ID: 1096541657

View in Genome Browser
Species Human (GRCh38)
Location 12:52311215-52311237
Sequence CTCCAAAAGCTGAAGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 303}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096541657_1096541662 3 Left 1096541657 12:52311215-52311237 CCAAGCTCCTTCAGCTTTTGGAG 0: 1
1: 0
2: 2
3: 26
4: 303
Right 1096541662 12:52311241-52311263 CGGGTAGTTTACCCACTTAAAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1096541657_1096541663 7 Left 1096541657 12:52311215-52311237 CCAAGCTCCTTCAGCTTTTGGAG 0: 1
1: 0
2: 2
3: 26
4: 303
Right 1096541663 12:52311245-52311267 TAGTTTACCCACTTAAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096541657 Original CRISPR CTCCAAAAGCTGAAGGAGCT TGG (reversed) Intergenic
900724923 1:4209872-4209894 GTCCAAAAGCTAAAGAATCTGGG + Intergenic
901064869 1:6489865-6489887 CTCCTCAAGTTGAGGGAGCTCGG - Intronic
901938273 1:12643091-12643113 CTCCGAGTGCTGCAGGAGCTTGG - Intergenic
902225841 1:14996060-14996082 CTCCAGAGGCAGAAGGGGCTGGG - Intronic
902620044 1:17645502-17645524 CCCCACAACCTGTAGGAGCTGGG - Intronic
902922508 1:19675106-19675128 CTCCAAAGGTGGAAGCAGCTTGG + Intronic
903689732 1:25164250-25164272 CTCCAGGAGCAGAAGGAGCCTGG - Intergenic
904080478 1:27869366-27869388 GTCCAAAAGCTGACAGAGATGGG + Intergenic
904268715 1:29334117-29334139 GTCCAAAGGCTTAAGGAGATAGG + Intergenic
905186589 1:36201527-36201549 CTCCAAAGGCTGAGTGAGCCAGG - Intergenic
906280476 1:44549950-44549972 CTCCAAAAAGTGAAGCAGCAAGG + Intronic
906367729 1:45224699-45224721 CTTCAAAAGTTGAAGGAATTGGG + Intronic
907597053 1:55729634-55729656 ATCCAAAAGCTTAGGGAGATTGG + Intergenic
908438525 1:64130653-64130675 CTCCAGAAGAGGAAGGAGGTAGG + Intronic
909091228 1:71228506-71228528 CTCTAAAAGCTATATGAGCTTGG + Intergenic
910211399 1:84797396-84797418 CACCAAAAGCTGGAAGAGGTAGG - Intergenic
910639239 1:89441984-89442006 CTCCAAAGGCTTAGGGAGATTGG - Intergenic
911434360 1:97837071-97837093 CTCCAAAACCAGAAGGATATTGG - Intronic
913318719 1:117574247-117574269 CCCCGAAGGCTGATGGAGCTGGG - Intergenic
915311569 1:155008125-155008147 CACCGAAAGAGGAAGGAGCTGGG - Intronic
915552999 1:156646099-156646121 CTGCTAAAGCTGCAGGAGCCTGG - Exonic
915724490 1:158007910-158007932 CTCCAAATGCTTCAGGAGCAGGG - Intronic
917238218 1:172917565-172917587 ATCCAAAAGATGAAGGAACAAGG - Intergenic
918704704 1:187645942-187645964 CTCCAAAAGATCATGAAGCTGGG + Intergenic
919230437 1:194765979-194766001 GTCCCAAAGCTGAAGAAGTTGGG + Intergenic
919924102 1:202183378-202183400 CTGCAGGAGCTGAAGGAGGTGGG + Intergenic
920561093 1:206939088-206939110 CCCCAGAAGCCCAAGGAGCTTGG + Intronic
920821303 1:209383920-209383942 CTCCATGAAATGAAGGAGCTTGG + Intergenic
920831570 1:209470314-209470336 CCCCCAAAGCTGAAGGACCCAGG - Intergenic
923441466 1:234024602-234024624 CACCACATGATGAAGGAGCTGGG + Intronic
923774634 1:236967413-236967435 CTACAAAAGATGAGGGAGCTTGG + Intergenic
923825404 1:237494320-237494342 GTCCAAAAGCTGAAGAACTTGGG + Intronic
