:142510228-142510250 TGACCTGTGGAGACAGTAGGAGG + Intergenic
1035260902 7:157661178-157661200 AGACCACTGGTGAGAGCCGCGGG - Intronic
1035472227 7:159117746-159117768 TGGTCACTGATGACAGCAGCAGG - Intronic
1037455158 8:19055760-19055782 TCGCCACAGGTCACAGCAGGAGG - Intronic
1040063836 8:43128061-43128083 AGAACACTGGTGACAGTGGGTGG + Intergenic
1040993725 8:53379492-53379514 TGACCAATTGAGAAAGCAGGGGG + Intergenic
1041497567 8:58503581-58503603 TGACCATGGCTGATAGCAGGGGG - Intergenic
1042717158 8:71786522-71786544 TGTACACTGGTGAAAGCATGGGG - Intergenic
1046729158 8:117706765-117706787 TGACCACAGCTAACAGCAAGAGG - Intergenic
1047759425 8:127943128-127943150 TGTCCTCTGGGGACAGAAGGAGG + Intergenic
1049398324 8:142412235-142412257 TGCTCAGTGGCGACAGCAGGAGG + Intergenic
1049423592 8:142527427-142527449 TGTTCACTGGGGACAGCAGGAGG - Intronic
1049746359 8:144264903-144264925 TGACTACTGGTGAGGGCTGGTGG - Exonic
1049929706 9:444606-444628 TGACCTCTGGAGACAGGAGAGGG - Intronic
1049995434 9:1029752-1029774 TACTCACTGGTGACAGCAGGAGG - Intergenic
1050168792 9:2794186-2794208 TGACCACAGTTGACAGCAAATGG + Intronic
1052695112 9:31868739-31868761 TGCCCACTGGTGGCAGTAGTGGG + Intergenic
1055093116 9:72383044-72383066 TGAGCACGGGTGAGAGCAGTAGG - Intergenic
1056412040 9:86338944-86338966 AGACCACTGGTGAGAGGTGGGGG + Exonic
1056757856 9:89393243-89393265 AGACCACTGCAGACAGCATGTGG + Intronic
1057253209 9:93520721-93520743 TGAACCCTGATGACAGCATGGGG - Intronic
1059207811 9:112483202-112483224 AGGCCAAAGGTGACAGCAGGGGG - Intronic
1059914514 9:119084348-119084370 TGACCTCTGTTGACATCAGATGG - Intergenic
1060182552 9:121544512-121544534 AGCCCAGTGGTGAGAGCAGGGGG + Intergenic
1060522246 9:124300482-124300504 TGACCAGGTGAGACAGCAGGAGG + Intronic
1061480669 9:130896386-130896408 TGACCCTCGGTGACAGTAGGGGG - Intergenic
1187285916 X:17903425-17903447 GAACCACTGCTAACAGCAGGTGG - Intergenic
1187391289 X:18888015-18888037 CGATCCCTGGTGACAGCTGGAGG + Intergenic
1188228672 X:27633640-27633662 TGACCACTGCTAACAGCTGTGGG + Intronic
1197666084 X:129224952-129224974 TGACCAGTGGGTACAGGAGGGGG - Intergenic
1199206908 X:145159815-145159837 TGCCCACTGGTGAAATCAGCTGG - Intergenic
1200065557 X:153502729-153502751 TGACCCCTGGGGTCACCAGGAGG - Intronic
1200069840 X:153522757-153522779 GGACCACTGGAGTCAGCACGAGG - Intronic