ID: 1096538927

View in Genome Browser
Species Human (GRCh38)
Location 12:52292813-52292835
Sequence GGAAGCATAAAATGTCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096538927 Original CRISPR GGAAGCATAAAATGTCAGAT TGG Intronic
901718269 1:11174405-11174427 GGAAATAAAAAATGTGAGATGGG - Intronic
904256296 1:29257153-29257175 GAAAGAACAAAGTGTCAGATTGG + Intronic
905971276 1:42144320-42144342 GGAACCATCAAATGTCAAATAGG - Intergenic
907346282 1:53783755-53783777 GGAATCATAACATGGCAGAAGGG - Intronic
908855383 1:68421006-68421028 AGAAGCATAAAATGGCAGAGAGG - Intergenic
910195771 1:84638193-84638215 GGAAAATTATAATGTCAGATAGG + Intergenic
910263996 1:85319455-85319477 GTAAGCCTAAACTGGCAGATTGG + Exonic
910270564 1:85389812-85389834 GGAAGCAAAAAGTGTTAGAGAGG + Intronic
910740110 1:90506052-90506074 TGGAGCAGAACATGTCAGATTGG - Intergenic
911540529 1:99152280-99152302 AGTAGCTTAAAAGGTCAGATAGG - Intergenic
914700368 1:150126880-150126902 TGAAGGAGAAAATGTCAGTTTGG - Intronic
917030790 1:170688797-170688819 GGAAGAAAAAAATGTCAGTCAGG - Intronic
918193994 1:182204634-182204656 GTAAGCATAATATACCAGATAGG + Intergenic
918791400 1:188834959-188834981 GGAAGCAAAAAATGAGAAATTGG - Intergenic
918793891 1:188866407-188866429 TGAAGCATAAAATCTCATAGTGG - Intergenic
921334741 1:214074967-214074989 TGAAGCAAAAAGAGTCAGATAGG + Intergenic
922298818 1:224277420-224277442 GGAGACATAAAGTTTCAGATAGG + Intronic
922820332 1:228480434-228480456 GGAATCATAAAGTGTCAAAATGG - Intergenic
922956976 1:229611256-229611278 GAAAGCATAAACTCACAGATTGG - Intronic
923226145 1:231940505-231940527 GGAAGCATAAGATGTAAGTGAGG - Intronic
1066550621 10:36552661-36552683 GGAAGCCTAAGAAGTCAGCTGGG - Intergenic
1069079988 10:64078119-64078141 GGCATCATTAAATGCCAGATGGG - Intergenic
1070208150 10:74285441-74285463 TGAAGCATAGTATGTGAGATGGG + Intronic
1070289523 10:75105336-75105358 GAAAGCATAAAATGGAAGAGGGG - Intronic
1073175106 10:101551011-101551033 GGAAGCAGACAATGTGAGACAGG + Intronic
1075765713 10:124891341-124891363 GGAAGCATAAAGGGAGAGATGGG - Intergenic
1078851036 11:15164046-15164068 AGAAGCATAAATTATCAGAAAGG - Intronic
1079652595 11:22948728-22948750 GGAAACATTAGATGTCAGATAGG - Intergenic
1080414700 11:32058336-32058358 GGAAGCAGAAGTTTTCAGATAGG + Intronic
1082935150 11:58648173-58648195 GGAAAAAAAAAATGGCAGATAGG - Intronic
1086738208 11:90333525-90333547 TGAAGTTTAAAATATCAGATAGG + Intergenic
1087126853 11:94636839-94636861 GGAAGCTTAGATAGTCAGATGGG + Intergenic
1088564811 11:111158687-111158709 AAAAGCAAAAATTGTCAGATTGG - Intergenic
1090065345 11:123498627-123498649 GGAGGAATAAAATATTAGATAGG - Intergenic
1091161757 11:133429096-133429118 GGAAGAATACAATTTCAAATAGG + Intronic
1093510981 12:19928215-19928237 GGAAACAGAACATGTCAAATAGG + Intergenic
1095229302 12:39718658-39718680 GGAAAAAAAAAATGTCACATAGG - Intronic
