ID: 1096540836

View in Genome Browser
Species Human (GRCh38)
Location 12:52306124-52306146
Sequence CAGCTCGGCCAACTTGCAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 3, 2: 1, 3: 5, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096540836_1096540846 11 Left 1096540836 12:52306124-52306146 CCCGCTGCAAGTTGGCCGAGCTG 0: 1
1: 3
2: 1
3: 5
4: 116
Right 1096540846 12:52306158-52306180 GCAGAAGGCCAAGCAGGACATGG 0: 9
1: 7
2: 20
3: 129
4: 701
1096540836_1096540849 26 Left 1096540836 12:52306124-52306146 CCCGCTGCAAGTTGGCCGAGCTG 0: 1
1: 3
2: 1
3: 5
4: 116
Right 1096540849 12:52306173-52306195 GGACATGGCCTGCCTGATCAGGG 0: 3
1: 3
2: 1
3: 8
4: 153
1096540836_1096540848 25 Left 1096540836 12:52306124-52306146 CCCGCTGCAAGTTGGCCGAGCTG 0: 1
1: 3
2: 1
3: 5
4: 116
Right 1096540848 12:52306172-52306194 AGGACATGGCCTGCCTGATCAGG 0: 3
1: 1
2: 0
3: 10
4: 133
1096540836_1096540843 5 Left 1096540836 12:52306124-52306146 CCCGCTGCAAGTTGGCCGAGCTG 0: 1
1: 3
2: 1
3: 5
4: 116
Right 1096540843 12:52306152-52306174 TGCCCTGCAGAAGGCCAAGCAGG 0: 5
1: 7
2: 11
3: 51
4: 391
1096540836_1096540842 -4 Left 1096540836 12:52306124-52306146 CCCGCTGCAAGTTGGCCGAGCTG 0: 1
1: 3
2: 1
3: 5
4: 116
Right 1096540842 12:52306143-52306165 GCTGGAGGGTGCCCTGCAGAAGG 0: 2
1: 8
2: 15
3: 64
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096540836 Original CRISPR CAGCTCGGCCAACTTGCAGC GGG (reversed) Exonic
900888030 1:5429319-5429341 CTGCTCGTCCAACTTGCATGTGG - Intergenic
902275248 1:15334924-15334946 CAGCTTGGCCACTTGGCAGCCGG - Intronic
903344886 1:22677560-22677582 CAGCTCTGCCACATCGCAGCTGG - Intergenic
910332133 1:86086323-86086345 TAGGTCAGCCAACTTGGAGCTGG - Intronic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
919795440 1:201318858-201318880 CATCTCAGCCAACATTCAGCCGG + Intronic
920387611 1:205579889-205579911 CACCGTGGCCAACATGCAGCTGG + Exonic
923647533 1:235839348-235839370 CAGCCTGGCCAACTTGAACCTGG - Intronic
1065844646 10:29735275-29735297 CAGCTCCGGCCACTTGCGGCTGG + Intronic
1067078223 10:43199984-43200006 CAGCACAGCCATCTTGGAGCAGG + Intronic
1067112941 10:43413435-43413457 CAGCTCAGCCATCTAGAAGCTGG - Intergenic
1069600995 10:69708042-69708064 CAGCTCCTCCAACTTGCAGGTGG + Intergenic
1069788417 10:71004441-71004463 CAGGACGGCCACCTTGCTGCCGG - Intergenic
1075090509 10:119441734-119441756 CAGGTCGGTCAACGTCCAGCCGG + Intronic
1075869865 10:125763419-125763441 CTGCTGGGCCAGCTTGCCGCCGG + Exonic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1078318669 11:10313253-10313275 CACCTCGGCCTCCTTGTAGCTGG - Intronic
1079399318 11:20093012-20093034 CTGCTGTGCCAACCTGCAGCGGG + Intronic
1083273731 11:61585417-61585439 CTGCACAGCCAACTTCCAGCTGG - Intergenic
1084463580 11:69309413-69309435 CAGCTGGGGCAACTGGAAGCAGG + Intronic
1085309146 11:75506012-75506034 CAGCTCCGCCAAGTACCAGCTGG + Intronic
1086557542 11:88128895-88128917 CTACTGGGACAACTTGCAGCAGG + Intronic
1090247484 11:125226840-125226862 CAGCTGGGCCAGCCTGCAACAGG - Intronic
1093077128 12:14770036-14770058 CTGCTCGGCCACCTGGCGGCGGG - Intronic
1093699855 12:22207112-22207134 CAGATAGGCCAATGTGCAGCAGG + Intronic
1094497588 12:30998169-30998191 CAGCACTGCCTATTTGCAGCAGG - Intergenic
1095736866 12:45567166-45567188 CAGCTCTGCCACCTAACAGCTGG + Intergenic
1096532779 12:52252395-52252417 CAGCTCGGCCAGCTTGCAGCGGG + Intronic
