ID: 1096537179

View in Genome Browser
Species Human (GRCh38)
Location 12:52282598-52282620
Sequence ATGGTCACTCTCACTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 123}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096537179_1096537187 8 Left 1096537179 12:52282598-52282620 CCACCTGGAGTGAGAGTGACCAT 0: 1
1: 0
2: 0
3: 17
4: 123
Right 1096537187 12:52282629-52282651 AGGAATAAGTAGGCAAGCCTAGG 0: 1
1: 0
2: 0
3: 18
4: 185
1096537179_1096537190 21 Left 1096537179 12:52282598-52282620 CCACCTGGAGTGAGAGTGACCAT 0: 1
1: 0
2: 0
3: 17
4: 123
Right 1096537190 12:52282642-52282664 CAAGCCTAGGGGTTAGAGCAAGG 0: 1
1: 0
2: 0
3: 30
4: 367
1096537179_1096537188 9 Left 1096537179 12:52282598-52282620 CCACCTGGAGTGAGAGTGACCAT 0: 1
1: 0
2: 0
3: 17
4: 123
Right 1096537188 12:52282630-52282652 GGAATAAGTAGGCAAGCCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 97
1096537179_1096537189 10 Left 1096537179 12:52282598-52282620 CCACCTGGAGTGAGAGTGACCAT 0: 1
1: 0
2: 0
3: 17
4: 123
Right 1096537189 12:52282631-52282653 GAATAAGTAGGCAAGCCTAGGGG 0: 1
1: 0
2: 0
3: 15
4: 145
1096537179_1096537186 -2 Left 1096537179 12:52282598-52282620 CCACCTGGAGTGAGAGTGACCAT 0: 1
1: 0
2: 0
3: 17
4: 123
Right 1096537186 12:52282619-52282641 ATAGGGCAGGAGGAATAAGTAGG 0: 1
1: 0
2: 2
3: 25
4: 290
1096537179_1096537193 30 Left 1096537179 12:52282598-52282620 CCACCTGGAGTGAGAGTGACCAT 0: 1
1: 0
2: 0
3: 17
4: 123
Right 1096537193 12:52282651-52282673 GGGTTAGAGCAAGGGCTCCTTGG 0: 1
1: 0
2: 1
3: 13
4: 184
1096537179_1096537191 22 Left 1096537179 12:52282598-52282620 CCACCTGGAGTGAGAGTGACCAT 0: 1
1: 0
2: 0
3: 17
4: 123
Right 1096537191 12:52282643-52282665 AAGCCTAGGGGTTAGAGCAAGGG 0: 1
1: 0
2: 1
3: 7
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096537179 Original CRISPR ATGGTCACTCTCACTCCAGG TGG (reversed) Intronic
902369102 1:15994206-15994228 ATGGTCATGCTCACTGCAGCTGG - Intergenic
902751408 1:18514041-18514063 ATGATCTCTCTCTCTCCAGGAGG + Intergenic
903335225 1:22620061-22620083 ATTGTCTCTCTCACTCCAGACGG - Intergenic
905234085 1:36533734-36533756 ATGGTCTCTCTCATTCCATGTGG - Intergenic
917922907 1:179765828-179765850 ATGGTCAGTGTGACTACAGGAGG + Intronic
920337075 1:205252062-205252084 ATAGTCACTCTCCCTGGAGGAGG - Intronic
923089259 1:230727017-230727039 ATGGTAACTTTGACTCCAGAAGG - Intergenic
1064317347 10:14270516-14270538 ATGGTCAGCCTAACTCCAGATGG - Intronic
1065555662 10:26913371-26913393 ATAGACACTCTTACTCCAGCAGG + Intergenic
1067062270 10:43083586-43083608 ATGGTCGTTCTCACCCCAGGAGG + Intronic
1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG + Intronic
1070509926 10:77151700-77151722 ATGATCCCACTCACACCAGGAGG + Intronic
1070805366 10:79267668-79267690 TTGGTCACTCTGCCTCCTGGAGG + Intronic
1076049114 10:127318592-127318614 AGCTTCACTCTCACTGCAGGAGG - Intronic
1076200242 10:128552120-128552142 ATTGTCACACTCTCTGCAGGAGG - Intergenic