1096538927 12:52292813-52292835 GGAAGCATAAAATGTCAGATTGG + Intronic
1096906045 12:54936675-54936697 GTAAACATAAAATGTGAAATAGG + Intergenic
1097467354 12:59943897-59943919 GGTAAAATAAAATGTCAGTTAGG - Intergenic
1099047078 12:77734695-77734717 GGCAGTTTAAAATCTCAGATAGG - Intergenic
1099234117 12:80061989-80062011 CAAAGAATAAAATTTCAGATAGG - Intergenic
1100434594 12:94560309-94560331 GGAAGCAAAATGTTTCAGATGGG + Intergenic
1100659660 12:96683048-96683070 GGCATCATAAAATGTCTGTTAGG - Intronic
1100661629 12:96705904-96705926 TGAAGCATGAAACTTCAGATTGG - Intronic
1102810662 12:115821360-115821382 AGAAGCTTAAAAAGTCAGAGTGG + Intergenic
1108592628 13:51924508-51924530 GGAAGAATAACAGGGCAGATGGG - Intergenic
1109705725 13:66089479-66089501 GGAACCAGAAAATTTCAGCTAGG + Intergenic
1111276952 13:85962834-85962856 TGATGAATAAAATTTCAGATAGG + Intergenic
1111781544 13:92732896-92732918 GGAAGAATAAAATCTCAGGATGG - Intronic
1114796885 14:25725979-25726001 AAGAGCATAAAATGTCAGAGGGG - Intergenic
1115280758 14:31660096-31660118 GGAAGCAGAAAATTTGAGAAAGG - Intronic
1115703054 14:35974419-35974441 GTAAGAAGAAAATGTGAGATGGG - Intergenic
1115964276 14:38869430-38869452 GGAAGCATAAAATGTCTGATGGG - Intergenic
1116200920 14:41794216-41794238 GGAAGCAGAAATAGTCAAATGGG - Intronic
1117127189 14:52641640-52641662 GGAAGCATAAGATGAGAGAGAGG + Exonic
1117307980 14:54495029-54495051 GAAAGTATGAAATGTGAGATGGG - Intergenic
1117757446 14:58990429-58990451 AGAAGAATCCAATGTCAGATAGG - Intergenic
1118469098 14:66057957-66057979 GGGAGAATAAAATCTCAAATTGG + Intergenic
1121839673 14:97122639-97122661 TGAAGCAGACACTGTCAGATTGG - Intergenic
1124343004 15:28901968-28901990 GGAAGAATAAAGGGCCAGATGGG + Intronic
1124647753 15:31451134-31451156 GGAAGCATAAACTGACAGAAAGG - Intergenic
1124656206 15:31509978-31510000 GGAAACAAAAAATGACAGAGAGG - Intronic
1125008422 15:34843831-34843853 GGAAGCACAAAATGTTAGGAAGG + Intergenic
1126409592 15:48358641-48358663 GGAAGAAAAAAATGAAAGATAGG - Intergenic
1126521592 15:49601412-49601434 AGTAGCATAAAATGTGAGAGTGG - Intronic
1127181041 15:56418065-56418087 AGAGTCATTAAATGTCAGATGGG + Intronic
1127247899 15:57197780-57197802 GCAAGCAAAAAAAGTCAGAAAGG + Exonic
1128393229 15:67197340-67197362 GGAAGCATCTATGGTCAGATTGG - Intergenic
1129881368 15:79008608-79008630 GGATGCAGCAAATGGCAGATCGG + Intronic
1131352751 15:91716719-91716741 GAAAGCACAAAAGGTCAGTTTGG - Intergenic
1131596129 15:93800156-93800178 AGAAGAATAAAATGTCACAGTGG + Intergenic
1133435022 16:5771747-5771769 GCAAGAATTAAATTTCAGATTGG - Intergenic
1136619095 16:31416165-31416187 GAAAGACTAAGATGTCAGATGGG + Intronic
1139544635 16:67644634-67644656 GGTGGGAAAAAATGTCAGATGGG - Intergenic
1140167073 16:72563721-72563743 AGAAGCATAAAATGTAGGGTGGG + Intergenic
1142503289 17:345953-345975 GGAAACACAAAATGTCACATGGG + Intronic
