ID: 1096543704

View in Genome Browser
Species Human (GRCh38)
Location 12:52322823-52322845
Sequence GATGAGGAGGACTCCACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096543694_1096543704 27 Left 1096543694 12:52322773-52322795 CCCATCAACCCTTCCAAACACAC 0: 1
1: 0
2: 0
3: 20
4: 363
Right 1096543704 12:52322823-52322845 GATGAGGAGGACTCCACTGATGG 0: 1
1: 0
2: 1
3: 12
4: 149
1096543698_1096543704 18 Left 1096543698 12:52322782-52322804 CCTTCCAAACACACATCTCTGGA 0: 1
1: 0
2: 1
3: 20
4: 265
Right 1096543704 12:52322823-52322845 GATGAGGAGGACTCCACTGATGG 0: 1
1: 0
2: 1
3: 12
4: 149
1096543696_1096543704 19 Left 1096543696 12:52322781-52322803 CCCTTCCAAACACACATCTCTGG 0: 1
1: 0
2: 2
3: 30
4: 264
Right 1096543704 12:52322823-52322845 GATGAGGAGGACTCCACTGATGG 0: 1
1: 0
2: 1
3: 12
4: 149
1096543699_1096543704 14 Left 1096543699 12:52322786-52322808 CCAAACACACATCTCTGGACTGC 0: 1
1: 0
2: 1
3: 16
4: 189
Right 1096543704 12:52322823-52322845 GATGAGGAGGACTCCACTGATGG 0: 1
1: 0
2: 1
3: 12
4: 149
1096543695_1096543704 26 Left 1096543695 12:52322774-52322796 CCATCAACCCTTCCAAACACACA 0: 1
1: 0
2: 1
3: 57
4: 568
Right 1096543704 12:52322823-52322845 GATGAGGAGGACTCCACTGATGG 0: 1
1: 0
2: 1
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096543704 Original CRISPR GATGAGGAGGACTCCACTGA TGG Intergenic
903814358 1:26053904-26053926 GAAGAGGAAGAGTCCACAGAAGG - Exonic
903996081 1:27306336-27306358 GATGATGAGGACAGCTCTGAGGG + Exonic
907781572 1:57571859-57571881 GCTGAAGAGGGCTCCAGTGAAGG - Intronic
910113734 1:83709853-83709875 GATGAGAAACAGTCCACTGATGG + Intergenic
912105273 1:106265227-106265249 GATGAGGAAGACTGCACAGCTGG + Intergenic
914242478 1:145860964-145860986 TATGAGGAGGATTATACTGAAGG - Intergenic
922743722 1:228031204-228031226 GATGAGGAGGACGTCCCTGAAGG + Intronic
924189231 1:241532043-241532065 GATGAGAAGGGCTCCATTCATGG + Intergenic
924275003 1:242377052-242377074 CACGAGGATGACTCCCCTGATGG - Intronic
1062906959 10:1185868-1185890 GATGAGGAGGTCTCCACTCTGGG + Intronic
1063789312 10:9423912-9423934 GATCTGGAGGACTACAATGATGG + Intergenic
1067020903 10:42796820-42796842 GAAGAAGAGGACTGCACTGCAGG + Exonic
1067811676 10:49432443-49432465 GAGGAGGAGGACTCTCCTAAGGG + Intergenic
1069466626 10:68645439-68645461 GATGGGGAGGAATTCTCTGATGG - Exonic
1069839200 10:71328526-71328548 GATGAGGAGGCCTCCCCCGCTGG + Intronic
1071964182 10:90835412-90835434 TATGATGAGGTCTCCACTTAGGG + Intronic
1074299229 10:112218357-112218379 GATGGAGAGGACTTCACTGAAGG + Intergenic
1074899553 10:117804384-117804406 GATGGGAAGGACATCACTGAGGG + Intergenic
1076462648 10:130657022-130657044 GAGGAGGAGCACTACACTGGAGG + Intergenic
1076701557 10:132275792-132275814 GCTGAGGAGGTTTCCGCTGAAGG - Intronic
1077176320 11:1192736-1192758 TTTGAGCAGGACTCCACTAAAGG + Intronic
1079662987 11:23065130-23065152 GATGTGGAGGACAACATTGAGGG - Intergenic
1081434482 11:43011901-43011923 GATGCAGAGGACTCCAAGGATGG - Intergenic
1083988232 11:66230835-66230857 GAAGAGGAGCACGCCCCTGAAGG + Exonic
1084503376 11:69549497-69549519 GATAAGGTGGATTCCACTGATGG - Intergenic
1085465804 11:76722464-76722486 GATGTGGAGGGCTTCACAGAAGG - Intergenic
