ID: 1096542350

View in Genome Browser
Species Human (GRCh38)
Location 12:52314818-52314840
Sequence GACCCTGCCCTTGTTCCCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096542350_1096542357 23 Left 1096542350 12:52314818-52314840 CCTGTGGGAACAAGGGCAGGGTC 0: 1
1: 0
2: 1
3: 18
4: 209
Right 1096542357 12:52314864-52314886 CCCATCCAGCCACCTTCCTTTGG 0: 1
1: 0
2: 0
3: 23
4: 291
1096542350_1096542351 -4 Left 1096542350 12:52314818-52314840 CCTGTGGGAACAAGGGCAGGGTC 0: 1
1: 0
2: 1
3: 18
4: 209
Right 1096542351 12:52314837-52314859 GGTCAAGAGACCCCTGCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096542350 Original CRISPR GACCCTGCCCTTGTTCCCAC AGG (reversed) Exonic
900363931 1:2302927-2302949 GACCCTGCCCTGGGAACCACAGG + Intronic
900621645 1:3590308-3590330 GACCCTGCCCATGTTTCAGCCGG - Intronic
900940092 1:5793111-5793133 GACCCTGCTCATGTTCTCCCAGG - Intergenic
901731853 1:11285738-11285760 GTCCCTGGCCATCTTCCCACTGG + Exonic
902046694 1:13530014-13530036 CAAGCTGCCCTTCTTCCCACAGG - Intergenic
903647382 1:24903477-24903499 GACTCTGCCCCTGCTCCCCCAGG + Intronic
904087835 1:27922446-27922468 GACCCTACCCTTTTTGCCAGAGG - Intergenic
904586584 1:31584196-31584218 GGCCCTGCCCTTATTCCCCTGGG + Intronic
904702770 1:32367913-32367935 GCCCTTGCCCTTGATCACACTGG + Intronic
905425703 1:37882575-37882597 GAACATGCTCTTGCTCCCACAGG + Intronic
905864602 1:41369874-41369896 GACTCTGGCCTTGTCCCCAGGGG - Intronic
906312338 1:44762733-44762755 GACCTGGGCCTTGTTCCCACAGG + Intronic
906710255 1:47924168-47924190 GTCCCTGTCCAGGTTCCCACAGG + Intronic
911116642 1:94252561-94252583 GACCCTGCCCATGCTACCAAGGG + Intronic
911117250 1:94258600-94258622 GACCCTTCCCTGATTACCACTGG - Intronic
911376997 1:97063098-97063120 CACCCTGCCCTTGCTTCCAGAGG + Intergenic
912664121 1:111563942-111563964 GACCCTTCCATTGGTCCAACTGG + Intronic
914973569 1:152334744-152334766 GACCCTGCTCTTGCCCCCAAAGG - Intergenic
916398369 1:164417152-164417174 AACACTTCCCTTGTTTCCACTGG - Intergenic
917649919 1:177066225-177066247 GAGCCAGGCCATGTTCCCACTGG + Intronic
918073337 1:181150106-181150128 GACCCTGCCCTGGTTCCCTGGGG + Intergenic
919805703 1:201379968-201379990 GGCCCTGCCCTCGTTCCTACTGG - Intronic
920071135 1:203304195-203304217 CATCCTGCTCCTGTTCCCACCGG - Intergenic
920097828 1:203498107-203498129 GACCCTGTCTCTGTACCCACGGG - Intronic
920686105 1:208110133-208110155 GACCCTGGCCTTATTCTCTCAGG + Intronic
921063976 1:211609744-211609766 GGAGCTGCCTTTGTTCCCACTGG - Intergenic
922472977 1:225888030-225888052 GACCCTGCTCTTGTCCCCAGAGG - Exonic
922480981 1:225940000-225940022 GACCCTGCTCTTGTCCCCAGAGG - Exonic
923048143 1:230370274-230370296 GACCTTTCCCTTGTTTCCATGGG - Intronic
923626853 1:235621047-235621069 GCCCCTGTCCTTGCTCCTACAGG + Intronic