1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096540836 12:52306124-52306146 CAGCTCGGCCAACTTGCAGCGGG - Exonic
1096542534 12:52316027-52316049 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG + Exonic
1096569957 12:52516771-52516793 CAGCTCGGCCAGCTTGTTCCTGG + Exonic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1096757078 12:53808610-53808632 CAGCTGGGAAAACTTGGAGCCGG + Intergenic
1096977287 12:55706891-55706913 CAGGTCTGCCAACCTGCAGTAGG - Intronic
1104077662 12:125404707-125404729 CAGCTAGTCCTTCTTGCAGCTGG + Intronic
1107103081 13:36614834-36614856 CAGCTCAGTGAACATGCAGCTGG + Intergenic
1110577118 13:77070307-77070329 AAGCTCATCCAACCTGCAGCCGG + Intronic
1114398127 14:22385119-22385141 CAGCTAAGCCAACAAGCAGCTGG + Intergenic
1115261339 14:31457312-31457334 CGGCTGGGCGAATTTGCAGCCGG + Exonic
1119186102 14:72643642-72643664 CAGCTATTCCCACTTGCAGCTGG + Intronic
1120191908 14:81447242-81447264 CAGCTCTGCCAGCTTCTAGCTGG + Intergenic
1121609956 14:95271563-95271585 CAGATCTACCAACTGGCAGCAGG + Intronic
1123509473 15:20982211-20982233 CAGCATGCCCAACCTGCAGCAGG + Intergenic
1123566695 15:21555950-21555972 CAGCATGCCCAACCTGCAGCAGG + Intergenic
1123602956 15:21993243-21993265 CAGCATGCCCAACCTGCAGCAGG + Intergenic
1128614778 15:69100622-69100644 CACCTGGGCCAAGCTGCAGCTGG - Intergenic
1202975057 15_KI270727v1_random:283045-283067 CAGCATGCCCAACCTGCAGCAGG + Intergenic
1132592671 16:733116-733138 CAGGTGGGCCCATTTGCAGCTGG - Intronic
1136619478 16:31418502-31418524 CAGCAAGGCCACCTTCCAGCTGG + Exonic
1137436155 16:48455685-48455707 CACCTCTGCCAACTGGGAGCTGG - Intergenic
1137898865 16:52243605-52243627 CAGCTCCTGCCACTTGCAGCTGG - Intergenic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1141276380 16:82592330-82592352 CAGCTCATCAAACTTGCACCAGG + Intergenic
1141675028 16:85513323-85513345 CAGCTCAGCCACTTTGCAGCTGG + Intergenic
1141917378 16:87108752-87108774 CAGCCCAGCCAGCTTGCTGCAGG + Intronic
1152235084 17:79134490-79134512 CAGCTCTGCAGCCTTGCAGCTGG + Intronic
1152589066 17:81202444-81202466 CAGCTCTGCCCACAGGCAGCAGG + Intronic
1161347601 19:3776042-3776064 CTTCTCAGCCAACTTGCAGAAGG + Intergenic
1162328896 19:10014900-10014922 CAGCTCTGCTACTTTGCAGCTGG - Intronic
1163820425 19:19493412-19493434 GAGCTCAGCACACTTGCAGCTGG - Intronic
1164050948 19:21585663-21585685 CAGCACGGCAGACTTGCTGCTGG + Intergenic
1165815016 19:38636673-38636695 CAGCTCTGCCAATTAACAGCTGG - Intronic
1165896737 19:39145915-39145937 CAGCTCCGCCACCTTCTAGCTGG + Intronic
1166355566 19:42225345-42225367 CAGCTCCGCCAACCGGCTGCAGG + Exonic
1166391338 19:42410490-42410512 CAGCTCGGCCAGGTTGTGGCTGG + Exonic
1168020952 19:53608290-53608312 CAGCTCGGCCCATTTGTAGTCGG + Intergenic
927787071 2:25981699-25981721 CAGGTCGGCCTGCTTGGAGCTGG + Exonic
927959874 2:27234471-27234493 CAGCAAGGCCAACCTGCAGAAGG + Intronic
937168018 2:119838464-119838486 CAGCTCTGCAGACCTGCAGCAGG - Intronic
948834704 2:240620407-240620429 CAGCTCTGCCCACCTGCAGCAGG - Intronic
1171416426 20:24984127-24984149 GAGGTCGGCCAGCTTGCAGTGGG - Intronic
1172527333 20:35607720-35607742 CAGTCCTGCCAGCTTGCAGCTGG - Intergenic
1174254239 20:49242439-49242461 CAGCTCCTCCAAGTAGCAGCTGG - Intronic
1175671071 20:60903230-60903252 CAGCTCGCCCTCCATGCAGCTGG + Intergenic