1063523811 10:6764678-6764700 CTCCAGAAGCTGCAGGCACTAGG + Intergenic
1064854866 10:19754711-19754733 GTCCAAAAGCTGAAGAACTTGGG - Intronic
1064958425 10:20937433-20937455 CTTCAAAAGTTGAAAGAGCCAGG + Intronic
1064979019 10:21147790-21147812 GTCCGAATGCTGAAGGGGCTGGG - Intronic
1065608411 10:27445344-27445366 GTCCAAGAGCTGAAGAACCTGGG + Intergenic
1067261663 10:44698404-44698426 CTCCAAAAGATGAAGGACAAAGG - Intergenic
1068446945 10:57136566-57136588 ATCCAAAGGCTTAAGGAGATTGG + Intergenic
1068713108 10:60155829-60155851 GTCCAAAAGCTGAAGAACTTGGG - Intronic
1070737543 10:78874288-78874310 GTCCAAAAGCTGAAGAACTTGGG - Intergenic
1071267357 10:83976014-83976036 ATCCAAAGGCTTAAGGAGATTGG - Intergenic
1071389483 10:85157093-85157115 CTCCAAAAGTTCAATGAGTTGGG + Intergenic
1072145169 10:92629275-92629297 CAAAAAAATCTGAAGGAGCTGGG - Intronic
1072420776 10:95289610-95289632 GTCCAGCAGCTGAAGGAGTTTGG - Intronic
1077315506 11:1917783-1917805 CTGCCAAAGCTCCAGGAGCTGGG + Intergenic
1079819779 11:25111035-25111057 CCCCAAAAAATGAAGTAGCTAGG - Intergenic
1079910896 11:26307999-26308021 CTCCAAAAGTAGAAGGATTTGGG - Intergenic
1080060371 11:27950299-27950321 CTACAAAAACTGAGAGAGCTGGG + Intergenic
1080095820 11:28405087-28405109 CAACAAAAGCTTATGGAGCTTGG + Intergenic
1081751522 11:45514419-45514441 CACAGAAAGCTGAAGGCGCTGGG + Intergenic
1082918835 11:58469655-58469677 GTCCAAAAGCTGAAGAACTTGGG + Intergenic
1083284208 11:61647483-61647505 TTCCAAAACTGGAAGGAGCTCGG + Intergenic
1083562683 11:63685742-63685764 CTCCAAAACCAAGAGGAGCTTGG - Intronic
1083596045 11:63918669-63918691 CTCCAAAGGGTGGAGGTGCTGGG - Intergenic
1084447713 11:69213335-69213357 CCCCAGAAGCTGAAGGAGGCGGG + Intergenic
1085524320 11:77155411-77155433 CATAAAGAGCTGAAGGAGCTGGG - Intronic
1085557765 11:77440918-77440940 CTCCAAAAGCTAGATGGGCTTGG + Intronic
1087321178 11:96660703-96660725 CAGCAGGAGCTGAAGGAGCTTGG - Intergenic
1087490619 11:98822610-98822632 CTCCAACAGCTGAATGTGCTCGG + Intergenic
1088049873 11:105498941-105498963 GTCCAAAAGCTGAAGAACTTGGG + Intergenic
1090457770 11:126864780-126864802 CCTCTAAAGCTGATGGAGCTAGG + Intronic
1093032128 12:14297989-14298011 ATCCAAAAGCTTAGGGAGATTGG - Intergenic
1093746223 12:22743786-22743808 CTCCAAAACCTAAACAAGCTTGG - Intergenic
1093778281 12:23103173-23103195 ATCCATGAGCTGAAGGAGCTGGG - Intergenic
1094530021 12:31265666-31265688 CTCTGAAAGCAGATGGAGCTAGG + Intergenic
1095150824 12:38795038-38795060 TTCCAAAAGCTGAAGAACTTGGG - Intronic
1095487445 12:42699749-42699771 TGCCAAAATCTGAATGAGCTTGG - Intergenic
1095508792 12:42926971-42926993 CACCAAAAGCTGAAGAGGCAGGG - Intergenic
1096497635 12:52047627-52047649 CTCCATAACCTGCAGCAGCTTGG + Intronic
1096541657 12:52311215-52311237 CTCCAAAAGCTGAAGGAGCTTGG - Intergenic
1097492160 12:60283438-60283460 CTGCCAAAGCTGAATGAGCAAGG - Intergenic
1097554584 12:61121460-61121482 GTCCAAAAGCTGAAAGAACTTGG - Intergenic
1097796288 12:63865652-63865674 CTTCAAAAGTTGAAGGAATTGGG - Intronic