924523780 1:244828730-244828752 GACACTGCACTTCCTCCCACAGG + Intergenic
1064004186 10:11687372-11687394 CACCCTTTCCTTCTTCCCACAGG + Intergenic
1064105109 10:12494092-12494114 GAGCCTGCCGTGGTTCCCAAAGG + Intronic
1064199803 10:13274698-13274720 CATCCTTCCCTTGTTCCCAAAGG + Intergenic
1067441623 10:46311956-46311978 GACCAGTCCCTGGTTCCCACAGG + Intronic
1068385635 10:56323368-56323390 GACACTCCCCTTTCTCCCACTGG + Intergenic
1072685862 10:97536583-97536605 CACCCTGCCCCTGGGCCCACTGG - Intronic
1074984303 10:118643457-118643479 GGCCCTGCCTCTGTCCCCACTGG - Intergenic
1075454603 10:122577003-122577025 GACCGTGGCATTGTACCCACAGG - Intronic
1076497432 10:130906108-130906130 GACCCTGCCACAGCTCCCACCGG + Intergenic
1076672711 10:132131856-132131878 CACCCTGCACTTCTTCCCATGGG - Intronic
1077162516 11:1120222-1120244 GACCCTGGGCCTGTTTCCACCGG + Intergenic
1077231806 11:1461139-1461161 GAGCCTGGCCTTCCTCCCACGGG - Exonic
1077322587 11:1948931-1948953 TTCACTGTCCTTGTTCCCACAGG - Intronic
1078398035 11:10999376-10999398 CACCCTGCCATTGTCTCCACAGG - Intergenic
1080270073 11:30441774-30441796 GCCTCAGCACTTGTTCCCACTGG - Intronic
1082197304 11:49321806-49321828 TATCCTGCCCTTGTTTACACTGG - Intergenic
1083380917 11:62267900-62267922 GGACCTGCCCTCTTTCCCACAGG - Intergenic
1083630578 11:64093086-64093108 GAGCCTGCCCAGGGTCCCACAGG - Intronic
1084357314 11:68648564-68648586 GACCCTGCCCCTGCCCCCAAGGG + Intergenic
1084381863 11:68817792-68817814 CACCCTGCCCTTGACCCCGCTGG - Intronic
1084890081 11:72232488-72232510 GACCCTAACCTTGTCCCCAGGGG + Intronic
1085274458 11:75289491-75289513 CACCCTGCCCCTGTCCCCGCCGG + Intronic
1086063082 11:82720427-82720449 GACCTTACCTTTGTTCCTACAGG - Intergenic
1089209660 11:116791624-116791646 CACCCTGCCTTTGTCCCCGCTGG + Exonic
1089684760 11:120139576-120139598 GTCTCTGCCCTTGTTCCCAGGGG - Intronic
1090354409 11:126130184-126130206 CATGCTGCCCTTGTCCCCACAGG - Intergenic
1091054808 11:132407933-132407955 GACCCTGTCCACCTTCCCACTGG - Intergenic
1091239612 11:134043720-134043742 GACCCAGCCCTCCTTCCCCCCGG - Intergenic
1202805604 11_KI270721v1_random:4244-4266 TTCACTGTCCTTGTTCCCACAGG - Intergenic
1092298015 12:7217626-7217648 GGCTCTGCCTTTGGTCCCACAGG + Intronic
1095668392 12:44830591-44830613 GTCCCTGTCCTTGTTTCCACAGG + Intronic
1096542350 12:52314818-52314840 GACCCTGCCCTTGTTCCCACAGG - Exonic
1098855162 12:75644404-75644426 GACCTTGCCCAGGTTACCACTGG - Intergenic
1100854723 12:98748831-98748853 GACCTTACCCTGGTCCCCACAGG - Intronic
1103331242 12:120155489-120155511 AGCCCAGCCCTTCTTCCCACTGG + Intronic
1105760984 13:23514265-23514287 GATCCTGGCCCTGTACCCACTGG + Intergenic
1106057735 13:26254338-26254360 GTCTCTGCCCTTGTCCCCGCGGG - Exonic
1109233695 13:59790087-59790109 GCCCCAGCCCTTGTTCCCATGGG + Intronic
1113739334 13:112700561-112700583 GACTCTGACCTTGTTCTCCCCGG + Intronic
