ID: 1096537935

View in Genome Browser
Species Human (GRCh38)
Location 12:52287236-52287258
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 3, 1: 2, 2: 1, 3: 20, 4: 192}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096537922_1096537935 26 Left 1096537922 12:52287187-52287209 CCCTGATCAGGCAGGCCATGTCC 0: 3
1: 3
2: 1
3: 8
4: 153
Right 1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG 0: 3
1: 2
2: 1
3: 20
4: 192
1096537925_1096537935 11 Left 1096537925 12:52287202-52287224 CCATGTCCTGCTTGGCCTTCTGC 0: 9
1: 7
2: 20
3: 129
4: 701
Right 1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG 0: 3
1: 2
2: 1
3: 20
4: 192
1096537923_1096537935 25 Left 1096537923 12:52287188-52287210 CCTGATCAGGCAGGCCATGTCCT 0: 3
1: 1
2: 0
3: 10
4: 133
Right 1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG 0: 3
1: 2
2: 1
3: 20
4: 192
1096537928_1096537935 5 Left 1096537928 12:52287208-52287230 CCTGCTTGGCCTTCTGCAGGGCG 0: 3
1: 11
2: 16
3: 38
4: 274
Right 1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG 0: 3
1: 2
2: 1
3: 20
4: 192
1096537929_1096537935 -4 Left 1096537929 12:52287217-52287239 CCTTCTGCAGGGCGCCCTCCAGC 0: 3
1: 5
2: 27
3: 58
4: 305
Right 1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG 0: 3
1: 2
2: 1
3: 20
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900394257 1:2446700-2446722 CAGGTTGGCCAGCTCTCAGCTGG - Intronic
900892290 1:5458271-5458293 CAGCTCTGATAGCTTGAAGCTGG - Intergenic
902275248 1:15334924-15334946 CAGCTTGGCCACTTGGCAGCCGG - Intronic
903278448 1:22236396-22236418 CAGCTCGGCAGGATGGCAGCTGG + Intergenic
903344886 1:22677560-22677582 CAGCTCTGCCACATCGCAGCTGG - Intergenic
903755439 1:25657359-25657381 CAGCCTGGCCAGGATGCAGCTGG + Intronic
904338379 1:29812577-29812599 CAGCTCTGCCAGAGTCCAGCTGG - Intergenic
904878815 1:33678662-33678684 CAGCTCGGTCAGCTTAGAGGGGG - Intronic
905862866 1:41362326-41362348 CAGCTCGGCCGGCTGGAAGGTGG + Exonic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
915832133 1:159140961-159140983 AAGCTCATCCAGCTTGCTGCTGG + Intronic
920372495 1:205488151-205488173 AAGCTAGTCCAGCCTGCAGCCGG - Intergenic
1063377965 10:5565406-5565428 CAGCATGTCCTGCTTGCAGCCGG - Intergenic
1063535238 10:6876745-6876767 CAGCAGGGCCAGCCAGCAGCCGG + Intergenic
1064302069 10:14131789-14131811 CAGCTAGGACAGCTTCTAGCGGG - Intronic
1067078223 10:43199984-43200006 CAGCACAGCCATCTTGGAGCAGG + Intronic
1067112941 10:43413435-43413457 CAGCTCAGCCATCTAGAAGCTGG - Intergenic
1067521886 10:47013949-47013971 CAGCTTGGCCAGCAAGCACCCGG + Intergenic
1068977279 10:63023429-63023451 CAGGTCAGCAAGCCTGCAGCTGG - Intergenic