1098495681 12:71133036-71133058 CTCAAAAATCTGAAGAAGTTGGG + Intronic
1099723335 12:86392537-86392559 CTCCAAAAGCCTAAGCAGCACGG + Intronic
1100527694 12:95435223-95435245 CTTCAAAAGTTGAATGAACTGGG + Intergenic
1100556188 12:95696111-95696133 CTCCAAAGGAAAAAGGAGCTAGG - Intronic
1100583777 12:95960444-95960466 CTCCCAAAGCTGAAGGAACTTGG + Exonic
1100961956 12:99972540-99972562 CATCAAGAGCTGATGGAGCTGGG + Intronic
1101192639 12:102351050-102351072 GTCCAAAAGCTGAAGAACTTGGG + Intergenic
1102096716 12:110246998-110247020 CTCCATAAGGTGAAGGGGCCAGG + Intergenic
1105445093 13:20447027-20447049 CTCCAAAAGCTGTTGCAGCATGG - Intronic
1106961428 13:35002921-35002943 CTTCAAACGTTGAAGGAACTGGG - Intronic
1107114985 13:36737246-36737268 CTCCAAAATCTGAATGTTCTTGG + Intergenic
1108422728 13:50267175-50267197 CTGCAAAAGTGGAAGAAGCTGGG - Intronic
1109099014 13:58155873-58155895 CTCTAAACACTGAAGGAGATTGG + Intergenic
1109688356 13:65850465-65850487 CTTCAAAAGTTGAATGAACTGGG - Intergenic
1110263102 13:73508281-73508303 GCTCAAAGGCTGAAGGAGCTGGG - Intergenic
1110351718 13:74516356-74516378 CTCCAAAATCTAAAGTAGTTAGG - Intergenic
1111049511 13:82862231-82862253 CTCCCAAAGCCCAAGGTGCTGGG + Intergenic
1111385078 13:87514917-87514939 CTCATAAAGCTGTAGGTGCTTGG + Intergenic
1112090681 13:96080041-96080063 TGCCAAAAGCTGAATGAACTTGG - Intergenic
1112904927 13:104405579-104405601 ATGCAAAAGCTGAGGGAGATGGG + Intergenic
1112989196 13:105490065-105490087 CTACCAAAGCTGAATGAGTTTGG + Exonic
1113090382 13:106611931-106611953 GTCCAAAAGCTGAAGAACTTGGG - Intergenic
1114038485 14:18653014-18653036 GTCCAAAAGCTGAAAGAACTTGG + Intergenic
1114120136 14:19662029-19662051 GTCCAAAAGCTGAAAGAACTTGG - Intergenic
1114205645 14:20569061-20569083 ATCCAAAAGCTTAGGGAGATTGG + Intergenic
1115919956 14:38361467-38361489 CTCCACAAGCTGAAAGAGGAAGG + Intergenic
1116531142 14:45975601-45975623 GTCCAAAAGCTGAAGGACTTAGG + Intergenic
1117913938 14:60657684-60657706 CTCCAAAAACTGGAGGCGTTGGG + Intronic
1119059970 14:71464189-71464211 ATCCAAAAGCTTAAGGAGATTGG - Intronic
1121290211 14:92768279-92768301 CTCTTAAAGCTGAAGGCACTTGG - Intergenic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1121694055 14:95898415-95898437 CTCCCAGAGCTGAAGGACGTGGG - Intergenic
1121805712 14:96819829-96819851 CTCCAAAAGTTGAATGAATTGGG - Intronic
1121883478 14:97521608-97521630 CTCAGGAAGCTCAAGGAGCTTGG - Intergenic
1121884371 14:97529720-97529742 CTCCAAAGGCTGAAGAAGCTGGG + Intergenic
1125924567 15:43551896-43551918 CTCAAAAAGCAAAAGGAGCCGGG - Intronic
1127803915 15:62501134-62501156 CTCAGAAGGCTGAAGGAGCTTGG + Intronic
1127918006 15:63471359-63471381 ATCCAAATGCTGAAGGAGACTGG + Intergenic
1128644218 15:69363041-69363063 AACCAACAGCTGAAGGAGCTCGG - Intronic
1128780380 15:70355200-70355222 CTGAAAAAGCAGAAAGAGCTGGG - Intergenic
1129924450 15:79350470-79350492 GTCCAAAAGCTGAAGAACTTGGG + Intronic
1130402445 15:83570163-83570185 CTCCAATAAATGCAGGAGCTTGG - Intronic
1130563396 15:84976075-84976097 GGCCAAAAGCTGGAGGACCTTGG + Intergenic