1114463205 14:22901548-22901570 GCTCCTGCCCATGGTCCCACTGG - Exonic
1122051902 14:99066438-99066460 TGCCCAGCCATTGTTCCCACAGG - Intergenic
1122321951 14:100860709-100860731 CACCCTGCACCTATTCCCACGGG + Intergenic
1122481493 14:102050239-102050261 GCCTCTGCCCTTGTTACCGCAGG - Intronic
1122641035 14:103159563-103159585 GACCCAGCCCTTGTGCCCAAGGG - Intergenic
1123995371 15:25714294-25714316 GGCCCCACCCTGGTTCCCACAGG + Intronic
1126049521 15:44673544-44673566 GTTCCTGCCCTTGTTTCAACAGG + Intronic
1127796252 15:62440942-62440964 GAACCTGGCTTTGTTTCCACAGG - Intronic
1130144718 15:81265222-81265244 TCCCCTGCCCCTGTTCCTACTGG + Intronic
1137557222 16:49478306-49478328 ACCCCTGCCCCTGTCCCCACGGG + Intergenic
1138657384 16:58499261-58499283 CACCCGGCCCTCGTTCCCAGAGG - Intronic
1140477280 16:75245284-75245306 GCCCCTGCCCTGGTGACCACAGG + Intronic
1141095248 16:81158552-81158574 GCCCCTGCCCTGGTTCACTCCGG - Intergenic
1141661370 16:85443351-85443373 GAGCCTGGCCTGGCTCCCACTGG + Intergenic
1142167743 16:88601829-88601851 CACCCTGACCCTGTTCCCAGAGG - Intronic
1142236793 16:88926220-88926242 GAGCCTAACCTTGTTCCCAGAGG + Intronic
1143336858 17:6178073-6178095 GGAACTGCTCTTGTTCCCACAGG + Intergenic
1144684132 17:17215088-17215110 GCCCCTGCCCTTCTCCCCAGTGG - Exonic
1145846217 17:28041588-28041610 GACCCACACCTTGTTGCCACTGG + Intergenic
1146807347 17:35875558-35875580 GACCTTGCCCTTGTTCAGCCGGG + Exonic
1147460484 17:40565149-40565171 GGCCCCTCCCTTGTCCCCACTGG + Intronic
1147759398 17:42787831-42787853 GACCCTGCCCTTCAGCCCCCTGG + Exonic
1151746534 17:76014616-76014638 GCACCTGCCCCTGTCCCCACGGG - Intronic
1152219083 17:79051051-79051073 GACCCTGCCTCTTTTCCCATGGG - Intergenic
1152495375 17:80667375-80667397 GACTCTGCATTTGTTCCTACTGG + Intronic
1155067410 18:22279745-22279767 CTCCCTGCCCTTGTACGCACAGG - Intergenic
1156336444 18:36176849-36176871 GACGCAGCCCTTGTTACCCCAGG + Intronic
1156868300 18:41913835-41913857 GACACAGCGTTTGTTCCCACTGG - Intergenic
1157887168 18:51379909-51379931 GACCCAGTCAATGTTCCCACGGG - Intergenic
1160269329 18:77370036-77370058 GCCCCTGCCCTTTCTCCCAAGGG - Intergenic
1161234782 19:3192448-3192470 GACCCCGCCCCTGTGCCCACAGG + Exonic
1162234577 19:9297937-9297959 GGTCCTCCTCTTGTTCCCACTGG + Exonic
1162444276 19:10712764-10712786 GGCTCTGCCCTGGTGCCCACTGG + Exonic
1162524472 19:11199406-11199428 GAGTCTGCCCTGGTGCCCACTGG - Exonic
1163534179 19:17867483-17867505 GGCACTGCCTTTGTCCCCACTGG - Intergenic
1163595826 19:18220598-18220620 GACCCTGAAACTGTTCCCACGGG + Intronic
1163977865 19:20869492-20869514 GACAGTGACCATGTTCCCACTGG - Intergenic
1165090678 19:33386770-33386792 GACTCTGCCCTTGTCCCGCCAGG + Intergenic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1167270047 19:48501404-48501426 GACACCGCCCTGGTTCCCTCAGG - Exonic