1069600995 10:69708042-69708064 CAGCTCCTCCAACTTGCAGGTGG + Intergenic
1069627084 10:69875010-69875032 CAGCTAACCCAGTTTGCAGCGGG - Intronic
1069678960 10:70270259-70270281 CAGCACTGCCTGCCTGCAGCAGG - Intronic
1069788417 10:71004441-71004463 CAGGACGGCCACCTTGCTGCCGG - Intergenic
1072209381 10:93232573-93232595 CAGCTCGGTCAGTTTGAGGCAGG + Intergenic
1072888608 10:99301674-99301696 CAGCTAGACCAGATGGCAGCAGG + Intergenic
1075077701 10:119362029-119362051 GAGGTGGGACAGCTTGCAGCTGG - Intronic
1075869865 10:125763419-125763441 CTGCTGGGCCAGCTTGCCGCCGG + Exonic
1076096809 10:127739096-127739118 CGGCTCGGCCAGCAGGGAGCTGG + Exonic
1076238413 10:128883616-128883638 CAGTGAGGCCAGCTGGCAGCGGG - Intergenic
1076571825 10:131438229-131438251 CAGCTCTGCCAGCGGGCATCTGG - Intergenic
1077341818 11:2029612-2029634 CAGCTCTGCCTGCTTGGAGTTGG + Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1077739844 11:4833619-4833641 CAGCTCAACAGGCTTGCAGCAGG - Intronic
1078318669 11:10313253-10313275 CACCTCGGCCTCCTTGTAGCTGG - Intronic
1080059260 11:27939706-27939728 CAGTTCTCCCAGCATGCAGCTGG + Intergenic
1081568509 11:44275438-44275460 CAGCTCCTCCAGCTGGTAGCTGG + Exonic
1081762217 11:45584488-45584510 CAGCCAGGCAAGCATGCAGCTGG - Intergenic
1083152909 11:60804304-60804326 CAGCAAGCCCAGCGTGCAGCAGG + Intergenic
1083853441 11:65380598-65380620 CTGCGTGGCCAGCTGGCAGCAGG - Intronic
1083906066 11:65671623-65671645 CAGGTCTTCCAGCTTGCAGATGG + Intergenic
1084118704 11:67056664-67056686 CAGCGCGGCCAGCTCACAGTAGG + Intergenic
1084189424 11:67492250-67492272 CACCTGGGCCAGCTGGAAGCGGG - Exonic
1085121929 11:73973017-73973039 CAGCTCAGCCAGGCTGCAGGGGG - Intergenic
1088913779 11:114211756-114211778 CAGGAAGGCCAGCTTGCAGTGGG + Intronic
1090247484 11:125226840-125226862 CAGCTGGGCCAGCCTGCAACAGG - Intronic
1090424447 11:126597303-126597325 CAGCCTTGTCAGCTTGCAGCGGG - Intronic
1090796886 11:130142931-130142953 CAGCTAGGCCAGTCTCCAGCAGG - Intronic
1090977823 11:131691426-131691448 CGGCTCGGCCAGCCTGGACCCGG - Intronic
1202824804 11_KI270721v1_random:84801-84823 CAGCTCTGCCTGCTTGGAGTTGG + Intergenic
1093077128 12:14770036-14770058 CTGCTCGGCCACCTGGCGGCGGG - Intronic
1093281914 12:17204823-17204845 CAGCTCCGGCAGCTGGCAACAGG - Intergenic
1095736866 12:45567166-45567188 CAGCTCTGCCACCTAACAGCTGG + Intergenic
1096532779 12:52252395-52252417 CAGCTCGGCCAGCTTGCAGCGGG + Intronic
1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096540836 12:52306124-52306146 CAGCTCGGCCAACTTGCAGCGGG - Exonic
1096542534 12:52316027-52316049 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG + Exonic
1096552205 12:52380497-52380519 CAGATCTGCCAGCTTGCATTTGG + Exonic
