ID: 1096543674

View in Genome Browser
Species Human (GRCh38)
Location 12:52322674-52322696
Sequence ACTTTGGGCCCTTGTTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096543670_1096543674 -4 Left 1096543670 12:52322655-52322677 CCTAAAGCCAAGCTCTCTTACTT 0: 1
1: 0
2: 1
3: 20
4: 219
Right 1096543674 12:52322674-52322696 ACTTTGGGCCCTTGTTCCTTTGG 0: 1
1: 0
2: 0
3: 16
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096543674 Original CRISPR ACTTTGGGCCCTTGTTCCTT TGG Intergenic
903267908 1:22169325-22169347 CCTGTGGGTCCTTGGTCCTTGGG - Intergenic
904415376 1:30358301-30358323 ATGTTGGTCCCTTGTCCCTTTGG - Intergenic
904624205 1:31793053-31793075 CCTTTGGGCCCTTCTTGCTATGG + Intronic
906507028 1:46387904-46387926 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
906583643 1:46956756-46956778 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
907457751 1:54586280-54586302 TCTTTGGGTCCTTGGTCATTGGG + Intronic
907505373 1:54914354-54914376 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
907701257 1:56790292-56790314 ACTTTGGGCCCGAGTTTCTGGGG - Intronic
908405669 1:63811877-63811899 ACTTTGGGCTCTATGTCCTTAGG + Intronic
908732687 1:67242628-67242650 ACTTTGGGACCTTGAACTTTTGG - Intronic
910591262 1:88929748-88929770 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
911654861 1:100432135-100432157 ACTTTGGGCCCTGCCTCCTGAGG + Intronic
912463708 1:109854776-109854798 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
913468799 1:119170423-119170445 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
918684355 1:187396842-187396864 ACTCAGGGCCCTTGTGCCATGGG - Intergenic
921092521 1:211857255-211857277 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
922684470 1:227628586-227628608 ACTGAGGGCCCTGGTGCCTTTGG + Intronic
922759066 1:228114010-228114032 ACTTTGGAACCTTGAACCTTGGG - Intergenic
1063322790 10:5067443-5067465 ACTTTGGGACCTTGAACTTTGGG - Intronic
1068791605 10:61036291-61036313 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
1070688280 10:78506283-78506305 TCTTTGGGGCCTGGTTTCTTAGG - Intergenic
1071198670 10:83192079-83192101 GCTTTGGGCCCTTGTTTCAGAGG + Intergenic
1072377879 10:94836686-94836708 ACTGAGGGCCCTGGTGCCTTTGG + Intronic
1074750158 10:116578164-116578186 TCTTTGGGCCTTTGGTACTTTGG - Intergenic
1075770990 10:124935578-124935600 ACTGTGGGCCCTAGTGCCTGTGG + Intergenic
1076172025 10:128327234-128327256 GGTTTGGGCCCTGGTGCCTTTGG + Intergenic
1079080350 11:17409532-17409554 TCTTTGGGCCTTTTTTCTTTGGG + Intronic
1079601094 11:22314251-22314273 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
1081621926 11:44623913-44623935 ACTTTGGGCCTTGGTGCCTCCGG + Intergenic
1084000641 11:66293645-66293667 CCTCTGGTCCCTTGTTCCATAGG - Intronic
1085439355 11:76544237-76544259 ACTTTGTGCCTTTTTTACTTAGG + Exonic
1085601554 11:77860409-77860431 ACTGAGGGCCCTGGTGCCTTAGG + Intronic
1086441771 11:86835698-86835720 ACTGAGGGCCCTGGTGCCTTTGG + Intronic
1086725781 11:90182004-90182026 ACCTTTGGCCCTTGTCTCTTTGG - Intronic
1087226955 11:95611880-95611902 ACTTTGGAGCCTTGAACCTTGGG - Intergenic
