ID: 1096544525

View in Genome Browser
Species Human (GRCh38)
Location 12:52328383-52328405
Sequence ACTCACAGCGTCCGGAGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096544525_1096544530 -3 Left 1096544525 12:52328383-52328405 CCACTGCTCCGGACGCTGTGAGT No data
Right 1096544530 12:52328403-52328425 AGTCTCTGGGTGCTGCCTGAGGG No data
1096544525_1096544531 3 Left 1096544525 12:52328383-52328405 CCACTGCTCCGGACGCTGTGAGT No data
Right 1096544531 12:52328409-52328431 TGGGTGCTGCCTGAGGGTGCAGG No data
1096544525_1096544529 -4 Left 1096544525 12:52328383-52328405 CCACTGCTCCGGACGCTGTGAGT No data
Right 1096544529 12:52328402-52328424 GAGTCTCTGGGTGCTGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096544525 Original CRISPR ACTCACAGCGTCCGGAGCAG TGG (reversed) Intergenic