1076229005 10:128804432-128804454 ATGGGCACTCTGAAGCCAGGCGG - Intergenic
1077801716 11:5545608-5545630 ATGGTCACTTTATCTTCAGGAGG - Intronic
1078108433 11:8373120-8373142 ATGGTCTCTCACCCTCCGGGAGG + Intergenic
1085158894 11:74322825-74322847 ATGATCTCTCACACTCCAGCAGG - Intergenic
1088820972 11:113457226-113457248 ATGGTCTCTCTCCCTCCAGTGGG + Intronic
1089514527 11:119023964-119023986 ATCTTCACCCTAACTCCAGGGGG + Exonic
1093093427 12:14946168-14946190 ATTGTGTCTCCCACTCCAGGGGG + Intronic
1096537179 12:52282598-52282620 ATGGTCACTCTCACTCCAGGTGG - Intronic
1097246174 12:57608994-57609016 ATGCTCACCCTCATTCTAGGTGG - Intronic
1098598852 12:72305484-72305506 ATGGTAACTATGAATCCAGGAGG + Intronic
1100239240 12:92694250-92694272 CTGGTCCCTCTCACTACACGTGG + Intergenic
1103632780 12:122275907-122275929 ATGGGCACTCTCCCTCTGGGTGG - Intronic
1104633551 12:130424415-130424437 CTGGTCACTGTCCCTGCAGGAGG - Intronic
1104918609 12:132279040-132279062 ATGGTGACTGTCACTGCAGAGGG + Intronic
1106308577 13:28533884-28533906 TTGGTCACTCCAAATCCAGGTGG - Intergenic
1107349506 13:39499518-39499540 ATGCCCACTCTCAGTCCACGAGG + Intronic
1107825655 13:44326862-44326884 ACGGTCTATCTCACTCCAGTTGG + Intergenic
1108433582 13:50379507-50379529 ATGGTCGCTCTCACCTCTGGAGG + Intronic
1110774507 13:79392870-79392892 ATGTTTACTCTCATTCCTGGTGG + Intronic
1116339782 14:43707042-43707064 ATGGTCACTCTCACTAGAGTAGG - Intergenic
1118050489 14:62021182-62021204 ACGGTCACAATCACTCCAGAAGG + Intronic
1120717122 14:87852005-87852027 ATCTTAACTCTCACTCCTGGAGG - Intronic
1121501409 14:94441385-94441407 ATGCTCACACTCACTCCACGGGG + Intergenic
1122890223 14:104728822-104728844 CTGGTCGCTCCCATTCCAGGGGG + Intronic
1123222611 14:106871196-106871218 GTGGTCAGTCTCCATCCAGGTGG + Intergenic
1128372014 15:67047354-67047376 AGAGACACTCTCACACCAGGAGG - Intergenic
1129969834 15:79768617-79768639 AAGGTCAAGCTCACTACAGGTGG - Intergenic
1131051152 15:89348965-89348987 ATGGTCTCCCTCACCCCAGATGG + Intergenic
1132619238 16:856523-856545 ATGGGCAATCCCACTGCAGGAGG - Intronic
1133234908 16:4383215-4383237 CTGGGCTCTCCCACTCCAGGCGG + Exonic
1135935101 16:26773138-26773160 ATTGTCACTCTCATTCCAGTTGG - Intergenic
1137993557 16:53184752-53184774 TTGGTCCCTCTCACGACAGGTGG - Intronic
1141029990 16:80579247-80579269 ATGGTGACACTCAATCCATGTGG + Intergenic
1141205098 16:81927432-81927454 TTGGTCACTTTCACTCCAGCGGG - Intronic
1149636103 17:58170567-58170589 ATTGTCACTCTCAAACCAGCCGG - Exonic
1150295971 17:64007753-64007775 ATCCTCTCTCTCCCTCCAGGAGG + Exonic
1152008005 17:77694619-77694641 ATGGCCACTCTTGCCCCAGGAGG + Intergenic
1154198830 18:12285309-12285331 ATGGTCTCTCCCAGTCCCGGAGG - Intergenic
1155840034 18:30632444-30632466 TGGCTCACTCCCACTCCAGGTGG + Intergenic
1156299822 18:35826675-35826697 CTGGTGACATTCACTCCAGGGGG + Intergenic
1156492248 18:37503096-37503118 ATGGTCACTCACTATCTAGGGGG + Intronic
1161889598 19:7025129-7025151 ATTCTCACTCTCACCCCAGCTGG + Intergenic