1087900205 11:103631910-103631932 ACTTTGGGCCCATGTTCTCAGGG + Intergenic
1088368533 11:109064019-109064041 ACTTAGCACCCTTTTTCCTTAGG + Intergenic
1089813135 11:121147975-121147997 AGTGGGGGCCCTTATTCCTTGGG - Intronic
1090187898 11:124750336-124750358 AATAGGGGCCCTTGTTCCTTTGG + Intronic
1090292833 11:125560846-125560868 ACTTTGGGACCTTGAACTTTGGG + Intergenic
1090401695 11:126453325-126453347 ACTTTGGGCTCCTGGTCCCTAGG + Intronic
1091302854 11:134518681-134518703 ACTTTGGGCTGTAGGTCCTTGGG - Intergenic
1091765897 12:3119770-3119792 ACTTTGGGCTTTTGCTCCTGTGG + Intronic
1092294282 12:7185799-7185821 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
1094239635 12:28207348-28207370 ACTTTGGAACCTTGAACCTTGGG - Intronic
1094806674 12:34100829-34100851 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
1095125525 12:38472294-38472316 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
1095493437 12:42759954-42759976 ATTTTGGTCCCTGGTTCCTGAGG - Intergenic
1095742371 12:45621321-45621343 ACTTTGAGACATTCTTCCTTGGG - Intergenic
1095875732 12:47078887-47078909 ACTGTGGGCCCTGGTGCCTCTGG - Exonic
1096543674 12:52322674-52322696 ACTTTGGGCCCTTGTTCCTTTGG + Intergenic
1097035741 12:56122313-56122335 AATTTGGGTCCTAGTTGCTTGGG + Exonic
1097377042 12:58854427-58854449 ACTGGGGGCCCTGGTGCCTTTGG + Intergenic
1101084223 12:101218908-101218930 ACTTTTGTGCCCTGTTCCTTTGG + Intergenic
1101707899 12:107237641-107237663 ACCTTGGGCCCTTGGTGCTCAGG + Intergenic
1103191921 12:119008859-119008881 GCCTGGGGCCCTTGTTCCTAGGG + Intronic
1103194853 12:119034775-119034797 ACTTTCGTCCCTGGTTCTTTTGG + Intronic
1103732508 12:123037176-123037198 ACTTGGGTCCCTTGCTACTTCGG - Intronic
1103803324 12:123553750-123553772 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
1104244645 12:127026394-127026416 ATTTTGTGCCCTTGTTTCTTAGG - Intergenic
1107229341 13:38088787-38088809 ACTTTGGGACCTTGAACCTAAGG - Intergenic
1107255519 13:38421553-38421575 ACGTTGGGACCTTGGGCCTTGGG - Intergenic
1108876890 13:55058927-55058949 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
1109174755 13:59141700-59141722 CCTGTGAGCCCTTGTTCCTTGGG + Intergenic
1109620328 13:64896105-64896127 ACTAGGGGCCCTTGGACCTTCGG + Intergenic
1111566773 13:90027477-90027499 CATTTGGCTCCTTGTTCCTTAGG - Intergenic
1112440304 13:99420205-99420227 ACTTTGGGCCAGTGTTCCTGAGG + Intergenic
1113382633 13:109817720-109817742 AATTTGGCTGCTTGTTCCTTTGG - Intergenic
1114694642 14:24615010-24615032 ACTTTGGCCCACTGTGCCTTGGG - Intergenic
1115069248 14:29301441-29301463 ACATTGGGTCCTTGGTCATTTGG - Intergenic
1115543713 14:34446180-34446202 ACTTTGGGACCTTGGGCTTTGGG + Intronic
1119599583 14:75966418-75966440 TCGTTGTGTCCTTGTTCCTTAGG - Intronic
1120649737 14:87117957-87117979 ACTTTGGGACCTTAAACCTTGGG + Intergenic
1123009044 14:105338452-105338474 ACTTTCCCACCTTGTTCCTTGGG + Intronic
1126544380 15:49856763-49856785 TCTTTGAGCCTTTGTTCCCTTGG - Intergenic
1127074076 15:55309289-55309311 ACTGAGGGCCCTGGTGCCTTTGG + Intronic