1086609944 11:88743537-88743559 TATGAGGAGGTCACCATTGAGGG - Intronic
1087130505 11:94665760-94665782 GATGAGGAAGACTCTGCTGGTGG + Intergenic
1089686010 11:120147259-120147281 GATGACGAGGACTCCAAGGTGGG - Intronic
1091710464 12:2736572-2736594 TATAAGGAAGACTCCACTGCAGG - Intergenic
1093683421 12:22029678-22029700 GATGGGGAGGATTCCACAGCCGG + Intergenic
1096369054 12:51053223-51053245 GATCAGGAAGAGTTCACTGAAGG + Intronic
1096543704 12:52322823-52322845 GATGAGGAGGACTCCACTGATGG + Intergenic
1096764560 12:53873191-53873213 GATGAAGAGGTCTTCATTGAGGG - Intergenic
1097211770 12:57376298-57376320 GATGAGAAGAAATCCACTGAAGG - Intronic
1097629519 12:62042915-62042937 GATGATGAGGACCCTACAGAAGG - Intronic
1102829362 12:115982472-115982494 GCAGAGGAGGACTCCACTTCTGG - Exonic
1103044858 12:117727540-117727562 GAGGAGGAGGAACACACTGAGGG + Intronic
1106619544 13:31360326-31360348 GATGAAGAGTTCTTCACTGATGG + Intergenic
1107195019 13:37641141-37641163 GATGAGTAAGATTCTACTGAAGG - Intronic
1113100691 13:106714324-106714346 GGTGAGGAGGGTCCCACTGAAGG - Intergenic
1113381902 13:109812183-109812205 GATGACAAGGACCCCAGTGATGG + Intergenic
1114253653 14:20983263-20983285 GATGAGGAGGAGGCTGCTGATGG - Intergenic
1116886259 14:50224414-50224436 GATGAGGAGGAATCAAGGGAAGG + Intronic
1117730028 14:58713057-58713079 CTGGAGGATGACTCCACTGATGG + Intergenic
1119261596 14:73241051-73241073 GCTGAGCAGGACTCCTCTGCAGG + Intronic
1121548433 14:94780014-94780036 GAAAAGGAAGACTCCAGTGACGG - Intergenic
1122523778 14:102365235-102365257 GATGAGAAAGAGTCCATTGAAGG + Intronic
1124611313 15:31211209-31211231 AATGAGGAGTAATCCACTGGGGG - Intergenic
1127701000 15:61500976-61500998 GAGAAGGAGGACTCCAGGGAGGG + Intergenic
1128474378 15:67984578-67984600 GATGACGGGCACTCCAGTGATGG - Intergenic
1128748674 15:70133001-70133023 GAAGAGGTGGTCTTCACTGAGGG - Intergenic
1130536875 15:84792125-84792147 GATGCTGAGGGCTTCACTGAAGG + Intronic
1133257625 16:4527013-4527035 GGTGAAGAGCACACCACTGAAGG + Intronic
1136454399 16:30372134-30372156 GAGGAGGAGGACTCCAAAAAGGG - Intronic
1139530358 16:67539668-67539690 GATGAGGAGGACTCCAGCAGAGG - Intronic
1141054156 16:80801237-80801259 GATGATGAGAACTCCACTACAGG + Intronic
1141229558 16:82152674-82152696 GCTGAGCACGACACCACTGATGG + Intronic
1141824897 16:86472073-86472095 CATGAGGAGGCCTCCAGGGAGGG - Intergenic
1142291879 16:89197005-89197027 GATGAGGAGGCCTCCAGAAATGG - Intronic
1148219677 17:45852665-45852687 GAAGAGGATGACTCCACTTCCGG - Intergenic
1150264602 17:63824189-63824211 GATGAGGAGGACTCAACAGCTGG - Exonic
1152478809 17:80536621-80536643 GATGAGGAGAACAACACAGATGG - Intergenic
1155171358 18:23269115-23269137 GATGATGAGGGTTCCACAGATGG + Intronic
1157202053 18:45667905-45667927 GATGATGAGGATGCCGCTGAGGG - Exonic
1157569935 18:48705575-48705597 GGTGAGGAGGACTTTACAGATGG + Intronic
1157752908 18:50194629-50194651 GACGAGGAGGACACCGCGGAGGG + Intronic
1158780431 18:60642984-60643006 AATGAAAAGGACTTCACTGAAGG - Intergenic
1158940621 18:62403582-62403604 GATGAGGAGAACAACACAGATGG - Intergenic
1161456398 19:4371840-4371862 GCTGAGGAGGACTGCAGGGAGGG - Intronic
1161553042 19:4924757-4924779 GATGAAGATGACTCCACAGAGGG - Intronic