1144663795 17:17088636-17088658 GGAAGCCTAAAAGGTGAGAGTGG - Intronic
1145416324 17:22716552-22716574 GGAAGCAGAAGATATCTGATTGG + Intergenic
1148348330 17:46919642-46919664 GGAAATCTTAAATGTCAGATTGG - Intergenic
1148399350 17:47340974-47340996 GGAAGCACATAATGTCCAATTGG - Intronic
1149047752 17:52267343-52267365 GGCAGTATAACATGACAGATTGG + Intergenic
1149566411 17:57643618-57643640 GGAAGCATAAAATAGAAGTTAGG - Intronic
1153092732 18:1366856-1366878 GGAATGTTAAAATGTCAGCTAGG + Intergenic
1153729051 18:7988926-7988948 GGCCCCAGAAAATGTCAGATTGG + Intronic
1153994932 18:10432519-10432541 GGAAGAATAAAGGTTCAGATGGG - Intergenic
1154996411 18:21644781-21644803 GGAAGTTTCAAATGTCATATTGG + Intergenic
1155802569 18:30126809-30126831 GAAGACATAAATTGTCAGATTGG + Intergenic
1155865123 18:30955410-30955432 GGAAGCATAGAATTTGAGAGAGG + Intergenic
1156794169 18:41021819-41021841 GGCAGCAAGCAATGTCAGATAGG - Intergenic
1156955298 18:42955523-42955545 GAAATCATAAAACGTCAGAAGGG - Intronic
1158294030 18:55974189-55974211 GAAAACATAAAGTTTCAGATGGG - Intergenic
1160303485 18:77707952-77707974 AGAAGCAAAAAATGGCAAATGGG + Intergenic
1160454329 18:78988320-78988342 GTAAGTAAATAATGTCAGATTGG + Intronic
1162755122 19:12853393-12853415 GGCAGCATAAAAAATCAGCTGGG + Intronic
1164819754 19:31239123-31239145 GGAAGTATAAAGTATCAGAAGGG - Intergenic
1165146616 19:33734987-33735009 AGCTGCATCAAATGTCAGATAGG + Intronic
1166913040 19:46174448-46174470 GGAGGAATAAAATATCAGGTGGG + Intergenic
1168541064 19:57210823-57210845 GTTTGCATAAACTGTCAGATAGG + Intronic
925183218 2:1830444-1830466 GGAGGCATCACATGGCAGATGGG + Intronic
925395812 2:3533023-3533045 GGACGCATAAAATGTCACCCGGG + Intronic
929052209 2:37847486-37847508 GGAAGCTTAAAATGCTATATGGG + Intergenic
929931185 2:46256739-46256761 AGAAGGATAAAGTGTCAGAAAGG - Intergenic
932722679 2:74149098-74149120 TGAAGCAGAAAATGTAAGACAGG - Intergenic
933307781 2:80623485-80623507 TGAAGCTGAAAATGTCAGAGAGG + Intronic
934992505 2:98931405-98931427 GGGAGGAGAAAATGTCAGAGAGG - Intronic
937609379 2:123841290-123841312 CGAACCATGAAATGTGAGATTGG - Intergenic
937843670 2:126553766-126553788 GGAAGAAGAAAATGTCTCATGGG + Intergenic
939267610 2:139893430-139893452 GTAAACATAAAATTTCAAATAGG + Intergenic
939596106 2:144124787-144124809 GGAAGCAAATGGTGTCAGATTGG - Intronic
940985164 2:160045341-160045363 GGAAGCATAAAAGGTCTTACTGG + Intronic
941327385 2:164133643-164133665 GGAAGAATAAAATGTACAATTGG - Intergenic
941395025 2:164963713-164963735 GGAAGGATCAAATTTCAGTTTGG - Intergenic
943660991 2:190559238-190559260 GAAAGCAGAAAATGTAAGTTTGG + Intergenic
943990689 2:194687487-194687509 GGAGGCATAAAATATCACAGTGG - Intergenic
944212581 2:197221830-197221852 GAAAGCACAAAAAGTCAGAGAGG + Intronic
1170107750 20:12769790-12769812 GGAAGCAAAAATTGACAAATGGG + Intergenic
1172070203 20:32251175-32251197 GGGAGGATAAAATGTTATATAGG - Intergenic
