ID: 1096539817

View in Genome Browser
Species Human (GRCh38)
Location 12:52300681-52300703
Sequence ACTTCTGTGCAGGAGTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096539814_1096539817 -3 Left 1096539814 12:52300661-52300683 CCTGCCAAGGGTACTGACAAACT 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1096539817 12:52300681-52300703 ACTTCTGTGCAGGAGTTTCAAGG 0: 1
1: 0
2: 3
3: 20
4: 183
1096539815_1096539817 -7 Left 1096539815 12:52300665-52300687 CCAAGGGTACTGACAAACTTCTG 0: 1
1: 0
2: 2
3: 22
4: 617
Right 1096539817 12:52300681-52300703 ACTTCTGTGCAGGAGTTTCAAGG 0: 1
1: 0
2: 3
3: 20
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096539817 Original CRISPR ACTTCTGTGCAGGAGTTTCA AGG Intronic
900529473 1:3145613-3145635 ACATCTCTGCAGGAGGCTCATGG - Intronic
900939462 1:5788847-5788869 ACCTCAGTGCAGGATCTTCATGG - Intergenic
903728107 1:25467318-25467340 ACTGCTGTCCTGAAGTTTCAAGG + Intronic
906536007 1:46551315-46551337 ACTTCAGGGTAGGAGTTTCTGGG + Intronic
906606102 1:47173416-47173438 ACTTCTGGGCAGGAGTCTAAGGG - Intergenic
906609878 1:47193884-47193906 ACTTCTTTGCATGGGTTTGAGGG + Intergenic
906896443 1:49778424-49778446 AGTTTTGGGAAGGAGTTTCAGGG - Intronic
908050332 1:60222655-60222677 ACATCTGTGCATGTGCTTCAGGG + Intergenic
909958439 1:81804187-81804209 ACTTCTGTCCAGGTGTGTTATGG + Intronic
910771961 1:90839841-90839863 ATTTCTCTTCAGGACTTTCAAGG - Intergenic
912621782 1:111167974-111167996 ACTTCAGTTCAGGAGTTTCAAGG - Intronic
915140026 1:153761917-153761939 ACTACTGAGCAGGAGTTACTAGG - Intronic
919297206 1:195718135-195718157 ACTTCTGGGTAGAAGTTTCTAGG - Intergenic
919861531 1:201741908-201741930 ACTTCTGGGCAGGTGTGCCAGGG + Intronic
921954337 1:220966732-220966754 ACTTTTGTACAGGAATTCCAAGG + Intergenic
924087622 1:240469310-240469332 ATTTCGGAGCAGGAGATTCATGG - Intronic
924178611 1:241418694-241418716 GCCTCTGTGCAGGACTTTTAAGG - Intergenic
1065410188 10:25417732-25417754 ACTTCTCTTCAGGAGTGTCTAGG - Intronic
1066416109 10:35223434-35223456 ACTCCAGGGCAGGACTTTCAGGG + Intergenic
1066546893 10:36509696-36509718 ACTTGAGCCCAGGAGTTTCAAGG + Intergenic
1067974149 10:51005231-51005253 ACTCTTGTGCAGGAGTAACAGGG + Intronic
1069580851 10:69565688-69565710 ACTTCTGAGCATAAGTTTTAAGG + Intergenic
1070066396 10:73039199-73039221 ACTTCTGCCCAGGAGTTGGAAGG + Intronic
1070807025 10:79276620-79276642 GTTTCTGGGCAGGAGTTTCAGGG + Intronic
1070948610 10:80413164-80413186 ATTTCTCTGCTGGAGTTCCATGG - Intronic
1071548412 10:86546512-86546534 ACTTCTGAGCAGAAGGTTTAAGG - Intergenic