1096554706 12:52396146-52396168 CAGCCCTGCCAGCTTGCACTTGG + Exonic
1096569957 12:52516771-52516793 CAGCTCGGCCAGCTTGTTCCTGG + Exonic
1096574868 12:52546420-52546442 CAGCTCGTCCAGCTTGGCCCGGG + Exonic
1096785361 12:54014279-54014301 CAGCTGGGGCAGCTTTGAGCAGG + Intronic
1098140098 12:67442517-67442539 CAGCTTTGCCAGCCTGGAGCCGG + Intergenic
1101695612 12:107122825-107122847 CACCTCCAGCAGCTTGCAGCCGG - Intergenic
1102447500 12:113014950-113014972 GAGCTTGGTCAGATTGCAGCAGG + Intergenic
1102950681 12:117028681-117028703 CAGCTCTACCAGCTTGCTACTGG - Intronic
1103600450 12:122051266-122051288 CAGCTCGGGCAGCAGGCAGGTGG - Intronic
1104077662 12:125404707-125404729 CAGCTAGTCCTTCTTGCAGCTGG + Intronic
1104874416 12:132023899-132023921 CAGCTCCGGCAGCTCACAGCGGG + Exonic
1106770561 13:32957480-32957502 CAGGTGGCTCAGCTTGCAGCTGG + Intergenic
1107016901 13:35714761-35714783 CAGCCAGGGCAGCTTCCAGCTGG + Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116944231 14:50821353-50821375 CAGCACGGCTTGCTTCCAGCAGG - Intronic
1119211485 14:72835558-72835580 CAGTTTCTCCAGCTTGCAGCAGG + Intronic
1120191908 14:81447242-81447264 CAGCTCTGCCAGCTTCTAGCTGG + Intergenic
1121225049 14:92315612-92315634 CAGCTCGGGCAGCTGTCTGCAGG - Intergenic
1123125195 14:105941214-105941236 CAGATCAGCCAGCCTGCAGTGGG - Intergenic
1124204746 15:27707640-27707662 CAGCTCTGCCAGCTTATTGCTGG + Intergenic
1125598571 15:40903053-40903075 CAGGTCGCACAGCCTGCAGCAGG - Exonic
1127868284 15:63048838-63048860 CACCTGGGCCAGCTGGCGGCGGG + Intronic
1128549624 15:68589982-68590004 CAGGACGGCCAGCTTCCAGGAGG - Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1132567347 16:629633-629655 CAGATTGGCCAGCGTGCAGGCGG - Intronic
1136619478 16:31418502-31418524 CAGCAAGGCCACCTTCCAGCTGG + Exonic
1139393334 16:66620293-66620315 CAGCCAGGCCAGCTCACAGCTGG - Intronic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1141675028 16:85513323-85513345 CAGCTCAGCCACTTTGCAGCTGG + Intergenic
1141917378 16:87108752-87108774 CAGCCCAGCCAGCTTGCTGCAGG + Intronic
1142263128 16:89051718-89051740 CAGGTGGGCCAGCGTGGAGCTGG - Intergenic
1143100469 17:4501759-4501781 CAGCTGGGCCAGCCAGCAACAGG - Intronic
1147188600 17:38726062-38726084 CAGCTCGGGCAGATGGCAGAAGG + Exonic
1148759726 17:49993484-49993506 CAGGGCGGCCAGCTGGTAGCTGG + Exonic
1151277117 17:73043518-73043540 CAGCTTAGCCAGCATGGAGCAGG + Intronic
1151620604 17:75242712-75242734 CAGGTAGGGCAGCTGGCAGCAGG + Intronic
1152235084 17:79134490-79134512 CAGCTCTGCAGCCTTGCAGCTGG + Intronic
1152267745 17:79306179-79306201 CAGCTCTGCCAGTTCCCAGCTGG + Intronic
1153988813 18:10376857-10376879 CGACTTGGCCAGCTGGCAGCAGG + Intergenic