1130772445 15:86938431-86938453 CTCCAAAAGATCAGGGAGGTAGG - Intronic
1130980892 15:88811223-88811245 CTCAAAATGCTGATGGACCTTGG + Intronic
1131182653 15:90250947-90250969 CTTCAACATCTGGAGGAGCTGGG + Intronic
1133359820 16:5165437-5165459 CTCCACAAGCTGAATAAGCTTGG - Intergenic
1134197959 16:12173631-12173653 CTCCAGAAGCAGAAGGTGTTTGG - Intronic
1136536868 16:30904627-30904649 CTCCACGAGCTGGAGGTGCTGGG + Intergenic
1137569112 16:49553126-49553148 CTCTGAAGGCAGAAGGAGCTGGG + Intronic
1138002813 16:53299577-53299599 CTCCAAAAGCTGGAGATGATTGG + Intronic
1139616252 16:68095295-68095317 CTCAAGTAGCTGAAGTAGCTGGG + Intronic
1139661717 16:68425447-68425469 CTCCAAGAGATGAGGAAGCTGGG - Intronic
1139681818 16:68570938-68570960 CCTCAGATGCTGAAGGAGCTGGG + Intronic
1142875467 17:2849608-2849630 CTCCAAAGGCTGAGGGGGCCTGG - Intronic
1143364909 17:6400755-6400777 GTCCAAAGGCTGAAGAAACTAGG - Intronic
1143593699 17:7901328-7901350 CTGCGAAAGCTGAAGGAGCAAGG + Exonic
1144718056 17:17447954-17447976 CACCAGAAGCTGGAGGAGGTAGG + Intergenic
1145909008 17:28532056-28532078 CTCCAAAAGCTTTAGGGGTTAGG - Intronic
1146587274 17:34093219-34093241 CTAGAAAAGGTGAAGGAGTTAGG - Intronic
1148802646 17:50241227-50241249 CTCTAAAAGATGAAGAGGCTGGG - Intergenic
1150890722 17:69145862-69145884 GTCCCAAAGCTGAAGAAACTTGG - Intergenic
1151813307 17:76458129-76458151 AACCAAAAGTTGAAGAAGCTGGG + Intronic
1153597362 18:6741404-6741426 CTCCAGAAGCTGGAAGAGGTGGG - Intronic
1154055925 18:11014112-11014134 CTCCACTTGCTGTAGGAGCTAGG + Intronic
1155459429 18:26060615-26060637 CTCCAAAATCTGAATGACTTAGG - Intronic
1156428251 18:37039907-37039929 TGCCAAAACCTGAATGAGCTAGG - Intronic
1156507636 18:37608509-37608531 CTTCAGAGGCTGAGGGAGCTGGG + Intergenic
1157321143 18:46635463-46635485 GGCCAATAGCTGATGGAGCTAGG - Intronic
1157451386 18:47791733-47791755 CTGCAACAGCTGGAGGGGCTTGG + Intergenic
1158333932 18:56394225-56394247 ATCCAAGGGCTGAAGGAGCCGGG - Intergenic
1158571962 18:58603791-58603813 TTCCAAAAGATGTAGGAGTTGGG - Intronic
1160818919 19:1049140-1049162 CTATAAAAGCTGCGGGAGCTTGG - Intronic
1160842135 19:1150897-1150919 ATGCAAAAGCTGGAGGAGCGGGG - Intronic
1165556904 19:36642033-36642055 CTCCAAAAGCTGAGTGAGGTAGG - Intronic
1166068057 19:40371664-40371686 CTCCTACAGGTCAAGGAGCTGGG + Exonic
1166940311 19:46359186-46359208 GTCCAAAAGCTGAAGTAGGATGG + Intronic
1167886617 19:52505180-52505202 CTCAAAAACCAGAATGAGCTGGG - Intronic
1167892040 19:52548032-52548054 CTCAAAAACCAGAATGAGCTGGG - Intronic
1167912249 19:52713594-52713616 CTCAAAAACCAGAATGAGCTGGG + Intronic
925080985 2:1066319-1066341 CTTCAAAAGTTGAATGAGTTGGG - Intronic
925245920 2:2382833-2382855 GTCCAAAAGCTGAAGAATTTGGG - Intergenic
925919753 2:8630833-8630855 CTCGACAGGCTGATGGAGCTGGG + Intergenic
926766991 2:16330544-16330566 TTCCTAAAGCAGAAGGAGGTGGG - Intergenic
926832796 2:16981726-16981748 GTCCAAAAGCTGAAGAACTTGGG - Intergenic
926987239 2:18638500-18638522 GTCCAAAAGCTGAAGAACTTGGG - Intergenic