1161891854 19:7045617-7045639 ATTCTCACTCTCACCCCAGCTGG - Intergenic
1162857824 19:13482618-13482640 ATGGTCCATCTGACTGCAGGGGG - Intronic
1166923206 19:46246088-46246110 AGGCTGTCTCTCACTCCAGGAGG - Intergenic
1167427151 19:49435198-49435220 ATTGTCACTCAGATTCCAGGAGG - Exonic
1167589224 19:50394220-50394242 ATGATCACTCTCATTCCTGGAGG + Intronic
928943825 2:36754181-36754203 ATGGCAACTTTCACTCCTGGAGG + Intronic
929003085 2:37367370-37367392 CTGGTGCCTCTCGCTCCAGGTGG - Exonic
939082651 2:137681390-137681412 CTCATCACTCTCACTCCAGAAGG + Intergenic
942951680 2:181728875-181728897 ATGGTCCCTGTCACTGCAGTTGG + Intergenic
944868111 2:203881914-203881936 ATGGTTACTCTCACTTCATTTGG + Intergenic
945022759 2:205590587-205590609 ATGCCCACTCTCAGTCCATGTGG - Intronic
945186995 2:207149250-207149272 GCTGTCACTCTCTCTCCAGGAGG + Intronic
946133943 2:217629989-217630011 ATGGTTTCTCTCTCTCCAGATGG + Intronic
947494990 2:230628567-230628589 AGGATCACTCTGGCTCCAGGTGG - Intergenic
947668960 2:231924970-231924992 AGGGCTACTCTCACTACAGGGGG + Intronic
948943738 2:241209192-241209214 ATGCACACTCCCATTCCAGGAGG + Intronic
1169470393 20:5880151-5880173 CTGGTCCCTCTCACTGCACGTGG + Intergenic
1170157932 20:13285507-13285529 CTGGTCCCTCCCCCTCCAGGAGG + Intronic
1175690481 20:61062153-61062175 CTGGTCACTCTGCTTCCAGGAGG + Intergenic
1177497568 21:21909741-21909763 ATGGTCTCGCTGACTTCAGGAGG + Intergenic
1177654073 21:23994466-23994488 ATAGATACTCCCACTCCAGGAGG - Intergenic
1177748100 21:25245678-25245700 ATGGTCCCTCTCACTACACCTGG - Intergenic
1179981024 21:44896068-44896090 AGGATCACTCACACTGCAGGCGG - Intronic
1181693888 22:24583313-24583335 ATCCTCACTCTCACTCCAGTGGG + Intronic
1184213629 22:43051884-43051906 CTGGTCACTCTCTCTCCAGCCGG - Exonic
952588207 3:34919115-34919137 ATCATCATTCTCACCCCAGGAGG + Intergenic
952610088 3:35198475-35198497 AAAGTCACTTTCTCTCCAGGTGG - Intergenic
954538913 3:51381147-51381169 AAAGTTACTCTCACTCAAGGAGG - Exonic
955227754 3:57074994-57075016 ATGGTCTATCTCACTGCAGAAGG - Exonic
955474452 3:59321531-59321553 TTGGCCACTCCCTCTCCAGGGGG + Intergenic
963910072 3:150809180-150809202 CTGGTCAGTCCAACTCCAGGTGG + Intergenic
970053534 4:11945121-11945143 AAGCTCACCCTCACTCCAGAGGG - Intergenic
975507650 4:75156889-75156911 ATGGTCCCTCTCACTGCAGTTGG - Intergenic
979946779 4:126842964-126842986 GAGGTAATTCTCACTCCAGGTGG - Intergenic
984560109 4:181258136-181258158 ATGGTCTCTCTTCCTCCAGCAGG + Intergenic
985545246 5:505801-505823 ATGGTCACTCTCCCCCCACATGG - Intronic
986176383 5:5355558-5355580 ATGGTCCTTAACACTCCAGGTGG + Intergenic
986769570 5:10959808-10959830 AGGGTCTCTCTCACTACACGTGG - Intergenic
986844256 5:11734349-11734371 CTGGTCCCTCTCACTACATGTGG - Intronic
986844369 5:11735587-11735609 CTGGTCCCTCTCACTACACGTGG - Intronic
987137003 5:14909529-14909551 ATTGTGATTCTCCCTCCAGGAGG - Intergenic
989807083 5:45622526-45622548 ATTGTCTCTCTCTCTCCAGCTGG - Intronic