1162186001 19:8905452-8905474 GATGAGGATGATGCCAGTGATGG - Intronic
1163544607 19:17933542-17933564 GAGGAGGTGGACTCCCCAGATGG - Intronic
1166009984 19:39934901-39934923 GATGAGGAGGCCTACAGTCAGGG + Intergenic
1166948748 19:46412812-46412834 AAGGAGGAGGACTCCACGGTGGG - Exonic
926698257 2:15785472-15785494 GCTGAGGACGACTCCACCCAAGG + Intergenic
930744420 2:54866974-54866996 CAGGAGGAGGACGACACTGAGGG - Intronic
933276256 2:80287512-80287534 GATGACGAGGATGACACTGATGG + Intronic
933320708 2:80772460-80772482 AATGAGCAGGTCTCCACTGTGGG - Intergenic
938225319 2:129610951-129610973 CTTGAGGAGGGCTCCACAGATGG - Intergenic
940686987 2:156864175-156864197 GATGAGGAATACTTCACTGCAGG + Intergenic
947931448 2:233968354-233968376 GATGAGGAGGTTGCCACTGTGGG + Intronic
1169214388 20:3785075-3785097 GATGAGGAGAGCTCCTCGGAGGG - Exonic
1172009829 20:31840108-31840130 GATGGAGAGGACTACGCTGAGGG + Intergenic
1172461241 20:35120549-35120571 GAAGAGGAGGCCTCCCATGAGGG - Intronic
1173082282 20:39879711-39879733 CATGAGAAGGACTCAACTGATGG + Intergenic
1173192962 20:40890190-40890212 GAGGAGGAAAACTCCACTGCTGG + Intergenic
1173446848 20:43127083-43127105 GATTAGGAGGAATCCAAAGAAGG - Intronic
1173478583 20:43381624-43381646 GCTGAGGAGGCCTCCAATCATGG + Intergenic
1175031594 20:55960275-55960297 CATCATGAAGACTCCACTGATGG - Intergenic
1175237601 20:57525276-57525298 GATGAGGAGGACCCCAGAGGGGG + Intronic
1179880786 21:44292572-44292594 CATGATGGGGACTCCACTGCAGG - Intronic
1179889796 21:44329797-44329819 AATGAGGAGGTCTTCACGGATGG - Intronic
1180709770 22:17831853-17831875 GAGGAGGAAGAGTCCAGTGAAGG - Exonic
1180917579 22:19499634-19499656 GATGGGGAGCCCACCACTGAGGG - Intronic
1183691643 22:39393076-39393098 GCTGAGCAGGACTGCACTCATGG - Intergenic
1185002500 22:48254439-48254461 GAGGAGGAGGACTCCAGAGAAGG + Intergenic
950528535 3:13539143-13539165 GAAGCTGAGGAGTCCACTGAAGG - Intergenic
950855427 3:16100219-16100241 GAGGAAGAGTACTCCACTCAGGG + Intergenic
952057517 3:29466010-29466032 GATCAGCATGACTCCACTGCAGG + Intronic
954415264 3:50390378-50390400 GATGAGGAGGCCTCCTCTGAGGG + Intronic
958652956 3:96961732-96961754 GATAACAAGGACTCCACTGCTGG - Intronic
959702695 3:109312959-109312981 GATGAGGAGGAAGGCCCTGAGGG - Intronic
960375324 3:116893385-116893407 CATGAAGGGGATTCCACTGAGGG - Intronic
961812127 3:129527981-129528003 GCTGAGGAGGACTCAAATGTGGG - Intergenic
963345154 3:144087421-144087443 CATGAGGAGCACTAGACTGAAGG + Intergenic
964858217 3:161170587-161170609 GATGAGGAACAGTCCACTTAGGG + Intronic
965772000 3:172191389-172191411 GATGAGGAGGACAATAATGATGG - Intronic
965941308 3:174185272-174185294 GATGAGGAGGAGTGAACTGGTGG - Intronic
971502812 4:27334739-27334761 GATGAGGAGTACTTCCCTAATGG - Intergenic
971522512 4:27571730-27571752 GATGAGGAGCAGTCCAATGTTGG - Intergenic
974088573 4:57287001-57287023 GGTGAGGTGGAAGCCACTGAAGG - Intergenic
975601534 4:76105211-76105233 GATGAGCAAGACCCCAATGATGG - Intronic
976404034 4:84641722-84641744 GATCAGGAGGGTTCCACTGGAGG - Intronic
991670021 5:69038168-69038190 CATGAGGAGGAATCTCCTGAAGG + Intergenic
992472137 5:77068562-77068584 GACAATGAGGAATCCACTGAAGG + Intergenic