927349295 2:22089689-22089711 GTCCAAAAGCTGAAGAACTTGGG - Intergenic
927796892 2:26057266-26057288 CTCCAAAAGCTAAGGAAGCTGGG + Intronic
931470769 2:62536016-62536038 ACCCAAAGGCTGATGGAGCTGGG + Intergenic
932110018 2:68990255-68990277 CACCAGAAGCTGAAGAAGCAAGG - Intergenic
932264727 2:70357869-70357891 CTCCAAATGCTGAAAGAAGTGGG + Intergenic
933445718 2:82377635-82377657 CTGCAGAAGCTGAAGTGGCTGGG - Intergenic
935470705 2:103456357-103456379 ATCCACAAGCTGAAGATGCTGGG - Intergenic
936151966 2:110026988-110027010 CTCCCAAGGCAGAAGGAGCCTGG + Intergenic
936192712 2:110344425-110344447 CTCCCAAGGCAGAAGGAGCCTGG - Intergenic
938136670 2:128764725-128764747 TACCAAAAGCAGAAGGAGATGGG - Intergenic
938272481 2:129986087-129986109 GTCCAAAAGCTGAAAGAACCTGG - Intergenic
938443754 2:131360023-131360045 GTCCAAAAGCTGAAAGAACTTGG + Intergenic
939913877 2:148016506-148016528 CTTCAAAAGTTGAACGAACTGGG + Intronic
941667735 2:168259137-168259159 ATCCAAAGGCTTAAGGAGATTGG + Intergenic
942923692 2:181407829-181407851 GTCCCAAAGCTGAAGAAACTGGG + Intergenic
943179177 2:184521443-184521465 CTCAAGAAGCTGAAAGAGCCAGG + Intergenic
943317595 2:186409706-186409728 GTCCCAAAGCTGAAGAAGTTGGG + Intergenic
946232714 2:218302508-218302530 CCCCTGAAGCTGAAAGAGCTTGG + Intronic
947347113 2:229203755-229203777 GGCCAAATGCTTAAGGAGCTGGG - Intronic
947353474 2:229270468-229270490 CTTAAATATCTGAAGGAGCTTGG + Intronic
947857401 2:233333443-233333465 CCCCAAAGGCTGGAGGAGCCTGG + Intronic
947872241 2:233445705-233445727 CTCCAAGATCTGGGGGAGCTGGG - Exonic
1168851440 20:979750-979772 CCCCAAATGCAGAAGGAGCTGGG - Intronic
1172649051 20:36490307-36490329 CTCCCAAGGCAGAAGCAGCTGGG - Intronic
1173433461 20:43011947-43011969 GTCCAAAAGCTGAAGAACTTGGG - Intronic
1174372295 20:50099665-50099687 CTAAAGAAGCTGAGGGAGCTTGG - Intronic
1175084305 20:56445803-56445825 CTCCAAAAGCAGAGACAGCTGGG - Intronic
1175183309 20:57163448-57163470 GGCCAAAACCTGAATGAGCTTGG + Intergenic
1176115128 20:63428863-63428885 CTGCCAAAGCTGGAGGAGTTGGG + Intronic
1176240880 20:64075306-64075328 CTCCAGAACCTGAAGGAGTGTGG - Intronic
1177505879 21:22016558-22016580 ATCCAAAGGCTTAGGGAGCTTGG - Intergenic
1177933956 21:27318964-27318986 ATCCAAAAGCTTAGGGAGATTGG - Intergenic
1179586352 21:42376214-42376236 CTCCGAAAGCTGCAGTGGCTGGG - Intronic
1180462609 22:15580056-15580078 GTCCAAAAGCTGAAAGAACTTGG + Intergenic
1180950700 22:19719228-19719250 CTCCATAAGCCGGAGAAGCTGGG - Intronic
1183220945 22:36512638-36512660 CTCCAAATGCCCAAGGTGCTGGG + Intronic
950291345 3:11786944-11786966 TTCCAAAAGCTGACTGGGCTTGG + Intergenic
950729507 3:14945375-14945397 CTTCAAAAGTTGAAGGAATTGGG - Intergenic
952179530 3:30902991-30903013 CATCAAAAGATGGAGGAGCTAGG - Intergenic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
953999335 3:47543460-47543482 CTCCACAGGCTGAAGGCTCTGGG + Intergenic
954538155 3:51376622-51376644 CTCCAATAGATGGAGCAGCTAGG - Intronic
955824519 3:62931334-62931356 ATCCTAAAGCAGAAGGAACTTGG - Intergenic