1167508581 19:49883904-49883926 GTCCCTGGCCTTGCTCCCCCAGG - Intronic
929545272 2:42851426-42851448 AACCCTGCCCTAGTGCTCACCGG + Intergenic
932226289 2:70043659-70043681 TGCCCTGCCCTTGTTGCCACTGG + Intergenic
941772738 2:169362041-169362063 GACCCTGTCTTTGTTCCCACGGG - Intronic
943968735 2:194374776-194374798 GACCATGGCCTCTTTCCCACAGG - Intergenic
944251692 2:197585347-197585369 TGCCCTGCCCTTGTTTACACTGG + Intronic
944280193 2:197886667-197886689 GACACTGAGCTTGTTCCCCCAGG - Intronic
946093039 2:217247946-217247968 GTCCCTTCCCTTGTCCTCACAGG + Intergenic
948580773 2:238986128-238986150 GCTACTGCCTTTGTTCCCACTGG - Intergenic
948675796 2:239595887-239595909 GACCCAATCCTTGTACCCACGGG + Intergenic
948850434 2:240702886-240702908 CTCCCTGACCTTGTTCCCTCTGG + Intergenic
1172102859 20:32496033-32496055 GTCCCTGCCCTGCTTCCCTCTGG + Intronic
1173552647 20:43943556-43943578 GACACTGCCCCTGTCCTCACAGG - Intronic
1174303888 20:49601564-49601586 GAACGTGCCCATGTTCACACTGG + Intergenic
1175245732 20:57580908-57580930 GACCCAGCCCTTGCACTCACAGG - Intergenic
1175991751 20:62793368-62793390 ACCCCTGCCCAGGTTCCCACTGG + Intergenic
1176171915 20:63699928-63699950 GACCCAGGCCATGTTCCCAAAGG - Exonic
1177161623 21:17554196-17554218 GACCCTGAACCTGGTCCCACAGG - Intronic
1178365401 21:31985665-31985687 GACCTTTCCTCTGTTCCCACGGG - Intronic
1178440293 21:32593066-32593088 GGCCCTGTCCTTCTTCCCAGAGG + Intronic
1178892844 21:36534396-36534418 GACCTTGCTCTGGTTCCCACGGG - Intronic
1179530105 21:42012527-42012549 GCCCCTGCCCATGCTCGCACTGG + Intergenic
1179548627 21:42128676-42128698 GAGCCTGCCCCTGGTTCCACTGG + Intronic
1180168272 21:46041306-46041328 GCCCCAGCCCCTGGTCCCACTGG - Intergenic
1181051507 22:20240289-20240311 GACCCTGTGCCTGTGCCCACAGG - Intergenic
1182551640 22:31103994-31104016 AACCCTGCCCATGTTCTCCCTGG - Intronic
1183676048 22:39299454-39299476 GCCCCATCCCTTGGTCCCACTGG + Intergenic
949866743 3:8553301-8553323 GACCCTGCCATTGCTCCAATAGG - Intronic
950534591 3:13571666-13571688 GACCCTGTCCTGGTTCCTTCAGG + Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
950686360 3:14621390-14621412 GACCTTGCCCTGGACCCCACAGG + Intergenic
953352147 3:42223516-42223538 GCACCAGCCCTTGTTCCCAGAGG + Exonic
954581562 3:51706021-51706043 GACACTGCCCTTTCTTCCACAGG - Intergenic
956773539 3:72546985-72547007 GACACAGCCTTTGTTCCCTCTGG + Intergenic
960430627 3:117564282-117564304 GTCCTTGCCCTTTTTCCTACAGG + Intergenic
961414310 3:126746218-126746240 GCCTCTGCGCTTGTGCCCACAGG + Intronic
965431410 3:168593646-168593668 GACTCTTGCCTTTTTCCCACAGG - Intergenic
965596955 3:170419516-170419538 GACCCGGCCAGTGTTACCACCGG - Intronic
969676314 4:8616354-8616376 GTCCCTGCTCTTGGGCCCACGGG - Intronic
969725091 4:8914003-8914025 GACCATGCCCTTGTGCCTGCAGG + Intergenic