997468128 5:134101758-134101780 GCTGACGAGGACCCCAGTGAGGG - Intergenic
997519906 5:134516331-134516353 GATGAGGTGGCCTCCTCTAAAGG - Intergenic
998515150 5:142746827-142746849 AATGAGACTGACTCCACTGAGGG + Intergenic
998719330 5:144926814-144926836 GAGGAGGAGGGCACAACTGAGGG - Intergenic
1000379395 5:160615261-160615283 GAGGAGGAGGACCCAATTGAAGG - Intronic
1002040411 5:176509576-176509598 GACCAGAAGGGCTCCACTGAGGG - Exonic
1003163721 6:3658088-3658110 GATGAGCAGGAATTCACTGCAGG + Intergenic
1003392083 6:5723043-5723065 GTTGGGGAAGACTCCACAGATGG + Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1006466371 6:34197086-34197108 GATGGGGAGGACTCCAGTACTGG - Intergenic
1008130666 6:47717309-47717331 GATGAGGATGTCTTCACTGAAGG + Exonic
1009988232 6:70807553-70807575 GATGAGGAGTACTCTATTAAAGG + Intronic
1012476500 6:99619324-99619346 GAAGAGGAGGACTCATCAGACGG + Intergenic
1015805385 6:137103012-137103034 GCTGAGGATCACACCACTGATGG - Intergenic
1018796549 6:167189935-167189957 GTTGAGGAGGGCCTCACTGAGGG + Intronic
1018819770 6:167365182-167365204 GTTGAGGAGGGCCTCACTGAGGG - Intronic
1019857912 7:3627759-3627781 GAAGAGGATGACTCAACTGTGGG - Intronic
1021118632 7:16772228-16772250 CATGATAAGGATTCCACTGATGG + Intronic
1023309851 7:38874431-38874453 GTTGAGGAGTGCTCCACTGGTGG - Intronic
1024943091 7:54782512-54782534 GAGGAGGAGGTGTCCACAGATGG + Intergenic
1024980886 7:55156617-55156639 GATGTGGAGATCGCCACTGATGG - Exonic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1027055119 7:75044364-75044386 GCTGAGGTGGACTCCACTTGAGG + Intronic
1027440482 7:78214034-78214056 CATGAGGAGGTCTCCAATTATGG - Intronic
1028005514 7:85561433-85561455 GATGAAGAGGACACCACAGCAGG + Intergenic
1029254104 7:99257419-99257441 GCTGAAGTGGACACCACTGAGGG + Intergenic
1031072669 7:117179646-117179668 GATGAGGAGGGATGCAGTGAAGG + Intronic
1032291609 7:130593371-130593393 GAAGAGGCAAACTCCACTGAAGG + Intronic
1037142044 8:15531619-15531641 GATGAGGGGCATTCAACTGAGGG - Intronic
1038242373 8:25821797-25821819 AAAGAGGAGGAGGCCACTGAGGG + Intergenic
1038567901 8:28635059-28635081 AATGAGGATGAGTCCTCTGAAGG + Intronic
1044957716 8:97498715-97498737 GATGTGGAAGAGTCCACTGGAGG - Intergenic
1046101471 8:109619070-109619092 GATGAGGAGGAAATCAATGATGG + Intronic
1048032496 8:130645895-130645917 GAGGAGGAGGACGCCTCTGAAGG + Intergenic
1048448235 8:134509053-134509075 GATGGTGAAGTCTCCACTGAGGG + Intronic
1049619124 8:143589879-143589901 GATGAGGCGGAAGCCCCTGACGG - Exonic
1052070413 9:24074727-24074749 GATGAGGAGGACACTACTTCTGG + Intergenic
1053071767 9:35106112-35106134 GGTGAGGAGAACTCTACTGTAGG - Intronic
1057876203 9:98756404-98756426 GATGAGGGTGAGTCCCCTGAGGG - Exonic
1060779332 9:126400064-126400086 CAGGAGCAGGACTCCACTCAGGG - Intronic
1186167630 X:6843780-6843802 GAGCAGGAAGACTGCACTGATGG - Intergenic
1187558328 X:20374338-20374360 TATGAGGAGCCCTCCACTGAAGG + Intergenic
1189082813 X:37992486-37992508 CATGAGGAGGACTGCTCAGAGGG - Intronic
1190339591 X:49286221-49286243 GGTGGGGAGGGCTCCACAGATGG + Exonic
1192962564 X:76145578-76145600 GATCTGGAGCAGTCCACTGAGGG - Intergenic
1192962969 X:76149509-76149531 GATCTGGAGCAGTCCACTGAGGG + Intergenic