1155618246 18:27746087-27746109 CAGCACGGCCAGGTAGAAGCAGG + Intergenic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157813548 18:50715176-50715198 CATCTCAGCCAGGATGCAGCCGG - Exonic
1158489683 18:57898667-57898689 CTGTGCTGCCAGCTTGCAGCAGG - Intergenic
1160832228 19:1109385-1109407 CTGCTCCGCCAGCAGGCAGCTGG + Exonic
1162328896 19:10014900-10014922 CAGCTCTGCTACTTTGCAGCTGG - Intronic
1163130075 19:15266872-15266894 CAGCTCTGCCAGCTGGCCCCTGG + Intronic
1165143762 19:33718785-33718807 CAGCTCAGCCAGCATGAGGCTGG + Intronic
1165896737 19:39145915-39145937 CAGCTCCGCCACCTTCTAGCTGG + Intronic
1166391338 19:42410490-42410512 CAGCTCGGCCAGGTTGTGGCTGG + Exonic
1166863863 19:45824647-45824669 CTGCTCTTCCAGTTTGCAGCAGG - Intronic
1167358518 19:49017979-49018001 CAGCTATGGCAGCTTGAAGCCGG - Intergenic
1202706379 1_KI270713v1_random:27293-27315 CAGCTAGACCAGGTGGCAGCTGG - Intergenic
925579056 2:5391573-5391595 CAGCACGGGCTGCTGGCAGCTGG + Intergenic
927415126 2:22871515-22871537 CTGCTGGGCCTGCTTGCAGAAGG - Intergenic
927787071 2:25981699-25981721 CAGGTCGGCCTGCTTGGAGCTGG + Exonic
929269442 2:39957659-39957681 CATCTCTGCCAGCTTCCATCTGG + Intergenic
935226076 2:101054295-101054317 CTGCTCGGCGAGCCTGCTGCTGG + Exonic
937862152 2:126719528-126719550 CAAATGGGCCAGTTTGCAGCTGG + Intergenic
942311503 2:174661154-174661176 CAGGGAGGCCAGCGTGCAGCAGG + Intronic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
943896097 2:193362217-193362239 CAGCTCAGCAAGACTGCAGCTGG + Intergenic
944798999 2:203217298-203217320 CGGCTCAGCCAGATTTCAGCTGG + Exonic
948636521 2:239341328-239341350 CACCTCGGTGAGCCTGCAGCAGG + Intronic
948834704 2:240620407-240620429 CAGCTCTGCCCACCTGCAGCAGG - Intronic
949045393 2:241870448-241870470 CAGCTCGGCCGGGTGCCAGCTGG + Intronic
1170143816 20:13151492-13151514 CAACTCTGCCAGCTCCCAGCAGG - Intronic
1171416426 20:24984127-24984149 GAGGTCGGCCAGCTTGCAGTGGG - Intronic
1172527333 20:35607720-35607742 CAGTCCTGCCAGCTTGCAGCTGG - Intergenic
1175671071 20:60903230-60903252 CAGCTCGCCCTCCATGCAGCTGG + Intergenic
1176013987 20:62919050-62919072 AAGCTCCACCAGCTTGCGGCAGG + Intronic
1181029590 22:20143376-20143398 CAGCTCCTACAGCCTGCAGCAGG + Exonic
1181283460 22:21735951-21735973 GAGCTCCGCCAGCTCGCACCCGG + Intergenic
1181513664 22:23399942-23399964 CAGCTCCTACAGCCTGCAGCAGG - Intergenic
1181628236 22:24135648-24135670 CAGCATGGCCAGCTCCCAGCTGG + Intronic
1181943811 22:26499473-26499495 CAGCTCGGGCAGCGCGAAGCCGG + Exonic
1182811552 22:33121242-33121264 CAGCTAGGCCAGTTGGCAGCTGG - Intergenic
1183953617 22:41366679-41366701 CAGCTCTGCCAGCCTGCTTCAGG - Intergenic
1185005948 22:48277079-48277101 CAGCCCGGCCAGGCTGGAGCTGG - Intergenic