1072257958 10:93638834-93638856 AGTTCTGTGCAAGAGTGTGAGGG + Intronic
1073303377 10:102484543-102484565 ACTTCCGTTCAGGTATTTCATGG - Intronic
1074614985 10:115058796-115058818 ACTTTAGTCCAGGAGTTTCAAGG + Intergenic
1074774155 10:116754122-116754144 ACTTCGGTGGAGCAGTTTGAGGG - Intergenic
1079702381 11:23564949-23564971 CCTACTATGCAGTAGTTTCAAGG - Intergenic
1080347675 11:31343233-31343255 ACTTGAGCCCAGGAGTTTCAAGG + Intronic
1081821680 11:46002760-46002782 AGTTCTGTGGAGGGGTTTGAGGG - Intronic
1083681074 11:64352136-64352158 AAGTCTGTGCTGGAGATTCAGGG + Exonic
1087821219 11:102714935-102714957 ACTTCTGAGCAAGACATTCAAGG + Intronic
1088811168 11:113393684-113393706 AATGCTGTGCAGGAAGTTCATGG - Exonic
1089862482 11:121602368-121602390 ACTTCTTTGCACGAGTCTCTAGG - Intronic
1090626879 11:128615784-128615806 AATTCTAGGCAGGAATTTCAGGG - Intergenic
1090652127 11:128816008-128816030 ACTGCTGTACAGGAGGTTTATGG + Intergenic
1095869122 12:47006380-47006402 ACTTGAGTCCAGGAGTTTGATGG + Intergenic
1096399621 12:51295013-51295035 ACTTGAGTGCAGGAGTTTGAGGG - Intronic
1096539817 12:52300681-52300703 ACTTCTGTGCAGGAGTTTCAAGG + Intronic
1096712891 12:53470609-53470631 ACTTGCGTTCAGGAGTTTCATGG - Intronic
1096778742 12:53979859-53979881 ACCTCTGGGCAGGAGTTTCCTGG - Intergenic
1097969118 12:65613388-65613410 ACTTTTGTGCAGAGGTTTCTGGG - Intergenic
1098561332 12:71876383-71876405 ACAACTGAGCAAGAGTTTCAAGG - Intronic
1099110042 12:78547340-78547362 AGTTCTGTCCAGGACTTTCAAGG + Intergenic
1101623626 12:106416703-106416725 AATTCCATGGAGGAGTTTCAGGG - Intronic
1103186255 12:118960426-118960448 ACTGCTGTGCAAAAGATTCAAGG + Intergenic
1105944547 13:25178035-25178057 CTTTCTGTGGAGCAGTTTCACGG + Intergenic
1107200853 13:37715093-37715115 AATAATTTGCAGGAGTTTCATGG + Intronic
1107405940 13:40113393-40113415 ACTCCTTTGCAGGAAATTCAAGG - Intergenic
1108888922 13:55228579-55228601 ACTTCTCTGAAGAAGTTTCCTGG + Intergenic
1110029233 13:70585216-70585238 ATGTCTGTGCAGGAGGGTCATGG + Intergenic
1110454064 13:75670067-75670089 AACTTTGTGCAGGAGTTGCAGGG + Intronic
1111434655 13:88191143-88191165 ACTTGTGCCCAGTAGTTTCAGGG - Intergenic
1111983170 13:95038486-95038508 ATTTCTGAGGAGGAGCTTCAGGG + Intronic
1113784815 13:112996907-112996929 AGATCTGTGCAGGAGTTTCATGG - Intronic
1117436931 14:55724436-55724458 ACTTCTGTGCAGAAGTTTTCAGG - Intergenic
1124600611 15:31130104-31130126 AGATGTGTCCAGGAGTTTCAGGG - Intronic
1126143982 15:45460162-45460184 ACTTTTCTGAAGGAGTTCCATGG + Intergenic