1177400725 21:20601409-20601431 AGGACCATAAAATGGCAGATTGG + Intergenic
1177484848 21:21744505-21744527 GTCAGCATAAAATGTTAAATAGG - Intergenic
1178181105 21:30162487-30162509 GGAATAATAAACTCTCAGATGGG - Intergenic
1178724650 21:35040447-35040469 GGAGACAAAAAATGTCAGAGTGG - Intronic
1182199003 22:28550311-28550333 GAAAGCACAAAATGTCAGTAAGG + Intronic
949272264 3:2232096-2232118 GGAAATATAAAATTTCAGACAGG - Intronic
949950686 3:9226318-9226340 GAAAGCAGAAAATCTCAGATTGG + Intronic
950615674 3:14156073-14156095 GGAAAAATAAAATTTAAGATAGG - Intronic
950793636 3:15493445-15493467 AGAAGCATAAAAGGGGAGATGGG - Intronic
951925206 3:27901743-27901765 TGAAGCATAAAATGACCAATAGG - Intergenic
951972256 3:28459812-28459834 ACAAACCTAAAATGTCAGATTGG + Intronic
952136468 3:30427991-30428013 GGAAGCATAAAATAACAGAATGG - Intergenic
956875233 3:73456596-73456618 TGAAGAATAAAATGACTGATAGG + Intronic
959557943 3:107744366-107744388 GGAAGCTTAGAATGTTAGAGAGG - Intronic
962482701 3:135811360-135811382 GGAAGCATGAAATCCCAGATTGG + Intergenic
963883114 3:150550548-150550570 AGAAGTACAAAATGTCAGTTTGG + Intronic
964183790 3:153918334-153918356 GAAAGCATAAATTGACAAATGGG + Intergenic
964712413 3:159684853-159684875 GGAAGCCTTAAATGTGAGAGAGG - Intronic
967615147 3:191556117-191556139 GTAAGCATAAAAGGGAAGATGGG - Intergenic
968317150 3:197734786-197734808 GGAAGAATAAATAGTCAAATAGG + Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
969175286 4:5394157-5394179 CAAAGCATAAAATGTCAGCTGGG - Intronic
970579725 4:17464203-17464225 GAAAGCATAAAACCTCAGAAAGG - Intronic
971041641 4:22759641-22759663 GAGAGCATAAAATCTCAGAGAGG + Intergenic
971107764 4:23545503-23545525 AGAAGCAAAAAATGACAAATGGG + Intergenic
971118804 4:23680682-23680704 GGAAGCAAAATATGTCACAGGGG - Intergenic
972135073 4:35882537-35882559 TGAAGCATGAAATATCAGATGGG + Intergenic
972235032 4:37122131-37122153 GGAAGCATAATATAAAAGATGGG - Intergenic
972633061 4:40858133-40858155 GGAAGCAGAAAATGTCCAATTGG + Intronic
974464421 4:62236070-62236092 GGAAGGATGAAATGGCAGCTGGG + Intergenic
974583011 4:63831482-63831504 TCAAACATAGAATGTCAGATGGG - Intergenic
979442130 4:120763221-120763243 GAAATCATAAAAAGCCAGATTGG + Intronic
979700239 4:123658729-123658751 GGAAAAATAAAATTTCAGAGGGG + Intergenic
980541585 4:134202246-134202268 GGAAACCTAAATTGTCAGAGGGG - Intergenic
981365544 4:143897962-143897984 GGAATCATAAAATATGAAATAGG + Intronic
981386164 4:144133153-144133175 GGAATCATAAAATATGAAATAGG + Intronic
981488021 4:145308146-145308168 AAAAGCAAAAAATGTCAGACAGG + Intergenic
981801748 4:148665835-148665857 GGCAGCATAAAAGAACAGATGGG - Intergenic
982297505 4:153844790-153844812 GGATGTATAATATGACAGATGGG + Intergenic
982377500 4:154709323-154709345 GGAAGTCTAAAATTTTAGATTGG + Intronic
983149943 4:164265715-164265737 GGAACTAAAAAATGTCAGAGTGG - Intronic