956835461 3:73092777-73092799 CTCCAAAAGCAGATGGAAGTTGG - Intergenic
957926428 3:86819197-86819219 CTTCACAAGGTGAAGGACCTTGG - Intergenic
958735027 3:97999224-97999246 CACGAAAAGCTAAATGAGCTTGG + Intronic
958814649 3:98901879-98901901 CTCCAAAGGCCGAAGGGGATTGG - Intergenic
958950527 3:100411016-100411038 CTCCTTAAGCTGAAGGGGCAAGG + Intronic
959135735 3:102417469-102417491 CTCCAAAGGCTGGTGGAGGTGGG + Intronic
962677340 3:137766698-137766720 AACCAAACGCTGAAGGAGCAGGG + Intergenic
963422531 3:145078324-145078346 CACCAGAAGCTGAAGGAACAAGG - Intergenic
964899637 3:161642705-161642727 CACAGAAAGCTGAAGAAGCTGGG - Intergenic
965312436 3:167147133-167147155 CTCAAAAAGAGGAATGAGCTTGG + Intergenic
966445415 3:179996517-179996539 ATCCAAAAGCTTAGGGAGATTGG + Intronic
966820644 3:183921694-183921716 CTCCCAAGGCTGAAGGAATTTGG - Intronic
968701987 4:2061674-2061696 CTTCTATAGCTGGAGGAGCTGGG + Intronic
969668579 4:8576380-8576402 CACCAATGGCTGATGGAGCTAGG - Intronic
970629085 4:17921924-17921946 GTCCAAAAGCTGAAGAACTTGGG - Intronic
970785759 4:19794160-19794182 GTCCAAAAGCTGAAGAACTTGGG - Intergenic
971051474 4:22867314-22867336 GTCCAAAAGCTGAAGAACTTGGG - Intergenic
971356978 4:25903889-25903911 GTCCAAAAGCTGAAGAACTTGGG + Intronic
971811298 4:31431774-31431796 CTTCAAAAGGTAAAAGAGCTTGG + Intergenic
971875711 4:32305875-32305897 CACCAAAAGCTAAAGGGGATAGG + Intergenic
972150525 4:36084005-36084027 GTACAAAAGCTGAAGGACTTGGG - Intronic
972726685 4:41751393-41751415 CCCCAAAAGCTAAAGGGGCCTGG - Intergenic
974754576 4:66187021-66187043 CTCCTACAGCTGCAGGAGGTAGG - Intergenic
976759514 4:88533132-88533154 GTCCAAAAGCTGAAGAATTTGGG + Intronic
977175820 4:93818194-93818216 CCCAAAATGCTGAAGGAGCTGGG - Intergenic
978236324 4:106465394-106465416 AACCATAAGTTGAAGGAGCTTGG + Intergenic
979076889 4:116282436-116282458 ATCCACAACCTGAATGAGCTTGG - Intergenic
980406158 4:132355846-132355868 ATCCAAAGGCTTAAGGAGATTGG - Intergenic
980483888 4:133427186-133427208 CCCCAAATGCTGAAGAAGCCAGG - Intergenic
981462525 4:145029752-145029774 ATCCAAAAGCTTAGGGAGATTGG + Intronic
982225217 4:153158864-153158886 CTCAAAAGGCTGCAGGAGCATGG + Intronic
987454064 5:18121171-18121193 CTCTATAAGCTGGAGGAGATTGG + Intergenic
988895961 5:35675313-35675335 CTCCAAAATAGAAAGGAGCTGGG + Intronic
989238576 5:39177462-39177484 CTCCCAAAGCTGACAGAGTTGGG + Intronic
989563590 5:42878020-42878042 CTCTAATAGCTGAATGATCTTGG + Intronic
990146498 5:52766778-52766800 GTCCAAAAGCTGAAGAACTTGGG + Intergenic
990369563 5:55103637-55103659 CTCCAAAAGCTGATGAATCCTGG - Intronic
991363134 5:65841792-65841814 CTCCAGAAGCCTAAGCAGCTGGG - Intronic
993335843 5:86657529-86657551 CTTCAAAAAATGAAGGTGCTCGG + Intergenic
994337082 5:98579807-98579829 CTCCAAAAGATGAGAGAGCTGGG - Intergenic
994681982 5:102899659-102899681 CACCAAAAAGTGCAGGAGCTGGG - Intronic
997811193 5:136972128-136972150 CTCAAAGAGCTAAAGGAGCCAGG - Intergenic
998669365 5:144336198-144336220 TTGCCAATGCTGAAGGAGCTGGG + Intronic