1128469143 15:67937430-67937452 GCCTCTGTGCAGGAATATCAAGG - Intergenic
1129127598 15:73457546-73457568 ACTTCTTGGCACGAGTTTCCAGG - Intronic
1131451957 15:92548932-92548954 TCTTCTCTGCAGGAGTATAAAGG + Intergenic
1132273616 15:100547130-100547152 ACTTGTACGCAGGAGTTTCAAGG + Intergenic
1134218008 16:12331229-12331251 ATCTCTGTGTAGGAGTTTCTAGG - Intronic
1136641315 16:31568135-31568157 TCTTCTGTGCAGGAATTCCCAGG + Intergenic
1137917231 16:52445405-52445427 ATTTGTGTGGAGGAGTTGCAAGG + Intronic
1138256920 16:55573286-55573308 AATTCTTTGCTGGAGTTTCATGG - Intronic
1140720625 16:77768626-77768648 ACTTCTGTTCAGGAGGCTCTTGG + Intergenic
1140726545 16:77818469-77818491 TCTTATGTGCAGCACTTTCAGGG - Intronic
1140875685 16:79150722-79150744 ACTTGAGTCCAGGAGTTCCAGGG - Intronic
1143603024 17:7961645-7961667 CCCTCTCTGGAGGAGTTTCACGG + Intergenic
1145099043 17:20058410-20058432 ACTTGAGTCCAGGAGTTTGAGGG + Intronic
1148236849 17:45974746-45974768 ACTTCTCTGCAGGGTTTTCTGGG + Intronic
1149297335 17:55272719-55272741 AGTTCTGTGCAGGTGATTCTGGG + Intronic
1151280102 17:73067298-73067320 CCTGCTGTGCAGGACTTTCAGGG + Intronic
1151721409 17:75858435-75858457 ACTTGAGTCCAGGAGTTCCAAGG - Intergenic
1153030800 18:711590-711612 GGTTCTGTGCAGGGTTTTCAGGG - Intronic
1153274474 18:3354422-3354444 AGTTCTGTGAAGGCATTTCAGGG - Intergenic
1153469423 18:5427200-5427222 ACTTCTCTACTGGAGTTTCTTGG - Intronic
1153566676 18:6425994-6426016 TCCTGAGTGCAGGAGTTTCAGGG - Intergenic
1155658477 18:28219592-28219614 ACTTCTCTTCAGGAGGTTAAGGG - Intergenic
1156685099 18:39635219-39635241 ACTTCTGGGTGGAAGTTTCAAGG + Intergenic
1156801727 18:41123020-41123042 ACTTCTGTGAGAGAGTTTCCAGG + Intergenic
1157723050 18:49940444-49940466 ACCTTTGTGCTGGAGTTCCAGGG + Intronic
1157740690 18:50090129-50090151 ACTTATGTGGAGTAGTTTTAAGG - Intronic
1160336976 18:78050998-78051020 CCTTCTCTGCACGTGTTTCATGG - Intergenic
1161773555 19:6244302-6244324 CATTCTTTGCTGGAGTTTCATGG - Intronic
1163621732 19:18364874-18364896 ACTTCTGGCCTGGAGCTTCAGGG + Exonic
1164146848 19:22517769-22517791 ACTTCAGTGCTGGAGGTGCAGGG + Intronic
1166022939 19:40049626-40049648 CAGTCTGTGGAGGAGTTTCAAGG + Intronic
1166336466 19:42111155-42111177 TCTTCTGGGCTGGAGTGTCATGG + Intronic
1166614102 19:44227632-44227654 ACTTCAGCCCAGGAGTTTGACGG - Intronic
1167695359 19:51012467-51012489 ACATTTGTGCAGGAGTTTAAAGG - Intergenic
926031583 2:9595390-9595412 ACTTCTGGGAAAGACTTTCAGGG - Intronic
927561837 2:24078966-24078988 GCTTGAGTCCAGGAGTTTCAAGG - Intronic
929847634 2:45546825-45546847 ACTACTGTGCTGCAGCTTCAAGG + Exonic