983830720 4:172323488-172323510 AGAAGAATAAAATGTCAACTTGG - Intronic
984000623 4:174237514-174237536 TGAAGAATAAAATGTCAAAAAGG - Exonic
984023006 4:174509025-174509047 TGTAGCATAAAATCTCATATTGG - Intronic
984974369 4:185217602-185217624 TGAAGCATACGATGTCACATTGG + Intronic
985046956 4:185950383-185950405 TGAAGTATAAAATCTCAGAGAGG + Intronic
987625999 5:20401461-20401483 GGTAGCATAAATTGTTAAATAGG + Intronic
989425023 5:41287063-41287085 GGAAAGATAATATGTCAGAGTGG - Intergenic
990081335 5:51917720-51917742 GGTATCATCAAATGTTAGATGGG + Intergenic
990505749 5:56443035-56443057 GAAAACATAGATTGTCAGATGGG + Intergenic
993530557 5:89019360-89019382 GAGAGCATTAAATGTCAGTTTGG + Intergenic
994080060 5:95698578-95698600 GGAAGGAGAAAAGGTAAGATAGG - Intronic
995496663 5:112752343-112752365 GGAAGCAAAAAATTTCAGGCTGG - Intronic
1002631519 5:180583893-180583915 GGAAGCAAAAGCTGACAGATTGG + Intergenic
1003383568 6:5647206-5647228 GGAAGCAGGAAAAGGCAGATAGG - Intronic
1005236642 6:23771125-23771147 GGCAGAATAAATTGTCAGACTGG - Intergenic
1006049144 6:31327145-31327167 GAAAGCAAAAATTGTCAAATGGG + Intronic
1006185591 6:32179982-32180004 GGAGGCAGAAAAAGTCAGACAGG - Intronic
1008667175 6:53727646-53727668 GGAAACATAAGATGACAGCTAGG - Intergenic
1009372217 6:62919782-62919804 GAATTCATAAAATGTAAGATAGG - Intergenic
1010304382 6:74301756-74301778 TGAAGCATCACATGACAGATAGG + Intergenic
1010390822 6:75335031-75335053 ATATGCATAAAATGTCAAATGGG + Intronic
1010608508 6:77922465-77922487 GCAAGCATAAAATGAGAGAATGG - Intronic
1011488912 6:87871162-87871184 GGAAGCTGAAAATGTCATGTTGG - Intergenic
1012823148 6:104114193-104114215 TGAATCAGAAAATCTCAGATTGG + Intergenic
1012892767 6:104915606-104915628 CCAAGCAAAAAATGACAGATGGG + Intergenic
1013393286 6:109708973-109708995 AGAAGCAAAAAATGACAAATGGG - Intronic
1013435611 6:110102473-110102495 GTAAGCATAAAATATCTGAGTGG - Intronic
1014534913 6:122603403-122603425 GGATACATAAAATCTAAGATTGG - Intronic
1015084284 6:129269219-129269241 GGAAGTATTCAATGTCACATGGG + Intronic
1016208189 6:141496096-141496118 GGAAACATGAAAAATCAGATAGG - Intergenic
1017095259 6:150799279-150799301 GGAAGGAAAATTTGTCAGATGGG - Intronic
1017225509 6:152016550-152016572 ACAAGTATAAAATCTCAGATGGG - Intronic
1018150383 6:160931635-160931657 GGAAGCTTACAAGGTCAAATGGG - Intergenic
1020192907 7:6014198-6014220 GGAACCATACAATTTCAGAGTGG + Intronic
1020603136 7:10302105-10302127 GTAAGGACAAAATGTCAGTTTGG - Intergenic
1021436262 7:20619689-20619711 AGAAGCAAAAATTGGCAGATGGG - Intronic
1021447473 7:20748985-20749007 GGAAGCAGGACATGGCAGATTGG - Intronic
1021503489 7:21355450-21355472 GAAAGAGCAAAATGTCAGATTGG + Intergenic
1022397849 7:30006941-30006963 GAAAGCAGAAAATTTCAGTTTGG - Intergenic
1022482158 7:30751452-30751474 TAAAGCATAAACTGTCAGAGGGG - Intronic
1022584364 7:31592022-31592044 AGCAACATAAAATGGCAGATGGG + Intronic