971300900 4:25441686-25441708 AAGCCTGCCCAGGTTCCCACAGG - Intergenic
973975027 4:56254612-56254634 GACCCTGGCCCACTTCCCACTGG + Intronic
974387579 4:61222627-61222649 GTCCCTGCCATTCTTCTCACTGG - Intronic
975040955 4:69743855-69743877 GGCCCCCACCTTGTTCCCACAGG - Intronic
976594162 4:86878788-86878810 GAGCTTGCCTTTGTTCCCAGTGG - Intronic
982126657 4:152189708-152189730 GTCCCTGCCCCTGTGCTCACTGG + Intergenic
982164618 4:152603522-152603544 CATCCTGCCCTTTTCCCCACTGG - Intergenic
982765769 4:159346836-159346858 GACCCTGCCCTTGGAGCTACTGG - Exonic
983904712 4:173170118-173170140 GACCCTGACCTGCTTCCCCCCGG + Intronic
984546709 4:181113221-181113243 CTCCCTTCCCTTGTTCCCACCGG - Intergenic
985818082 5:2141598-2141620 GGCCCTGCCCCTATTCCTACTGG - Intergenic
986155960 5:5176170-5176192 GACCCTCCCCTTGACACCACAGG + Intronic
986560930 5:9060397-9060419 GACCCTATCCTTGTTGCCATGGG - Intronic
986694677 5:10340980-10341002 TACCCTCCCCTGGTACCCACAGG - Intergenic
990632605 5:57686950-57686972 GACTCGGCCCTTGTTTTCACAGG - Intergenic
992220560 5:74567977-74567999 AACCCTGCACATGTACCCACTGG - Intergenic
999398125 5:151243717-151243739 GGCCCTGCCCCTGCCCCCACAGG - Intronic
999731917 5:154481615-154481637 GACCCTGCCCTGGTTCCTCCTGG + Intergenic
1001266667 5:170278922-170278944 GACCCTGGCAGTGGTCCCACAGG - Intronic
1001339759 5:170832385-170832407 GATCCTGCCCCTGCTCCCACTGG + Intergenic
1001445399 5:171778876-171778898 GCCCCTGCCCATGGTCCCAACGG + Intergenic
1002074057 5:176697688-176697710 CACTCTGCCCATGTTGCCACGGG - Intergenic
1002188487 5:177467072-177467094 GGGCCTACCCTTGTTCGCACCGG - Intronic
1002371329 5:178757364-178757386 GATCCTGCCCCTGCTCCCACTGG - Intergenic
1002439301 5:179256088-179256110 GACACGGTCCTTCTTCCCACAGG + Intronic
1003651053 6:7960766-7960788 GAGAATGCCCTTGTTCCCATGGG + Intronic
1004733300 6:18380190-18380212 GACCCTGTCCTGGATCCTACAGG - Intergenic
1006298098 6:33178973-33178995 GACACTTCCCTTGTTCTCCCAGG - Exonic
1008274157 6:49524106-49524128 GACTCTGACCTTGTTTCCAAAGG - Intronic
1010868603 6:81010671-81010693 GAATCTGCACTTCTTCCCACCGG - Intergenic
1013772191 6:113640431-113640453 TTCCCTTCTCTTGTTCCCACTGG - Intergenic
1015955098 6:138590459-138590481 GCCCCTGCCCCTCTTCCCTCTGG + Intronic
1018395317 6:163373872-163373894 GTTCCTGTCCTTCTTCCCACAGG + Intergenic
1018657666 6:166055026-166055048 GACCCTTCCCTGGTTTGCACAGG + Intergenic
1023897019 7:44442474-44442496 GGCCCTGCCCTGGGTCCCCCAGG - Intronic
1023967946 7:44972954-44972976 GACCCTGCCCTGTGTCCCAAGGG + Intronic
1024154323 7:46604807-46604829 GAGGCTCCCCTTGTTCCCAAGGG - Intergenic
1024395169 7:48858340-48858362 GAGCCTGACCATGTTCCCATTGG - Intergenic
1024400102 7:48914346-48914368 GAGCCTGACCGTGTTCCCATTGG + Intergenic
1024638999 7:51315428-51315450 CACCCTGCCCATGTGCCCATAGG - Intronic
