ID: 1096544529

View in Genome Browser
Species Human (GRCh38)
Location 12:52328402-52328424
Sequence GAGTCTCTGGGTGCTGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096544518_1096544529 28 Left 1096544518 12:52328351-52328373 CCTCATGGGTCTGAGCAGCAGGG No data
Right 1096544529 12:52328402-52328424 GAGTCTCTGGGTGCTGCCTGAGG No data
1096544516_1096544529 29 Left 1096544516 12:52328350-52328372 CCCTCATGGGTCTGAGCAGCAGG No data
Right 1096544529 12:52328402-52328424 GAGTCTCTGGGTGCTGCCTGAGG No data
1096544515_1096544529 30 Left 1096544515 12:52328349-52328371 CCCCTCATGGGTCTGAGCAGCAG No data
Right 1096544529 12:52328402-52328424 GAGTCTCTGGGTGCTGCCTGAGG No data
1096544525_1096544529 -4 Left 1096544525 12:52328383-52328405 CCACTGCTCCGGACGCTGTGAGT No data
Right 1096544529 12:52328402-52328424 GAGTCTCTGGGTGCTGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096544529 Original CRISPR GAGTCTCTGGGTGCTGCCTG AGG Intergenic