1027799550 7:82734399-82734421 GGAAGACTAGAATGTTAGATAGG + Intergenic
1028338590 7:89689837-89689859 GAAAGCATAAAATGGAAGAATGG + Intergenic
1028762669 7:94511856-94511878 GGGAGAATAGAATGTCAGATGGG + Intronic
1029887384 7:103887699-103887721 GGATACAAGAAATGTCAGATGGG + Intronic
1030458829 7:109806176-109806198 GGAAGAATAAAAAGTTATATGGG + Intergenic
1030619462 7:111773317-111773339 AGAAGAATAAAATGTTACATGGG + Intronic
1033816867 7:145083681-145083703 GGAAAAAAAAAATGGCAGATAGG - Intergenic
1035908909 8:3543964-3543986 GAAAGCAGAAAGAGTCAGATAGG + Intronic
1037181852 8:16016672-16016694 GGAAGCAGAAAATGTAAAATTGG - Intergenic
1037697525 8:21238371-21238393 TAAAGGATAAAATGTCAGCTAGG + Intergenic
1038028941 8:23619798-23619820 GTTAGCATAAAATGTCTGGTTGG + Intergenic
1041000145 8:53441749-53441771 GGGATCATAAAATTCCAGATAGG + Intergenic
1044291588 8:90477660-90477682 GGAAGCATAAAAGGTCATACAGG - Intergenic
1046989036 8:120428474-120428496 AAAAGCATAAATTGACAGATGGG + Intronic
1047131970 8:122031247-122031269 GGAACTATAAAATGTCCAATTGG - Intergenic
1048531934 8:135257469-135257491 AAAAGCATGAAATGTTAGATGGG + Intergenic
1049097092 8:140555215-140555237 GCAAGCATACCATGTCTGATGGG - Intronic
1049128325 8:140812269-140812291 GGAATTATAAAATTTCAGGTTGG - Intronic
1051843443 9:21424632-21424654 GAAAGCAAAAATTGACAGATGGG - Intronic
1052180523 9:25520525-25520547 GGAAGAATAAAGTATCAGAATGG + Intergenic
1052493779 9:29199764-29199786 TCATGAATAAAATGTCAGATAGG - Intergenic
1055325145 9:75120892-75120914 GGAAGTATTTAATGTCAGCTTGG - Intronic
1055503481 9:76924957-76924979 GGAGGCAGAAGATGTCAGCTGGG + Intergenic
1056799952 9:89684045-89684067 GGAAGCACAAAATATCCCATGGG + Intergenic
1187859885 X:23671060-23671082 GGAAACACTAAATTTCAGATGGG - Intronic
1187996615 X:24933850-24933872 GGAAGGAAAAAATATCAAATGGG - Intronic
1189431078 X:40947929-40947951 GGCAGCATAAAATGTCAGAGTGG + Intergenic
1189622949 X:42862977-42862999 GGAAGCATGAAAAGACATATCGG - Intergenic
1191649047 X:63516922-63516944 GAAAGCATATAATATTAGATAGG + Intergenic
1191802552 X:65097524-65097546 GGACACATAAAATGGCTGATAGG - Intergenic
1192285423 X:69729938-69729960 AGCAGCATAAAATGTCAAACAGG - Intronic
1192828124 X:74720162-74720184 GTAAACATAGATTGTCAGATTGG + Intergenic
1192851722 X:74963453-74963475 TTATGGATAAAATGTCAGATGGG - Intergenic
1192950571 X:76011921-76011943 GGAACCATGAAATGACAGACTGG + Intergenic
1193077842 X:77374513-77374535 GGGAGAAAAAAATGGCAGATAGG + Intergenic
1193137880 X:77993235-77993257 GGCATCATAAACTTTCAGATTGG + Intronic
1193500669 X:82270459-82270481 GAAAGCAAAAATTGTCAAATGGG - Intergenic
1195826073 X:109002157-109002179 GAAAGCATACAATGACAGATGGG + Intergenic
1200803026 Y:7403664-7403686 GGAAACAGAAGATGTCACATTGG + Intergenic
1201587143 Y:15573590-15573612 GGATTCATCAAATGACAGATTGG + Intergenic