930557621 2:52919124-52919146 ATATCTTTGCAGGATTTTCATGG - Intergenic
931707299 2:64957846-64957868 ACTTCTGAGAAGAAGATTCAGGG + Intergenic
932287899 2:70552713-70552735 ATTTCTGGGGAGGAGTTCCATGG + Intronic
932305019 2:70695882-70695904 ACTTGGGTGCAGTAGATTCAGGG - Intronic
934889832 2:98057518-98057540 TCTGCTGTGCAGGAGTCCCAGGG + Intergenic
936243639 2:110808427-110808449 TGTTCTGTGCAGGGGTCTCAAGG - Intronic
936923828 2:117716264-117716286 ACTCCTGGGCAGAAGTTTCAAGG - Intergenic
938109639 2:128555237-128555259 ACTCCTGGGAAGGAGTTGCAGGG + Intergenic
938711041 2:133976453-133976475 ACTGCTGTGCAGGAGCCTCTTGG - Intergenic
938913931 2:135915367-135915389 ACTTGTGCCCAGGAGTATCAAGG - Intronic
940010566 2:149050400-149050422 GCTTCTGTGCAGTATTTTGATGG - Intronic
940543724 2:155055953-155055975 ACTTCTGAACAGGAGAATCACGG - Intergenic
942066864 2:172279703-172279725 TCTTCTGTTCAGGAGTTTTAGGG - Intergenic
942772275 2:179536405-179536427 TCTTCAGTGCTAGAGTTTCAAGG - Intronic
943751459 2:191513930-191513952 GCTTCTTTCCAGGTGTTTCAAGG - Intergenic
944910608 2:204306820-204306842 TCTTCTCTGCAGTAGTTGCAGGG - Intergenic
945115468 2:206404096-206404118 TCCTCTCTGGAGGAGTTTCATGG - Intergenic
945563731 2:211370412-211370434 ACTTGTTTTCTGGAGTTTCAGGG - Intergenic
947075932 2:226346073-226346095 ACATGTGTGCCGTAGTTTCAAGG - Intergenic
949067126 2:241998750-241998772 TATTTTGTGCAAGAGTTTCAAGG - Intergenic
1168874066 20:1158402-1158424 ACTGAAGTGCAGAAGTTTCATGG + Intronic
1169533198 20:6507355-6507377 AAATCTGTGCTGGAGATTCAGGG - Intergenic
1172118938 20:32586289-32586311 ACTTGCCTGCAGGAGTGTCATGG - Intronic
1172670421 20:36631233-36631255 ACTTAAGTCCAGGAGTTCCAGGG - Intronic
1172928171 20:38560203-38560225 CCTTCTATGCAGTAGTTTTAGGG - Intronic
1173186590 20:40844895-40844917 CCTTCTCTGCAGAAGTTTCTGGG - Intergenic
1176008174 20:62877381-62877403 ACTGCGGTGAAGGAGTCTCATGG - Intergenic
1178241879 21:30912177-30912199 ACTTCTCTGCTGAATTTTCAAGG + Intergenic
1184307850 22:43619087-43619109 ACATCTGTGCAGGAAGTTCCAGG + Intronic
950453516 3:13079078-13079100 ACATCAGTGCAGGAGTTGCCAGG - Intergenic
952134277 3:30399555-30399577 ACTTAAGCCCAGGAGTTTCAGGG + Intergenic
952156320 3:30647397-30647419 AGTTCTGTGCAGGAGGTTTTTGG - Intronic
953962827 3:47280373-47280395 ACTCTTGTGCAGGGGCTTCAGGG - Intronic
954448834 3:50560921-50560943 ACTTCTGTGCAGGCCATGCAGGG - Exonic
954988239 3:54814545-54814567 ACCTCTCTGAAGGAGTCTCAGGG - Intronic
956451148 3:69376166-69376188 ACTTCAGGGCAGGATTTTCTAGG + Intronic
