ID: 1096544528

View in Genome Browser
Species Human (GRCh38)
Location 12:52328391-52328413
Sequence ACCCAGAGACTCACAGCGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096544528_1096544531 -5 Left 1096544528 12:52328391-52328413 CCGGACGCTGTGAGTCTCTGGGT No data
Right 1096544531 12:52328409-52328431 TGGGTGCTGCCTGAGGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096544528 Original CRISPR ACCCAGAGACTCACAGCGTC CGG (reversed) Intergenic