1024669915 7:51585046-51585068 GACCCTGCACCTGTTCTCTCTGG - Intergenic
1024887367 7:54159904-54159926 GCCCCTCCTCTTGTTCCCATGGG - Intergenic
1026914577 7:74112141-74112163 GACCCTGCGCTCTTCCCCACGGG - Intronic
1029790360 7:102837157-102837179 AACAATGGCCTTGTTCCCACTGG + Intronic
1030837325 7:114305943-114305965 GACTCTCCCCTTGTGCCCAAGGG - Intronic
1032089802 7:128905778-128905800 CACCCTGTCCTTGTGCCCAGAGG + Intronic
1032092443 7:128917753-128917775 CACCCTGTCCTTGTGCCCAGAGG - Intergenic
1032423313 7:131800712-131800734 GACCCTGCTGCTGTGCCCACAGG + Intergenic
1032576776 7:133062854-133062876 GTCCCTGCCCTTGTTACTGCAGG - Intronic
1034466602 7:151233430-151233452 GCCCCTTCCCTTGTGCCCACCGG + Exonic
1035446164 7:158944688-158944710 GTCCCTGCCCTTGTCACTACAGG - Intronic
1039458877 8:37727079-37727101 GACCCAGCCCTAGATCCCAGAGG + Intergenic
1039839692 8:41284908-41284930 CACTCTGCCCTTCTTCCCTCAGG + Intronic
1041231608 8:55757981-55758003 GCCCCTGCCCTCATTCCCCCTGG - Intronic
1041794177 8:61728979-61729001 GACCCTGCCCAAGGTCCTACTGG + Intergenic
1042886266 8:73555259-73555281 GTCCCTGCCCTTGCTCCTGCTGG - Intronic
1043505232 8:80895920-80895942 GACCCAGCCCTTTTTCCTTCAGG + Intergenic
1045343929 8:101277700-101277722 GACACTGCCCTAGTCTCCACTGG - Intergenic
1048455941 8:134578588-134578610 GACCTGGCCTTTGTTTCCACAGG + Intronic
1049646728 8:143738946-143738968 AACCCTGCCCTAGCTCCCACCGG - Intergenic
1049867432 8:144947903-144947925 TACCCTGCCCGGGTGCCCACTGG + Intronic
1051110958 9:13635711-13635733 GATCCTTGCCTTGTTCCCAAAGG - Intergenic
1051620905 9:19048998-19049020 TGCCCTGCCCTTGTACTCACTGG + Intronic
1052283469 9:26758362-26758384 TCCCTTGCCCTTCTTCCCACTGG - Intergenic
1057268130 9:93632130-93632152 GACCCTGCCCCTGTCCCTGCAGG + Intronic
1057527074 9:95812246-95812268 GACCCTGTCCTCCTTCCCTCTGG + Intergenic
1057550549 9:96048740-96048762 GAAGCTGCCCGTGTTCCCGCAGG + Intergenic
1058893594 9:109381702-109381724 GAACCTGCCCATTTACCCACTGG - Exonic
1060819439 9:126652774-126652796 ACCCATCCCCTTGTTCCCACAGG - Intronic
1061019096 9:128002425-128002447 GACCCTGCCCTGGTCTCCAGGGG - Intergenic
1061540469 9:131275618-131275640 TACCCTGCCACTGTTCCCCCCGG - Intronic
1061901300 9:133673472-133673494 GCCTCTGCCCTCCTTCCCACAGG - Intronic
1062045748 9:134423738-134423760 AACCCTGCCCTTGTTTGCAGGGG + Intronic
1062378561 9:136275947-136275969 GACCCAGCTCTGGTTCCCGCTGG + Intergenic
1062701317 9:137905898-137905920 GGACCTGCCCTTGTGCCCTCTGG + Intronic
1191646401 X:63486219-63486241 AAACCTGCACATGTTCCCACTGG + Intergenic
1192342923 X:70278816-70278838 AAGCCTGCCGTTGGTCCCACAGG - Intronic
1199175498 X:144783642-144783664 CACGCAGCCCTGGTTCCCACTGG - Intergenic
1199941518 X:152632384-152632406 ATCCCTGCCCCTGTTCCCAAGGG - Intergenic