957337086 3:78844848-78844870 ACTGCTTTGGAGGAATTTCAAGG - Intronic
957356443 3:79093997-79094019 ACTTTTGGGCAGTAGCTTCAAGG + Intronic
959372605 3:105547224-105547246 ACTGCTCTGCAGGAGGTTGAAGG + Exonic
959563341 3:107808009-107808031 ACTCCTCTCCAGCAGTTTCAGGG - Intronic
960084484 3:113575982-113576004 ACTTGTGTGCATGATCTTCATGG + Intronic
961189807 3:124949502-124949524 CCTACTGTACAGCAGTTTCATGG - Intronic
961260565 3:125598152-125598174 ACTTATGCCCAGGAGTTTGAGGG + Intergenic
965006796 3:163037427-163037449 ACTTCTGAGCAGAAGATTTAAGG + Intergenic
965075728 3:163973360-163973382 ATTTCTGTTCAGAAGTTTCACGG - Intergenic
966955175 3:184869470-184869492 CCTTCTCTGCAGGATTATCAGGG + Exonic
969176100 4:5400196-5400218 TCTTTTGTGCAGCAGCTTCAGGG - Intronic
969828561 4:9777593-9777615 ACTTCTGTGCATTGATTTCATGG + Intronic
969906476 4:10401353-10401375 ACCTCTGAGCAGGGGTCTCAGGG - Intergenic
971704521 4:30023208-30023230 AATTCTGTGAAGGAGTTTTGGGG - Intergenic
972316888 4:37935024-37935046 CCTTCTGTGCAGGTGCTCCAAGG - Intronic
973066027 4:45794346-45794368 ACTTGAGTGCAGGAGTTCGAGGG + Intergenic
975723936 4:77274132-77274154 ATTTCTGTGCAGAAGTTCCAGGG - Intronic
978408428 4:108404062-108404084 TCCTCTGAGCAGGAGGTTCAAGG - Intergenic
982696376 4:158606664-158606686 ACTTAAGTCCAGGAGTTTGAGGG - Intronic
984520206 4:180793161-180793183 GCTTCTTTGCATGAGGTTCATGG - Intergenic
985890592 5:2712354-2712376 ACATCTGTGCATGTGTTTAAAGG + Intergenic
986288020 5:6374908-6374930 TCCTCTGTGGAGGAGCTTCAGGG + Intronic
986968341 5:13302359-13302381 GCTTCAGTGATGGAGTTTCATGG + Intergenic
990238415 5:53792729-53792751 AGTTCTGTGAATGAGTTTCAAGG + Intergenic
991636071 5:68707254-68707276 CCTTCTGAGAAGGAGATTCAGGG - Intergenic
992194768 5:74328337-74328359 AGTTCTGTGCAGGATTTTATTGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
996688620 5:126312683-126312705 GCTTCTGAGGAGTAGTTTCATGG - Intergenic
996813961 5:127553449-127553471 ACTTTTGTCCAGGAGTAACAGGG + Intronic
997948542 5:138223592-138223614 ACTTCTGAGCCTCAGTTTCAAGG + Intergenic
999728476 5:154456987-154457009 ACTTCTGGGCAGGAATCACATGG - Exonic
1000343208 5:160293726-160293748 ACTTCTGTGCCTCAGTTTCCTGG - Intronic
1003050064 6:2772078-2772100 ACTGCCGTGCAGGAATTTAAAGG + Intronic
1007496240 6:42261819-42261841 AGTTCTGAGCAGGATTTTGAAGG - Intronic
1007621049 6:43214892-43214914 ACTTGAGTCCAGGAGTTTGAGGG + Intronic
1008698718 6:54073085-54073107 ACTTCAGGGGAGGAGTTGCAGGG - Intronic
1010828996 6:80508043-80508065 ATTTCTGTCAATGAGTTTCATGG + Intergenic