950274121 3:11643880-11643902 CAGCGCTGCCGGCTTGCAGCGGG - Exonic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
954876072 3:53803949-53803971 CGGCTTGGCCAGCCTGGAGCTGG + Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
958675456 3:97264434-97264456 TAGCTCCTCCAGCTGGCAGCAGG + Intronic
961363096 3:126380329-126380351 CAGCTCGTCCTGCAGGCAGCAGG - Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
965256743 3:166423946-166423968 CGGCTCTCTCAGCTTGCAGCGGG + Intergenic
965596887 3:170419185-170419207 CAGCTCATCCAGCTTGCGGCAGG - Exonic
966876351 3:184324081-184324103 CAGCTCTGCCTCCTTCCAGCTGG - Intronic
967582421 3:191175144-191175166 CATCTCGGCCACTTTCCAGCTGG + Intergenic
968442871 4:633444-633466 CACCTCGGCCAGCCCCCAGCAGG + Intronic
969097428 4:4744171-4744193 CGACTCGGCCACCTTGCATCTGG - Intergenic
969325641 4:6442312-6442334 CAGCTCTGCCCGCTCTCAGCAGG + Intronic
969696421 4:8737677-8737699 CAGCTCTGCCTGCTGGCGGCTGG + Intergenic
970062175 4:12046935-12046957 CACCTCACCCATCTTGCAGCTGG - Intergenic
970065654 4:12090619-12090641 CAGTTCTCCCAGCATGCAGCTGG + Intergenic
975986099 4:80202641-80202663 CCGCGCGGCCAGCCTGCAGGAGG + Exonic
976812003 4:89108403-89108425 GAGCTGGGCCACCTTGCAGGTGG + Intronic
977470747 4:97438475-97438497 CAGCTCCCTCAGCTTGCGGCAGG - Intronic
979524995 4:121707153-121707175 CACCTCGGCCTGCCTTCAGCAGG - Intergenic
980901869 4:138912697-138912719 CAGCACGGTCAGGTAGCAGCAGG - Intergenic
982133027 4:152247448-152247470 CAGCCAGGCCAGCTTCCTGCAGG + Intergenic
984475739 4:180232151-180232173 CAGCTCAGGCAGTCTGCAGCTGG - Intergenic
986830350 5:11570224-11570246 CAGCCAGGCCAGATTGGAGCAGG - Intronic
987332171 5:16866939-16866961 CAGGTCGGGCAGCTGGCAGGAGG - Intronic
989333411 5:40286944-40286966 CATCTTGGCCTGCCTGCAGCTGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995689082 5:114803328-114803350 CAGGTCAGTCAGCTGGCAGCTGG + Intergenic
998674811 5:144395527-144395549 CAGCTGGGCCAGCTGCCTGCAGG + Intronic
999364303 5:151011847-151011869 CAGCAGGGCCAGCTTCCAGTGGG - Intergenic
1001749710 5:174119382-174119404 CAGCTTGACCAGCTTGCATCTGG - Intronic
1003501236 6:6704609-6704631 CAGTTCTGCCAGCCTGCAGATGG - Intergenic
1008778017 6:55064432-55064454 CAGCTAGGAAAGCTTTCAGCTGG - Intergenic
1016848749 6:148595058-148595080 CAGCAGGGCCAGCTGGCAGGAGG - Intergenic
1017382713 6:153848709-153848731 CAGCTCCTCCTGCTTGCAGGGGG - Intergenic
1019473603 7:1233583-1233605 CAGCTCCTCCAGCTGCCAGCCGG - Exonic
1019770801 7:2882729-2882751 GAGCTCTGCCAGGTTGCAGGGGG + Intergenic
1020085386 7:5307598-5307620 CAGGTAGGCCAGCTGGCATCGGG + Exonic
1023190107 7:37570999-37571021 CAGCCCTGCCAGTTTGCAGGAGG - Intergenic