1127626978 15:60789223-60789245 ACTGTGGGGCTGTGTTCCTTGGG - Intronic
1128362399 15:66971636-66971658 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
1130404187 15:83583431-83583453 CCTTTGAGCCATTCTTCCTTTGG + Intronic
1131420392 15:92300055-92300077 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
1132172900 15:99681064-99681086 ACTTTGGGGACTTTTTACTTTGG + Intronic
1132490408 16:226125-226147 ACCTTGTGCCTCTGTTCCTTGGG - Intronic
1133109851 16:3541558-3541580 CCTTTGGCCCCTAGTCCCTTGGG + Intronic
1134298067 16:12964290-12964312 AATTTGGGACCTTTTTCATTTGG - Intronic
1135323639 16:21512665-21512687 ACTTCTGACCCTTTTTCCTTGGG - Intergenic
1139288438 16:65835819-65835841 ACTCTGGGTCCTCCTTCCTTGGG + Intergenic
1143289080 17:5815478-5815500 TCTTTGGCACCTTGGTCCTTGGG + Intronic
1143857225 17:9860936-9860958 CCTCTGGGCCCTGGTTTCTTGGG + Intronic
1145783631 17:27580141-27580163 ACTTTGGGGCTTGTTTCCTTTGG + Intronic
1146518290 17:33506695-33506717 ACTTTGCACCCATGTGCCTTTGG + Intronic
1150063082 17:62085540-62085562 ACTTTGGGCCATCTCTCCTTGGG - Intergenic
1150536629 17:66049248-66049270 ACTGTGAGCCCATGTCCCTTGGG - Intronic
1151323222 17:73363965-73363987 ACTGAGGGCCATTGTTCCCTAGG + Intronic
1152171027 17:78748748-78748770 GCTTTTGTCCCTTGTTGCTTTGG + Intronic
1154092811 18:11380917-11380939 CCTTTGGCTCCTTGTACCTTAGG - Intergenic
1157885976 18:51366968-51366990 CCTTTGGGCCCTGTTTCCTTCGG + Intergenic
1161295990 19:3520388-3520410 CCTTTGGGCCCATGTGCTTTGGG + Intronic
1163358784 19:16832151-16832173 GCTTTGGTCCCTTTTTTCTTGGG + Intronic
1167121918 19:47522252-47522274 CCTTTGTGCCCATCTTCCTTAGG - Intronic
926864688 2:17344113-17344135 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
927432266 2:23036748-23036770 ACTGGGGGCCCTTGGACCTTGGG + Intergenic
927519672 2:23691178-23691200 ACTTGGGGCCCTCGGTCCTGGGG + Intronic
928703276 2:33920560-33920582 TCTTTGTGTCTTTGTTCCTTTGG - Intergenic
929582094 2:43087904-43087926 ACTTTAGTCCCCTATTCCTTGGG + Intergenic
930144876 2:47991768-47991790 ACTTTGAGCCCTTCTTAGTTTGG + Intergenic
933175037 2:79165287-79165309 ACTGAGGGCCCTGGTACCTTTGG + Intergenic
933219795 2:79675867-79675889 ATTTTAAGCCCTTATTCCTTTGG + Intronic
935220024 2:101004271-101004293 ACTTTAGCACCTTATTCCTTTGG - Exonic
935317708 2:101853079-101853101 ACTTGGGGCCTTATTTCCTTTGG - Intronic
935702502 2:105824714-105824736 ACTTCCGGCCTTGGTTCCTTTGG + Intronic
939493439 2:142902583-142902605 ACTGAGGGCCCTGGTGCCTTTGG + Intronic
942763526 2:179427814-179427836 CCTTTGGGCCCTTCCTCTTTGGG + Intergenic
942831097 2:180238121-180238143 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
943883716 2:193183386-193183408 ACTCTGGGCCACTCTTCCTTTGG - Intergenic
944411556 2:199448311-199448333 ACTTTATGCCTTTGGTCCTTTGG + Intronic
946296905 2:218791674-218791696 ACTTTGAGACCTTGAACCTTGGG - Intronic
946710457 2:222499877-222499899 TCTTTGGGCCCTTCTGCCTGGGG - Intronic
948466172 2:238152706-238152728 GCTCTGGGCTCTTGTTCCTTTGG - Exonic
948722335 2:239908902-239908924 ACTCTGGGCACTTGGTGCTTGGG - Intronic