1000223508 5:159236326-159236348 ATCCAAAAGCTTAGGGAGATTGG - Intergenic
1002359615 5:178660246-178660268 CTCTAAAAAATGAAGGACCTCGG - Intergenic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003672267 6:8170492-8170514 CTCCAATGTCTGAAAGAGCTAGG + Intergenic
1004166670 6:13262748-13262770 CTCCAAAAGTAGGAGGAGATGGG - Intronic
1004655803 6:17659089-17659111 CTTCAAAAGTTGAAGGAATTGGG + Intronic
1005505553 6:26466299-26466321 CTCCAAAAGATAAAGGATCCTGG - Intronic
1007028730 6:38606075-38606097 GTCCAAAAGCTGAAGAACTTGGG - Intronic
1007094132 6:39203084-39203106 CCCCCAAAGCTGAAGCAGATGGG + Intronic
1008648672 6:53542307-53542329 CTCCAAAAGATCAAGGGGCTTGG - Intronic
1009409027 6:63344018-63344040 GTCAAAAATCTGAAAGAGCTTGG + Intergenic
1010778270 6:79911475-79911497 TTACAAAGGCTGAAGGAGGTGGG - Intergenic
1010794521 6:80103953-80103975 CTCAAAAACCTGAATGAGTTAGG - Intergenic
1011564369 6:88658828-88658850 GTCTAAAAGCTGAAGAATCTGGG - Intronic
1011683409 6:89804525-89804547 CTTCAAGAGTTAAAGGAGCTGGG - Intronic
1012391528 6:98746593-98746615 ATCCAAAGGCAGAGGGAGCTGGG - Intergenic
1012618121 6:101302929-101302951 CTCCAATATCTCAAGGAGGTGGG + Intergenic
1012769371 6:103409753-103409775 CACCAGAAGCTGAAAGAGGTAGG + Intergenic
1013919600 6:115387440-115387462 ATGCAAAAGCTGAAAGAGCCTGG + Intergenic
1015272756 6:131354159-131354181 ATCCAAGAGGTGAAAGAGCTGGG + Intergenic
1016875248 6:148858314-148858336 GTCCAAAAGCTGAAGAACTTGGG + Intronic
1017102113 6:150857991-150858013 CCCCAAATGCAGAAGGAGCCTGG - Intergenic
1018147396 6:160905320-160905342 CTCCAGAAGCTGAAAGAGTTTGG + Intergenic
1018477274 6:164156025-164156047 CTCCAAAAGCTGGAAGGGATGGG + Intergenic
1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG + Intergenic
1020117032 7:5481719-5481741 CTCGAGAAGCTGCAGGAGCCTGG - Exonic
1021111135 7:16696033-16696055 CTTCAAAAGCAGAAGGAGCCGGG - Intronic
1021370107 7:19834053-19834075 ATCAAAAAGCAGAAGGACCTAGG + Intergenic
1024743559 7:52381865-52381887 CTCCAAAATCTGATGGGGGTTGG + Intergenic
1028493631 7:91441061-91441083 CAGCTAAAGCTGAAGTAGCTGGG - Intergenic
1031236582 7:119185962-119185984 ATCCAAAGGCTTAAGGAGATTGG + Intergenic
1031255723 7:119445644-119445666 CTACAAAAGTTGAAGGAATTTGG + Intergenic
1031590165 7:123581121-123581143 CGCAAAGAGCTGAAGGAGGTTGG - Intronic
1031609375 7:123806998-123807020 CCCCAAAAGGTCCAGGAGCTGGG - Intergenic
1032410922 7:131692798-131692820 TTCCAAAAGCTAGAGCAGCTGGG - Intergenic
1032923687 7:136577844-136577866 ATCCAAAAGCTTAGGGAGATTGG - Intergenic
1033491109 7:141844885-141844907 CCCCAAAAGATAAAGGAGCCTGG + Intergenic
1034221362 7:149449051-149449073 CTGCAAAAGGAGAAGGCGCTTGG + Intronic
1034340838 7:150353918-150353940 CTCCTAAAACGGAAAGAGCTAGG - Intergenic
1034544662 7:151781923-151781945 TTTCAAATGCTGAAGCAGCTTGG - Intronic
1035796629 8:2363289-2363311 CTCAAAAAGCTGAATCACCTGGG - Intergenic
1036048762 8:5172728-5172750 CACCATAAGCTGAAGGAGACTGG + Intergenic
1036449847 8:8856201-8856223 CTCCAGCAGCCAAAGGAGCTGGG + Intronic