1181395164 22:22616296-22616318 CAGCTCCCCCAACAGGCAGCTGG + Intergenic
1182811552 22:33121242-33121264 CAGCTAGGCCAGTTGGCAGCTGG - Intergenic
1183987912 22:41579435-41579457 CAGCTCCGCAAACGTGGAGCAGG + Intronic
949889950 3:8726331-8726353 CTGGTCAGCCAACATGCAGCTGG - Intronic
950274121 3:11643880-11643902 CAGCGCTGCCGGCTTGCAGCGGG - Exonic
952239383 3:31514427-31514449 CAGTTTGGCCAACTTGCCACGGG - Intergenic
956559992 3:70564861-70564883 CACCTGTGCCAACCTGCAGCAGG + Intergenic
957639828 3:82837869-82837891 AAGCTTGTCCAACGTGCAGCCGG - Intergenic
965520823 3:169666783-169666805 CAGCTCCGCCAACTTGTTGGAGG - Intergenic
965596887 3:170419185-170419207 CAGCTCATCCAGCTTGCGGCAGG - Exonic
966876351 3:184324081-184324103 CAGCTCTGCCTCCTTCCAGCTGG - Intronic
967582421 3:191175144-191175166 CATCTCGGCCACTTTCCAGCTGG + Intergenic
968690432 4:1987239-1987261 CAGCTGGGTAAACTTGCAGATGG - Intronic
969097428 4:4744171-4744193 CGACTCGGCCACCTTGCATCTGG - Intergenic
970062175 4:12046935-12046957 CACCTCACCCATCTTGCAGCTGG - Intergenic
976812003 4:89108403-89108425 GAGCTGGGCCACCTTGCAGGTGG + Intronic
982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG + Intronic
989133766 5:38133251-38133273 GAGCTCTGCCAACTTGCTGGAGG - Intergenic
989742064 5:44785029-44785051 AAGGTGGGCCAACTTGAAGCAGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
1001749710 5:174119382-174119404 CAGCTTGACCAGCTTGCATCTGG - Intronic
1006121182 6:31806914-31806936 AAGCGCGGCCGACTTGCGGCTGG + Exonic
1006929770 6:37680746-37680768 CAGCTGGGCCAAGTGGCAGGGGG - Intronic
1012694196 6:102356286-102356308 AAGTTCGTCCAATTTGCAGCTGG - Intergenic
1013625644 6:111934702-111934724 CAGCTTTGCCAACCTGCAGTGGG + Intergenic
1018759347 6:166877648-166877670 AAGCTGGGACAACTTGAAGCAGG + Intronic
1019598498 7:1869463-1869485 GAGCTCAGCCCACGTGCAGCTGG + Intronic
1025003138 7:55334857-55334879 AAGGTCGGACAACTTGAAGCTGG - Intergenic
1034854111 7:154524512-154524534 CAGATCAGCCAACATCCAGCTGG - Intronic
1035316855 7:158001937-158001959 CAGCTTGGCCAGCTTCCGGCTGG - Intronic
1035777833 8:2203252-2203274 CAGCACCACCAACCTGCAGCCGG - Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1046144328 8:110137957-110137979 CAGCTGGGCACAATTGCAGCTGG - Intergenic
1049322302 8:142003024-142003046 CAGCTCAGCCAGCCTCCAGCAGG - Intergenic
1049960645 9:734902-734924 CAGCTCGGGCAGCCTACAGCTGG - Intronic
1053160820 9:35812214-35812236 CAGCTGGGCGGACTTGCAGGTGG + Exonic
1053430640 9:38039821-38039843 CCTCTGGGGCAACTTGCAGCTGG + Intronic
1057076394 9:92140421-92140443 CAGCTCGGCCACCCTGAGGCTGG - Intergenic
1057902899 9:98963361-98963383 CAGCTCCCCCAAATTGCAGACGG + Intronic
1057976362 9:99609866-99609888 CAGCCCCGCCATCATGCAGCTGG + Intergenic
1060247205 9:121957047-121957069 CAGCTGGGCCAACATGCAGTGGG - Intronic
1061735950 9:132659207-132659229 CAGCTCGGCCACCATTCAGAAGG - Intronic
1061995687 9:134181603-134181625 CAGCTGGGCCCAGCTGCAGCAGG - Intergenic
1189267233 X:39726115-39726137 CTGCTGGGCAAACTTCCAGCAGG + Intergenic
1191716545 X:64197524-64197546 CAGCATGGCCAACTTGAAGAGGG + Intronic
1192214458 X:69149077-69149099 CAGCTCTGCCACTTGGCAGCTGG - Intergenic
1198005419 X:132489116-132489138 CAGAGCGGCCGACTTGGAGCCGG - Intronic
1199694589 X:150334858-150334880 CATCTCACCCAACTTGCATCTGG - Intergenic
1200408770 Y:2841384-2841406 CAGCTCAGCCAACTTGACGGGGG + Intergenic