1029789438 7:102827193-102827215 CAGCTCAGCTAGCTTGCTGGAGG + Intronic
1030221495 7:107103748-107103770 CAGCTAGACCAGGTGGCAGCTGG - Intronic
1031857753 7:126942587-126942609 CTGCTCGCCCGGCATGCAGCAGG + Intronic
1033589404 7:142797268-142797290 CAGCACGGTCAGCCTGCTGCCGG - Intergenic
1033648401 7:143322036-143322058 CAGCTTGGGGAGCTTGGAGCAGG + Intronic
1035316855 7:158001937-158001959 CAGCTTGGCCAGCTTCCGGCTGG - Intronic
1037937610 8:22925776-22925798 CAGCTGGGCCAGGGTACAGCAGG - Intronic
1042332504 8:67595375-67595397 CAGTTCTCCCAGCATGCAGCTGG - Intronic
1044055542 8:87565679-87565701 CAGCTCTTCAAGCTTGAAGCTGG + Intronic
1044441598 8:92230759-92230781 CAGCTCCCTCAGCTTGCAGGGGG + Intergenic
1044625901 8:94234913-94234935 CTGCGGGGCCAGCTTTCAGCAGG + Intergenic
1045111897 8:98944470-98944492 GAGCTCGGCGTGCTTGCTGCTGG + Exonic
1047785878 8:128153441-128153463 CAGCCCGCCCAGGCTGCAGCTGG - Intergenic
1049322302 8:142003024-142003046 CAGCTCAGCCAGCCTCCAGCAGG - Intergenic
1049480711 8:142821147-142821169 CAGCAAGGCCAGCCTGCAGAAGG + Intergenic
1049960645 9:734902-734924 CAGCTCGGGCAGCCTACAGCTGG - Intronic
1051296371 9:15600624-15600646 CAGTTCTCCCAGCATGCAGCTGG - Intronic
1056887648 9:90458732-90458754 CAGCTGGGCTAGCTTGCTGATGG + Intergenic
1057076394 9:92140421-92140443 CAGCTCGGCCACCCTGAGGCTGG - Intergenic
1057485867 9:95483633-95483655 CAGCTGCGCCAGGTTTCAGCAGG - Intronic
1057515163 9:95714416-95714438 GAGCACTACCAGCTTGCAGCTGG - Intergenic
1057724381 9:97557694-97557716 CAGCCCGAGCAGCTGGCAGCAGG + Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1057976362 9:99609866-99609888 CAGCCCCGCCATCATGCAGCTGG + Intergenic
1058242320 9:102580322-102580344 CAGTTGGACCAGCTTTCAGCTGG - Intergenic
1060155097 9:121313995-121314017 GAGCTTGGCCAGCTTGCGGTTGG - Exonic
1060247205 9:121957047-121957069 CAGCTGGGCCAACATGCAGTGGG - Intronic
1061735950 9:132659207-132659229 CAGCTCGGCCACCATTCAGAAGG - Intronic
1062059485 9:134487314-134487336 CAGCTCTGCCTGCATGGAGCAGG - Intergenic
1186402860 X:9275629-9275651 CTGCATGGCCAGCTTGCTGCTGG - Intergenic
1186942173 X:14521581-14521603 CAGATGGTCCAGCTTGCAGATGG + Intergenic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1188483125 X:30653917-30653939 CAGAGCGGCCCGCTTGCAGTAGG + Intronic
1192214458 X:69149077-69149099 CAGCTCTGCCACTTGGCAGCTGG - Intergenic
1192233622 X:69282778-69282800 CAGCCAGGCCAGCTTGCCTCTGG + Intergenic
1194876296 X:99192557-99192579 CAGCTCTGCCAGCATCTAGCTGG - Intergenic
1196935588 X:120727462-120727484 CCCCTAGGGCAGCTTGCAGCAGG - Intergenic
1202368051 Y:24180084-24180106 CAGCTGGGCCAGCATGCACTGGG + Intergenic
1202502734 Y:25490033-25490055 CAGCTGGGCCAGCATGCACTGGG - Intergenic