1168741178 20:192826-192848 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172235218 20:33368204-33368226 ACTTTGGGACCTAATTCCTAAGG - Intronic
1174977332 20:55350078-55350100 ACTGAGGGCCCTGGTCCCTTTGG - Intergenic
1175640105 20:60621930-60621952 ACTTTGGGTCCTTGCTTCTTGGG + Intergenic
1176367246 21:6040524-6040546 AGGTTGGGCCCTTCTTCCTCTGG + Intergenic
1176711268 21:10151981-10152003 TCTTTCAGCCCATGTTCCTTGGG + Intergenic
1177263296 21:18755316-18755338 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
1177534016 21:22401222-22401244 ACTTTGGGACCTTGAACTTTGGG + Intergenic
1177896476 21:26859914-26859936 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
1179634269 21:42697220-42697242 ACTTTGGGCCCTTTGTCTGTAGG - Intronic
1179756273 21:43498022-43498044 AGGTTGGGCCCTTCTTCCTCTGG - Intergenic
1180131182 21:45828289-45828311 ACTTTGGGGCCATCTTCCTTGGG - Intronic
1181470248 22:23134351-23134373 ACCTTGGCCCCTTGTTCTTCTGG + Intronic
1182369169 22:29798973-29798995 ACACTGTGCCCTTGTTCCTGGGG - Intronic
1185317110 22:50184043-50184065 ACTTTGGGCCCTAGGGCCTCTGG - Intergenic
949871999 3:8596873-8596895 ATTTTGGCCCCTTGTCCCTGAGG + Intergenic
951838134 3:27004443-27004465 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
951841608 3:27039936-27039958 ACTTTGGGACCTTGAACTTTGGG - Intergenic
951847186 3:27097117-27097139 ACTTTGGGCCCATCTTAATTAGG - Intergenic
952195869 3:31074960-31074982 AGTTTGGGCTCTTGTACCCTTGG + Intergenic
956020271 3:64926448-64926470 ACAATGGGCCCTTGTCCCTCAGG + Intergenic
956948793 3:74256132-74256154 ATTTGGGGCACTTGTTCCTGAGG + Intergenic
958903053 3:99910844-99910866 AGTTTGGGCCCAAGTTTCTTGGG - Intronic
960277682 3:115745924-115745946 ACTGAGGGCCCTGGTTCCTTTGG - Intergenic
960539454 3:118847585-118847607 ACTAAGGGCCCTGGTGCCTTTGG - Intergenic
960898968 3:122534942-122534964 ACCTTGGGACCATATTCCTTGGG + Intronic
963027571 3:140934465-140934487 ATTTTGTTCCCTTGATCCTTTGG - Intergenic
963188179 3:142441138-142441160 ACTGAGGGCCCTGGTGCCTTTGG - Intronic
963809263 3:149758595-149758617 ACTGAGGGCCCTGGTACCTTTGG + Intergenic
963915989 3:150859191-150859213 ACTGAGGGCCCTGGTACCTTTGG - Intergenic
964583765 3:158272049-158272071 CCTTTAGGCCCTTAATCCTTTGG - Intronic
964953647 3:162326216-162326238 ACTGAGGGCCCTGGTCCCTTTGG - Intergenic
966287330 3:178312918-178312940 GCTTTTGGCCCCTGTGCCTTGGG + Intergenic
966353728 3:179057697-179057719 ACTGAGGGCCCTGGTGCCTTTGG - Intronic
967623774 3:191663438-191663460 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
968768131 4:2485455-2485477 ACCTTGGGCCCTTTCTCCCTGGG + Intronic
969903187 4:10368794-10368816 CCTTTAGGATCTTGTTCCTTTGG + Intergenic
971839040 4:31808817-31808839 GCATAGGGCCCTAGTTCCTTAGG + Intergenic
972179286 4:36443813-36443835 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
972781140 4:42287938-42287960 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
973813920 4:54600682-54600704 ACTTTGGAGCCTTGAACCTTGGG - Intergenic
975313589 4:72928670-72928692 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
975696792 4:77021646-77021668 ACTGAGGGCCATAGTTCCTTGGG + Intronic