1036453578 8:8890689-8890711 CTCCACATACTGATGGAGCTGGG + Exonic
1037398953 8:18474026-18474048 CTCCAAAAGCTCACGCTGCTAGG + Intergenic
1037865605 8:22440582-22440604 CCACAAAAACTGAAGGAGCGCGG + Intergenic
1038299268 8:26327091-26327113 TTCCAAGGGCTGAAGGATCTTGG - Intronic
1043337536 8:79195104-79195126 TTGCAAAAGCTGCAGCAGCTTGG + Intergenic
1043992317 8:86770747-86770769 GTCCAAAAGCTGAAGAACTTGGG + Intergenic
1044618189 8:94163532-94163554 CCCTAAAACCTGAAGGAGCCAGG - Intronic
1046992014 8:120468596-120468618 CTTCAAAAGTTGAATGAACTGGG - Intronic
1047099805 8:121664519-121664541 TTCCAGAAGCTGGAGGACCTAGG - Intergenic
1049675827 8:143888599-143888621 AGCCAGAAGCTGAAGGAGCAGGG + Intergenic
1050814514 9:9792781-9792803 ATCCAAAATCTAAAGCAGCTGGG + Intronic
1051068320 9:13131822-13131844 CTCCAAAGACTGAGGGAGCTGGG - Intronic
1052282478 9:26748774-26748796 GTCCAAAAGCCAAAGGACCTGGG - Intergenic
1052718188 9:32144338-32144360 GTCCAAAAGCTGAAGAACTTGGG - Intergenic
1053858030 9:42357556-42357578 CTCCAACAGTTTAAGGAGCTGGG + Intergenic
1056079148 9:83072630-83072652 TTCCAAAAGCTGAAGAACTTGGG + Intergenic
1056095378 9:83248059-83248081 CTCCAAAAGGAGGAGGAGCAGGG + Exonic
1056261578 9:84854189-84854211 ATCCCAAAGCTGAGGAAGCTGGG - Intronic
1056475672 9:86948740-86948762 CTCCAGAAGCAGAGGGAGCCGGG + Intergenic
1056491885 9:87116615-87116637 CTCCAAGAGCTGGAGGAAATGGG - Intergenic
1058849093 9:108993242-108993264 CTCCACAAGCTGAACGGCCTTGG + Intronic
1059553789 9:115257719-115257741 TGCCAAAAGCTGAAGGAGGGTGG + Intronic
1062158617 9:135067621-135067643 CTCCAGAAGCTGCAGGAGGCAGG + Intergenic
1062471164 9:136705635-136705657 CTCCCAAAACTGAAGTAGATGGG + Intergenic
1185823930 X:3230906-3230928 GTCCAAAAGCTGAAGAACCTGGG + Intergenic
1185922040 X:4104109-4104131 CACCAGAAGCTGCAGGAGCAAGG + Intergenic
1186244174 X:7603203-7603225 GTCCAAAGGGTGAAGAAGCTGGG + Intergenic
1186898872 X:14032230-14032252 CTCCTAAGGGTGCAGGAGCTTGG + Intergenic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1189107597 X:38253732-38253754 CTGAAAAAGCTGAAGAAACTTGG - Intronic
1189596736 X:42574306-42574328 GTCCAAAAGCTGAAGAGCCTGGG - Intergenic
1191162035 X:57340148-57340170 GTCCAAAAGCTGAAGAACTTGGG + Intronic
1193461755 X:81798380-81798402 GTCCAAAAGCTGAAGAACTTGGG - Intergenic
1193904336 X:87224512-87224534 ATCCAAAAGCTTAGGGAGATTGG + Intergenic
1194032261 X:88831907-88831929 ATCCAAAGGCTTAAGGAGATTGG - Intergenic
1194520861 X:94917384-94917406 ATCCAAAAGCTTAGGGAGATTGG + Intergenic
1194931651 X:99895729-99895751 CTCTAAAAGCTGAGGGTCCTGGG + Intergenic
1196339360 X:114580069-114580091 CTCAAAAAGGAGAAAGAGCTAGG - Intergenic
1196631644 X:117947643-117947665 CTTCAAAAGCTGAAGAAGCCTGG + Intronic
1197591597 X:128417291-128417313 ATCCAAAGGCTGAGGGAGATTGG + Intergenic
1198332718 X:135636563-135636585 CTCCAAAGGCTTAAGGACATTGG + Intergenic
1198777437 X:140195251-140195273 CTCCAGAATCTGAAAGATCTAGG + Intergenic
1201400238 Y:13597058-13597080 ATCCAAAAGCTTAGGGAGATTGG - Intergenic