991463360 5:66883135-66883157 ATGGTTTCTCTCACCCCTGGTGG + Intronic
991921140 5:71658058-71658080 ATGGCCATTCTAACTCCAGGGGG - Exonic
993255035 5:85580135-85580157 ATGGTGACTTTCACTGAAGGAGG - Intergenic
997768391 5:136527953-136527975 ATGGTCTCTCTTTCTACAGGAGG + Intergenic
998016726 5:138737965-138737987 ATGGACACTCTGAATACAGGTGG - Intronic
1001904218 5:175457789-175457811 ATGGTCACTCACACTGAATGGGG + Intergenic
1001982459 5:176046447-176046469 ATGGACACTCTGGTTCCAGGTGG + Intergenic
1002235001 5:177797610-177797632 ATGGACACTCTGGTTCCAGGTGG - Intergenic
1002586333 5:180251188-180251210 GTGGGCACTTTCTCTCCAGGAGG + Intronic
1003491338 6:6624716-6624738 ATGTTCACTCTGACAACAGGGGG - Intronic
1004187747 6:13435520-13435542 ATGGGCACCATCCCTCCAGGTGG + Intronic
1006114052 6:31765953-31765975 ATGGTGACTGTGACTGCAGGGGG - Exonic
1008446641 6:51599274-51599296 ATGGTCTCGCTGACTTCAGGAGG - Intergenic
1008575712 6:52858204-52858226 ATGGTCCCACCCACTCAAGGAGG + Intronic
1009336823 6:62501512-62501534 ATGGTCACACTCCCTCCATCTGG + Intergenic
1012137029 6:95571366-95571388 ATGGTCACTCTCCCTTCTGAAGG + Intergenic
1014753490 6:125278683-125278705 AAGGTCACTCTAACTACAGGTGG + Intronic
1018907784 6:168085370-168085392 AAGGTCTCCCTCCCTCCAGGCGG - Intergenic
1019028026 6:168988234-168988256 GGGGTCACTCTCAGGCCAGGTGG - Intergenic
1020704003 7:11519493-11519515 ACTGTCACTTTCACTCCAGCAGG + Intronic
1024975859 7:55112981-55113003 ATGGTCACTCTGAGTCTAAGGGG - Intronic
1025784517 7:64632450-64632472 AAAGTCACTCTCACTTCAGTGGG - Intergenic
1029200132 7:98833899-98833921 AGGATCTCTCTCTCTCCAGGAGG - Intergenic
1032004081 7:128286103-128286125 ATGGCCCCTCTCTCTCCAAGTGG + Intergenic
1033540909 7:142355132-142355154 ATGTTAACTCTCAGTGCAGGTGG - Intergenic
1034053932 7:148014624-148014646 CTGGTGACTCATACTCCAGGTGG - Intronic
1034462585 7:151206018-151206040 ATGCTCACTTTCACCCAAGGGGG - Intergenic
1038288007 8:26223288-26223310 CTGGTCCCTCTCACTCCCGTGGG - Intergenic
1049182296 8:141229226-141229248 GTGGTCACTCTGACTGCAGGTGG - Intronic
1053247955 9:36550651-36550673 AGTGTCACTCTCACTCAAGCTGG - Intergenic
1056318990 9:85418976-85418998 ATGGTCACCCTCTCTGCAGTGGG - Intergenic
1057701523 9:97366357-97366379 ATGGCTCCACTCACTCCAGGTGG + Intronic
1058634612 9:107024215-107024237 CTGTCCACACTCACTCCAGGTGG + Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1187186696 X:16993527-16993549 ATAGTCTCTCTTCCTCCAGGAGG - Intronic
1187830899 X:23380164-23380186 CTGGCCACTCTCACTGCAGCCGG + Exonic
1188674751 X:32925252-32925274 GTGGTCACACTCATTCCAGCAGG - Intronic
1189327526 X:40121871-40121893 ATGGGCTCTCTCTCTCCAGCTGG + Intronic
1192279607 X:69671124-69671146 ATGGTGACTCTCATTCCATGTGG + Intronic
1194767900 X:97863899-97863921 ATGATCACTTTGAATCCAGGAGG + Intergenic
1196611149 X:117716371-117716393 ATGATCACTCTAAGTCCAAGGGG + Intergenic
1198749361 X:139923209-139923231 ATGGGCAGTCTCATTACAGGAGG - Intronic