975819610 4:78256434-78256456 ATTTTGGGGCCTAGTCCCTTGGG + Intronic
977838784 4:101676226-101676248 ACTTTGGGACCTTGAACCTTGGG + Intronic
978586576 4:110281329-110281351 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
978909784 4:114049673-114049695 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
979123280 4:116930461-116930483 ATTTTGGATCCTTGTTCCTATGG - Intergenic
980444434 4:132886991-132887013 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
981201255 4:141982350-141982372 ACTTTGGAGCCTTGAACCTTGGG + Intergenic
984723960 4:183002254-183002276 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
987818127 5:22930394-22930416 GCTAAGGGCCCTGGTTCCTTTGG - Intergenic
988378051 5:30464346-30464368 GCTTTGAGCCCTTCCTCCTTGGG - Intergenic
990617518 5:57522585-57522607 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
990892507 5:60663879-60663901 ACTGAGGGCCCTGGTGCCTTTGG - Intronic
990945495 5:61245143-61245165 ACTTTTGTCCATTTTTCCTTGGG + Intergenic
990972389 5:61523032-61523054 AATTTGGGACCTTGTTTCTAAGG + Intronic
992858791 5:80891254-80891276 CCTCTGGCCCCTTGTCCCTTGGG + Intergenic
993585538 5:89722840-89722862 TCTTTGTGCCCTTGTGCCTCAGG - Intergenic
995000763 5:107125553-107125575 ACTTTGGGTCCTTTTTTGTTGGG + Intergenic
998285951 5:140861138-140861160 CCTTTTGGTCCTTGTTCCTGAGG - Intronic
999460042 5:151749764-151749786 ACTGTGGGCCCTTCTTTCTCGGG - Intronic
1000698470 5:164418842-164418864 ACTTTGGGACCTTGAACTTTGGG - Intergenic
1001706427 5:173744329-173744351 CCTCAGGGCCCTGGTTCCTTGGG - Intergenic
1004765880 6:18726300-18726322 ACTTTGGGACCTTGAACTTTGGG + Intergenic
1004987822 6:21102601-21102623 TCTTTCGGCCCTTTTGCCTTAGG + Intronic
1005089941 6:22045987-22046009 TCTTTGGGCCCTAGTGCCTTTGG - Intergenic
1005323443 6:24677872-24677894 ACTGAGGGCCCTTGTGCCTTTGG + Intronic
1006464341 6:34182780-34182802 ATATTCGGCCCTTGTTGCTTGGG - Intergenic
1008582101 6:52916803-52916825 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
1009545008 6:65009823-65009845 ACTGAGGGCCCTGGTGCCTTTGG - Intronic
1010893681 6:81342046-81342068 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
1011341817 6:86324357-86324379 ACTTTAGGGCCTTGACCCTTAGG + Intergenic
1011357242 6:86484539-86484561 ACTTTGGGACCTTGAACCTTGGG + Intergenic
1013022463 6:106233201-106233223 ACTGAGGGCCCTGGTGCCTTTGG - Intronic
1013445883 6:110226314-110226336 ACTTTGGCCCCTTCCTTCTTGGG + Intronic
1013543775 6:111135930-111135952 ACTGAGGGCCCTGGTGCCTTTGG - Intronic
1014220588 6:118795173-118795195 ACTTTGGTGCCTTGTTCTTCAGG - Intergenic
1014930014 6:127324739-127324761 ACTTTGGGTCTTTGGTCTTTGGG + Intronic
1015865265 6:137721071-137721093 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
1016255751 6:142103091-142103113 ACTTTGGCACCTTGAACCTTGGG - Intergenic
1016343026 6:143083095-143083117 ACTGAGGGCCCTGGTGCCTTTGG + Intronic
1016444488 6:144118456-144118478 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
1016461167 6:144281483-144281505 ACTTTGAGCCCCTGTGCCCTGGG - Intergenic