1011018604 6:82786131-82786153 ACATCTGTGCAGAAGTATTAGGG + Intergenic
1018321803 6:162618741-162618763 ACTTTTGGGGGGGAGTTTCAAGG - Intronic
1018777023 6:167026983-167027005 ACTTCTGTGCAGAAGCTTCATGG + Intronic
1020038590 7:4982889-4982911 ACTACTGTGCAGTCGTTCCAAGG + Intergenic
1020156713 7:5731575-5731597 ACTACTGTGCAGTTGTTCCAAGG - Intronic
1020830084 7:13084565-13084587 ACTTCTATTAAGGAGTTTTAAGG - Intergenic
1027149505 7:75722881-75722903 ACTTTTGTGCATGAGTGCCAGGG + Intronic
1027756632 7:82222257-82222279 ACTTCTGAGAAGGAATTTCTAGG + Intronic
1030529353 7:110693802-110693824 ATTTCAGTGCAAGAGTTCCAGGG - Intronic
1031875152 7:127131076-127131098 ACCTTAGTGCAGGAGTTGCATGG + Intronic
1035680426 8:1483614-1483636 ACTGCTGTGCAGGAGGCTCAGGG + Intergenic
1035719848 8:1783792-1783814 ACTTCTGTCGAGGAGCTTCGGGG + Exonic
1036123358 8:6041309-6041331 AATTGTGAGCAGGACTTTCATGG + Intergenic
1038905365 8:31896282-31896304 CTTTCTGTGCAGAAATTTCAAGG + Intronic
1046662697 8:116965587-116965609 ACATCTTTGCAGGATTTTGAGGG + Intronic
1048211809 8:132460487-132460509 ACTTGTGTACTGGAGTTTAACGG - Intronic
1048599663 8:135906422-135906444 ACATCTGTGCAGGAGCTTTCTGG - Intergenic
1051877535 9:21807539-21807561 ATTTCTGTGGAGGAGGTTAAGGG - Intronic
1055312980 9:75003581-75003603 ACTGCTGTGAAGGAGATTCAGGG - Intronic
1056482691 9:87021698-87021720 ACTTCCGTGCACGAGCTACATGG + Intergenic
1058673829 9:107383548-107383570 ACTTGAGCCCAGGAGTTTCAGGG - Intergenic
1058888733 9:109342926-109342948 CCTGCTGGGCAGGGGTTTCATGG - Intergenic
1059576494 9:115494500-115494522 ACTTATTTGCAGCAGCTTCATGG + Intergenic
1060262071 9:122084498-122084520 ACCTCTGTGGAGGAATCTCAGGG + Intronic
1060475050 9:123980546-123980568 ACTTCTGAGCAGGGTTTTAAGGG - Intergenic
1186309701 X:8304180-8304202 ACCTCTGTGCAGAAGTTTAAAGG - Intergenic
1187279938 X:17850494-17850516 GCTTCTTTGGAGGAGTTTGAGGG - Intronic
1190257917 X:48777692-48777714 ACACCTGTGAAGGAGTTTCTCGG - Intergenic
1193259129 X:79384666-79384688 ACTTCTGTGAAGAATGTTCATGG - Intergenic
1197659266 X:129152233-129152255 ACTTTTGTGCTGAAGTTTGAAGG + Intergenic
1197877039 X:131120286-131120308 ACTTCTGTGCATAATTTTCTTGG - Intergenic
1199026735 X:142948057-142948079 ACTTCAGAGCAAGGGTTTCAGGG + Intergenic
1200276642 X:154739209-154739231 GCTTCTGTTAATGAGTTTCAGGG - Intronic
1200913297 Y:8549772-8549794 ACAGCTGAGCAGGAGCTTCATGG + Intergenic
1201986136 Y:19968914-19968936 AGTTCTGTGTAGTAGTTTCGAGG + Intergenic
1202095868 Y:21247729-21247751 ACGTCTGTGCTCGAGTCTCATGG + Intergenic