ID: 1096544530

View in Genome Browser
Species Human (GRCh38)
Location 12:52328403-52328425
Sequence AGTCTCTGGGTGCTGCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096544518_1096544530 29 Left 1096544518 12:52328351-52328373 CCTCATGGGTCTGAGCAGCAGGG No data
Right 1096544530 12:52328403-52328425 AGTCTCTGGGTGCTGCCTGAGGG No data
1096544525_1096544530 -3 Left 1096544525 12:52328383-52328405 CCACTGCTCCGGACGCTGTGAGT No data
Right 1096544530 12:52328403-52328425 AGTCTCTGGGTGCTGCCTGAGGG No data
1096544516_1096544530 30 Left 1096544516 12:52328350-52328372 CCCTCATGGGTCTGAGCAGCAGG No data
Right 1096544530 12:52328403-52328425 AGTCTCTGGGTGCTGCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096544530 Original CRISPR AGTCTCTGGGTGCTGCCTGA GGG Intergenic