1016805020 6:148203914-148203936 ACCTGTGGCCCTTGTACCTTGGG + Intergenic
1017986596 6:159448127-159448149 TCTTTGAGCCCTTGGTCCTTTGG + Intergenic
1017986799 6:159450846-159450868 ACTTGGGACCCTTGTGCCTGAGG + Intergenic
1018761268 6:166896128-166896150 ACTGAGGGCCCTGGTGCCTTTGG - Intronic
1019441596 7:1050222-1050244 ACTTTGGGCCACTGTGCCTGAGG - Intronic
1019713188 7:2526675-2526697 AGTTTGGGACCTTATTCCTGGGG + Intronic
1024438841 7:49391142-49391164 ACTTTGGGTCCTAGTGCTTTGGG + Intergenic
1024997395 7:55282912-55282934 ACTTTGGGTCCTTGAAACTTGGG - Intergenic
1026896936 7:74014749-74014771 ACTTTGGGCACTTTGACCTTGGG - Intergenic
1028588353 7:92472775-92472797 ACTGAGGGCCCTGGTGCCTTTGG + Intronic
1028734707 7:94194904-94194926 ACTTTGTGCACTTGTACCCTAGG + Intergenic
1029900302 7:104032216-104032238 ACTTTGGCACCTTGGACCTTGGG - Intergenic
1030337519 7:108342323-108342345 ACTGAGGGCCCTGGTGCCTTTGG - Intronic
1031264779 7:119568690-119568712 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
1031305343 7:120119209-120119231 ACTTTGGAGCCTTGAACCTTAGG + Intergenic
1032427752 7:131835101-131835123 ACTTTTGGCTCTTGGTCTTTAGG + Intergenic
1034055108 7:148026057-148026079 AGGTTGGACCCTTGTCCCTTAGG + Intronic
1037189534 8:16106101-16106123 CCCTTGGGCCCTGGTTCCATGGG - Intergenic
1038941398 8:32309764-32309786 ACTTTGTGTCCTTGTTCCCATGG + Intronic
1040527522 8:48238068-48238090 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
1040803002 8:51364287-51364309 ACTTTGAGACCTTGAACCTTGGG + Intronic
1041663643 8:60422423-60422445 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
1043490192 8:80741035-80741057 ACTGAGGGCCCTAGTGCCTTTGG - Intronic
1046202631 8:110947329-110947351 ACTTTGGGACCTTGAACTTTGGG - Intergenic
1047394405 8:124481888-124481910 ACTTTGGAGACTTGTTACTTAGG + Intronic
1048430433 8:134365411-134365433 ACTTTGGGCCCTTAAGCCTGTGG + Intergenic
1049496265 8:142935257-142935279 ACCTTGGGCTCTGGTTCCATGGG - Intergenic
1053103315 9:35389861-35389883 ATGCTGGGCCCTTGTTCCTCTGG - Exonic
1055755935 9:79557295-79557317 TCTTGGGGCCAATGTTCCTTGGG - Intergenic
1056381421 9:86060496-86060518 ACTTTGTGCCCTTGTCCCTATGG - Intronic
1056568141 9:87792899-87792921 ACTATGGGCCCTGCTTCCTCAGG - Intergenic
1057058296 9:91980856-91980878 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
1057958966 9:99436644-99436666 ACATTGGGCACTTCCTCCTTAGG - Intergenic
1186747008 X:12580251-12580273 ACTCTGGCCCCTTGTTCTTCAGG - Intronic
1195535176 X:106001975-106001997 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
1195630969 X:107054697-107054719 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
1196527126 X:116740087-116740109 ACTGAGGGCCCTGGTGCCTTTGG + Intergenic
1196725789 X:118893894-118893916 AATGTGGCCACTTGTTCCTTGGG - Intergenic
1198498469 X:137218289-137218311 ACTTTGGAGCCTTGAACCTTGGG + Intergenic
1198518533 X:137430418-137430440 ACTTAGTGCTGTTGTTCCTTTGG - Intergenic
1198765758 X:140077897-140077919 ACTGAGGGCCCTGGTGCCTTTGG - Intergenic
1199233568 X:145466921-145466943 ACTTTGGGACCTTGAACCTTGGG - Intergenic